CN117660416A - Glycosyl hydrolase, gene, vector, host cell and application - Google Patents

Glycosyl hydrolase, gene, vector, host cell and application Download PDF

Info

Publication number
CN117660416A
CN117660416A CN202211100249.0A CN202211100249A CN117660416A CN 117660416 A CN117660416 A CN 117660416A CN 202211100249 A CN202211100249 A CN 202211100249A CN 117660416 A CN117660416 A CN 117660416A
Authority
CN
China
Prior art keywords
glycosyl hydrolase
ginsenoside
seq
amino acid
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211100249.0A
Other languages
Chinese (zh)
Inventor
史社坡
刘晓
万建波
罗源
张蓓蓓
王娟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Macau
Beijing University of Chinese Medicine
Original Assignee
University of Macau
Beijing University of Chinese Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Macau, Beijing University of Chinese Medicine filed Critical University of Macau
Priority to CN202211100249.0A priority Critical patent/CN117660416A/en
Publication of CN117660416A publication Critical patent/CN117660416A/en
Pending legal-status Critical Current

Links

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses glycosyl hydrolase, a gene, a vector, a host cell and application. The glycosyl hydrolase is (a) or (b): (a) Glycosyl hydrolase with the amino acid sequence shown as SEQ ID NO. 1; (b) Glycosyl hydrolase derived from (a) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1. The glycosyl hydrolase provided by the invention can selectively hydrolyze the glucose group on the 3 rd carbon of PPD type ginsenoside.

Description

Glycosyl hydrolase, gene, vector, host cell and application
Technical Field
The invention relates to glycosyl hydrolase, and a coding gene, a vector, a host cell and application thereof.
Background
Ginsenoside is the most representative active component in Panax plant, and has abundant and various structures due to the difference of aglycone structure and sugar type, number and connection position of sugar on sugar chain, such as ginsenoside Ra and Rb 1 、Rb 2 、Rb 3 、Rc、Rd、Re、Rf、Rg 1 Etc. Pharmacological studies show that the ginsenoside components have the activities of delaying aging, protecting nerves, improving immunity, inhibiting tumor cell growth and the like. However, as most ginsenoside components contain a plurality of glycosyl groups, the molecular weight is large, the ginsenoside components are not easy to be absorbed by human body, and the glycosyl groups in the structure are partially hydrolyzed under the action of intestinal flora in the human body and are converted into rare ginsenoside with relatively small molecular weight, such as Rg 3 、Rh 2 、Rh 3 、Rk 2 And the like, the water solubility and the fat solubility of the components are increased, the pharmacological activity is enhanced, and the components have better activity in the aspect of resisting tumors.
In the study of the structure-activity relationship between ginsenoside and antitumor activity, researchers found that the activity of different types of ginsenoside was expressed as follows: monoglycoside > bisglycoside > trisaccharide > tetrasaccharide.
However, rare ginsenosides with relatively few glycosyl groups in the structure are very low in content in the ginseng genus plants, and the rare ginsenosides are prepared by simply extracting the ginsenosides from the plants, so that the production cost is very high, the plant resource consumption is huge, and the problems that the selectivity is poor, the aglycone structure is easily damaged and the like are also involved in the preparation of the rare ginsenosides by using a chemical hydrolysis method. The biological method, especially the biological enzyme method, can selectively hydrolyze specific glycosidic bonds under mild conditions, thereby realizing green and efficient preparation of rare ginsenoside and obtaining rare ginsenoside with low cost. Glycosyl hydrolases are a class of enzymes that catalyze the above reactions, and current methods for preparing certain rare ginsenosides using glycosyl hydrolases are also of interest.
CN102762738A discloses a ginsenoside glycosidase and application thereof, and the glycosidase is used for preparing ginsenoside Rb 1 、Rb 3 Glucopyranose or arabinopyranose on carbon 20 or 3 of Rd, rc is selectively hydrolyzed to have high active substances absorbable in vivo to convert PPD-like saponins into deglycosylated.
CN108064309A discloses an enzyme-catalyzed synthesis of ginsenoside Rh 2 The method uses ginsenoside Rg 3 Adding specific glucosidase into substrate to perform catalytic reaction, hydrolyzing 20 th glucose to obtain ginsenoside Rh 2 。
Although there have been reports of the preparation of rare ginsenosides using microorganism-derived glycoside hydrolase, there have been no reports of glycosyl hydrolases that specifically and universally hydrolyze the beta-1, 2-glucosidic bond on the 3-carbon sugar chain of protopanaxadiol (PPD) type saponin.
Disclosure of Invention
In view of the above, an object of the present invention is to provide a glycosyl hydrolase for selectively hydrolyzing a glucose group at the 3 rd carbon of PPD-type ginsenoside, which glycosyl hydrolase has a specific catalytic site and can selectively hydrolyze a glucose group at the 3 rd carbon of PPD-type ginsenoside.
It is another object of the present invention to provide a nucleotide sequence encoding the above glycosyl hydrolase.
It is still another object of the present invention to provide a recombinant expression vector comprising the above nucleotide sequence.
It is a further object of the present invention to provide a host cell containing a nucleotide sequence or a recombinant expression vector.
It is a further object of the present invention to provide the use of any one of the glycosyl hydrolase as described above, the nucleotide sequence as described above, the recombinant expression vector as described above and the recombinant host cell as described above for selectively hydrolyzing the glucosyl group on carbon 3 of PPD-type ginsenoside.
The invention adopts the following technical scheme to realize the aim.
In one aspect, the present invention provides a glycosyl hydrolase for selectively hydrolyzing a glucosyl group on carbon 3 of PPD-type ginsenoside, the glycosyl hydrolase being (a) or (b):
(a) Glycosyl hydrolase with the amino acid sequence shown as SEQ ID NO. 1;
(b) Glycosyl hydrolase derived from (a) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1.
The invention also provides a glycosyl hydrolase which is derived from a ginseng plant and is a homologous amino acid sequence of the glycosyl hydrolase.
The glycosyl hydrolase according to the invention preferably has a similarity to the glycosyl hydrolase according to (a) or (b) of at least 80%.
The glycosyl hydrolase according to the present invention is preferably any of the following:
(c) Glycosyl hydrolase with an amino acid sequence shown as SEQ ID NO. 4;
(d) Glycosyl hydrolase derived from (c) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 4;
(e) Glycosyl hydrolase with an amino acid sequence shown as SEQ ID NO. 6;
(f) Glycosyl hydrolase derived from (e) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 6.
In another aspect, the present invention provides a nucleotide sequence encoding the glycosyl hydrolase described above.
Preferably, the nucleotide sequence encoding the glycosylhydrolase of (a) is as shown in SEQ ID NO. 2; the nucleotide sequence of the coded glycosyl hydrolase is shown as SEQ ID NO. 3; the nucleotide sequence of the glycosyl hydrolase of the code (e) is shown as SEQ ID NO. 5.
In yet another aspect, the present invention provides a recombinant expression vector comprising the nucleotide sequence described above.
The recombinant expression vector according to the present invention is preferably used as pET32a.
In yet another aspect, the present invention provides a recombinant host cell comprising the nucleotide sequence described above or the recombinant expression vector described above.
The recombinant host cell according to the invention is preferably used in a host cell selected from the group consisting of bacteria, actinomycetes, filamentous fungi, yeasts, plant cells or animal cells.
In a further aspect, the present invention provides the use of any one of a glycosyl hydrolase as described above, a nucleotide sequence as described above, a recombinant expression vector as described above and a recombinant host cell as described above for selectively hydrolysing the glucosyl group on carbon 3 of a PPD-type ginsenoside.
Preferably, according to the application of the present invention, the PPD type ginsenoside comprises notoginsenoside R 4 Ginsenoside Ra 1 Ginsenoside Ra 2 Ginsenoside Ra 3 Ginsenoside Rb 1 Ginsenoside Rb 2 Ginsenoside Rb 3 Ginsenoside Rc, ginsenoside Rd, ginsenoside Rg 3 。
According to the application of the present invention, preferably, the PPD type ginsenoside is a dammarane type ginsenoside mixture with beta-1, 2-glucosyl group on 3-position carbon.
The glycosyl hydrolase with the homologous sequence can be obtained by separating and separating glycosyl hydrolase with the homologous sequence from various plants of the ginseng genus, wherein the glycosyl hydrolase can selectively hydrolyze the glucose group on the 3 rd carbon of PPD type ginsenoside. Glycosyl hydrolase (SEQ ID NO: 1) is isolated from Notoginseng radix, and the code is PnGH1; isolated glycosyl hydrolase (SEQ ID NO: 4) from ginseng, code PgGH1; glycosyl hydrolase (SEQ ID NO: 6) is isolated from American ginseng and has the code number PqGH1. The present invention finds that glutamic acid at positions 188, 232 and 425 is a key site for PnGH1 selective hydrolysis of the glucosyl group, wherein the glutamic acid at position 425 is particularly important. The invention also discloses the optimized nucleotide sequences for encoding the amino acid sequences, which are SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 5.
Drawings
FIG. 1 is an agarose gel diagram of glycosyl hydrolase gene PnGH1 identified in Notoginseng radix.
FIG. 2 shows SDS-PAGE gel of glycosylhydrolase PnGH1 (the position indicated by the arrow is the protein of interest).
FIG. 3 is a diagram showing the reaction EIC of PnGH1 catalyzed PPD type ginsenoside; wherein reference numerals are as follows: 1-notoginsenoside R 4 2-ginsenoside Ra 2 3-ginsenoside Ra 3 4-ginsenoside Rb 1 5-ginsenoside Rc, 6-ginsenoside Ra 1 7-ginsenoside Rb 2 8-ginsenoside Rb 3 9-ginsenoside Rd, 10-ginsenoside Rg3;11-PN04, 12-PN02, 13-PN03, 14-gypenoside XVII, 15-notoginsenoside Fe,16-PN01, 17-ginsenoside Rd 2 18-notoginsenoside Fd, 19-ginsenoside F2, 20-ginsenoside Rh 2 The method comprises the steps of carrying out a first treatment on the surface of the ", represents a new compound.
FIG. 4 is a schematic diagram of a stability experiment of PnGH 1.
FIG. 5 shows PnGH1 and its homologous proteins PgGH1 and PqGH1 respectively catalyzing ginsenoside Rb 3 HPLC profile of the reaction.
FIG. 6 shows the mutant pair ginsenoside Rb in the mutation experiment 3 Is a graph of the conversion results of (2).
FIG. 7 is a schematic diagram showing alignment of PnGH1 with sequence listings of homologous sequences PgGH1 and PqGH1.
Detailed Description
The present invention will be further described with reference to specific examples, but the scope of the present invention is not limited thereto.
< glycosyl hydrolase and Gene sequence >
In the art, the biosynthetic pathways of secondary metabolites in closely related plants are similar, as are the structure and function of enzymes (i.e., proteins) that catalyze these biosynthetic reactions. Proteins having homologous protein sequences are said to have the same ancestor of two or more protein sequences, whereas proteins having homologous sequences generally have similar functions. Thus, in plants of close relatedness, it is decisive to determine the first protein sequence with a certain catalytic action, and on the basis of this it is relatively simple to obtain from plants of close relatedness a homologous protein of this sequence with a similar structure and function.
The ginseng is a genus of Araliaceae, the genus has few plants, only eight species have been found in the world at present, and biological relatives are very close. Thus, when a protein sequence in one of the plants of the genus has a certain selective catalytic function, a functionally similar protein sequence homologous to the protein sequence can be easily isolated from the other plants of the genus.
The invention firstly separates and obtains a protein sequence with selective hydrolysis glycosyl from Panax notoginseng (academic name: panax notoginseng (Burkill) F.H.Chen ex C.H.), which can selectively catalyze and hydrolyze glycosyl on the 3 rd carbon of PPD type ginsenoside without influencing glycosyl on other positions in the ginsenoside structure. The inventors then isolated homologous sequences of the protein sequences from two plants, ginseng and American ginseng, respectively, of the genus Panax, and found that both had the same catalytic function. This also demonstrates the theory that when a protein sequence in a plant of a species having similar relationships has a selective catalytic function, proteins homologous to the protein sequence and functionally similar to the protein sequence can be isolated and identified very easily from the rest of the related plants. The invention separates and obtains the enzyme which can selectively catalyze and hydrolyze the glucosyl group on the 3 rd carbon of PPD type ginsenoside from the notoginseng. The glycosyl hydrolase and the nucleotide sequence for encoding the glycosyl hydrolase are obtained through further screening, identification and optimization.
The glycosyl hydrolase of the invention may be a natural protease or an enzyme comprising a mutation and still having selective glycosyl hydrolyzing activity. Preferably, the glycosyl hydrolase of the invention comprises (a) an amino acid sequence shown in SEQ ID NO. 1, or (b) an amino acid sequence with equivalent functions formed by substitution, deletion or addition of one or more amino acids to the amino acid sequence shown in SEQ ID NO. 1.
In certain embodiments, the amino acid sequence of the glycosyl hydrolase has 85% or more, preferably 90% or more, more preferably 92% or more, still more preferably 95% or more, still more preferably 98% or more, still more preferably 99% or more homology to the sequence shown in SEQ ID NO. 1 and is derived from the same species Panax notoginseng. In other embodiments, the glycosyl hydrolase may be produced by a recombinant cell containing a gene encoding the enzyme, and may be located intracellularly or extracellularly. "homology" in this application refers to the similarity between two sequences, which can be determined by any algorithm known in the art. For example, the degree of identity between two amino acid sequences can be determined using the Needleman-Wunsch algorithm. The amino acid sequence SEQ ID NO. 1 is sometimes referred to below simply as "PnGH1".
The glycosyl hydrolase of the present invention may be derived from a plant of the genus Panax and is a homologous amino acid sequence of the glycosyl hydrolase described in (a) or (b) above. Preferably, the glycosyl hydrolase has at least 80% similarity to the glycosyl hydrolase according to (a) or (b).
Glycosyl hydrolase can be any of the following:
(c) Glycosyl hydrolase with an amino acid sequence shown as SEQ ID NO. 4;
(d) Glycosyl hydrolase derived from (c) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 4;
(e) Glycosyl hydrolase with an amino acid sequence shown as SEQ ID NO. 6;
(f) Glycosyl hydrolase derived from (e) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 6.
In certain specific embodiments, a glycosyl hydrolase obtained from ginseng (academic: panax ginseng c.a. meyer) has the amino acid sequence shown in SEQ ID No. 4 (hereinafter sometimes abbreviated as "PgGH 1"). Glycosyl hydrolase encoded by the amino acid sequence of SEQ ID NO. 4 has similar selective hydrolytic activity as PnGH 1.
In other embodiments, a glycosyl hydrolase obtained from American ginseng (academic: panax quiquefolium L.) having the amino acid sequence shown in SEQ ID NO. 6 (hereinafter sometimes abbreviated as "PqGH 1"). Glycosyl hydrolase encoded by the amino acid sequence of SEQ ID NO. 6 has similar selective hydrolytic activity as PnGH 1.
The invention also provides a nucleotide sequence for encoding the glycosyl hydrolase. In certain embodiments, the nucleotide sequence encoding the glycosylhydrolase of (a) is shown in SEQ ID NO. 2. In other embodiments, the nucleotide sequence encoding the glycosylhydrolase of (c) is shown in SEQ ID NO. 3. In some embodiments, the nucleotide sequence encoding the glycosylhydrolase of (e) is shown in SEQ ID NO. 5.
< recombinant expression vector and recombinant host cell >
Cloning the gene encoding the glycosyl hydrolase into an expression vector to construct a recombinant expression vector. The expression vector used may be pET32a.
The gene encoding the glycosylhydrolase or the recombinant expression vector described above is used for expression in a host cell to form a recombinant host cell. The host cell used is selected from bacteria, actinomycetes, filamentous fungi, yeast, plant cells or animal cells. Preferably, the host cell used is E.coli.
< application >
The invention also provides the use of any one of the glycosyl hydrolase as described above, the nucleotide sequence as described above, the recombinant expression vector as described above and the recombinant host cell as described above for selectively hydrolyzing the glucosyl group on carbon 3 of PPD-type ginsenoside. Can selectively hydrolyze the glucose group on the 3 rd carbon of PPD type ginsenoside in various monomers, mixtures and biological samples.
In the present invention, the PPD type ginsenoside includes notoginsenoside R 4 Ginsenoside Ra 1 Ginseng radixSaponin Ra 2 Ginsenoside Ra 3 Ginsenoside Rb 1 Ginsenoside Rb 2 Ginsenoside Rb 3 Ginsenoside Rc, ginsenoside Rd, ginsenoside Rg 3 。
In certain embodiments, the PPD ginsenoside is notoginsenoside R 4 Ginsenoside Ra 1 Ginsenoside Ra 2 Ginsenoside Ra 3 Ginsenoside Rb 1 Ginsenoside Rb 2 Ginsenoside Rb 3 Ginsenoside Rc, ginsenoside Rd, ginsenoside Rg 3 One or more of the following.
According to one embodiment of the invention, the PPD-type ginsenoside is a dammarane-type ginsenoside mixture with beta-1, 2-glucosyl group on carbon 3. The ginsenoside mixture may be derived from plant tissue, cells, or microbial cell cultures of Panax.
According to a preferred embodiment of the present invention, the PPD-type ginsenoside is ginsenoside Rb 3 。
In the invention, pnGH1 can selectively hydrolyze notoginsenoside R 4 Ginsenoside Ra 1 Ginsenoside Ra 2 Ginsenoside Ra 3 Ginsenoside Rb 1 Ginsenoside Rb 2 Ginsenoside Rb 3 Ginsenoside Rc, ginsenoside Rd, ginsenoside Rg 3 . The starting materials and the selective hydrolysis products are shown in tables 1 and 2. Rare saponins can be prepared.
TABLE 1 PnGH1 catalytic hydrolysis of PPD type ginsenoside substrate
TABLE 2 PnGH1 catalytic PPD type ginsenoside conversion products
The substrate materials in Table 1 and the correspondence of the conversion products in Table 2 are illustrated in Table 3.
TABLE 3 Table 3
In the present invention, the selective hydrolysis reaction comprises the steps of: mixing the solution containing glycosyl hydrolase with substrate (PPD type ginsenoside), reacting at 35-55 deg.C for 1-55 h, stopping reaction, and centrifuging; wherein the mass ratio of glycosyl hydrolase to substrate is 1:8-16, preferably 1:10-15, more preferably 1:12-14.
In certain embodiments, the reaction system of the present invention may further comprise a buffer. The buffer may be Tris-HCl,0.5mm, ph=7.4.
In certain embodiments, the reaction system comprises 50. Mu.M substrate, 2 to 5. Mu.g glycosylhydrolase and 20mM buffer, in 100. Mu.L, and an equal scale up of the reaction system.
In the present invention, methanol, ethanol, etc. may be used for terminating the reaction.
The reaction temperature may be 35 to 55 ℃, preferably 40 to 55 ℃, more preferably 50 to 55 ℃. The reaction time may be 1 to 55 hours, preferably 1.5 to 50 hours, more preferably 2 to 12 hours.
According to one embodiment of the present invention, a solution containing glycosyl hydrolase is mixed with a substrate (PPD ginsenoside), reacted at 45 to 50 ℃ for 1 to 10 hours, the reaction is terminated, and centrifugation is performed.
EXAMPLE 1 glycosyl hydrolasePnGh1And the obtaining of the coding gene thereof
Fresh leaf tissue of pseudo-ginseng is selected, a liquid nitrogen flash-freezing grinding method is adopted, and total RNA is extracted by using an RNA extraction kit. And (3) primarily judging the quality of RNA through gel electrophoresis, determining the concentration of the RNA by using a Nanodrop 2000 spectrophotometer, and submitting one part of the extracted RNA to transcriptome sequencing and using the other part of the extracted RNA for reverse transcription amplification of a cDNA template after gel electrophoresis analysis and concentration determination are qualified.
mu.L of RNA (10 pg-5. Mu.g) of the leaves of Panax notoginseng were respectively extracted and placed in RNase-free separationInto the tube (200. Mu.L), 7. Mu.L dd H was added 2 O, heating at 65℃for 5min, then rapidly quenching on ice, and standing on ice for 2min. Taking the mixture of the previous step, adding 2 μL of 5 XgDNA with Mix, lightly blowing and mixing with a pipette, heating at 42 ℃ for 2min, adding 2 μL of 10 xRT Mix,2 μ L HiScript III Enzyme Mix,1 μL of Oligo (dT) 20VN,5 μL of dd H into the mixture of the previous step 2 O, 20 mu L of the system is added, the mixture is lightly blown and mixed by a pipetting gun, and the mixture is subjected to PCR at 37 ℃ for 45min; reverse transcription was performed at 85℃for 5s to obtain cDNA. The reverse transcribed pseudo-ginseng leaf cDNA is used as a template, and specific primers are respectively designed and synthesized according to the sequencing result of a transcriptome, wherein the forward primer is ATGCTCAGCCCTGCTCTTGT, and the reverse primer is TTAAGATGAACTTGTCGTAATATGGG. PCR amplification was performed using the Phanta Super-Fidelity DNA Polymerase enzyme with forward primer (10. Mu.M): 2. Mu.L; reverse primer (10. Mu.M): 2. Mu.L; cDNA template: 1 μl; dNTP Mix (10 mM): 1 μl; phanta Super-Fidelity DNA Polymerase:1 μl;5 XSF Buffer: 10. Mu.L; dd H 2 O: 33. Mu.L; a total of 50. Mu.L of system. The amplification procedure was 95℃for 3min;95 ℃,10s,58 ℃,15s,72 ℃,1min,35cycles;72℃for 5min. And (3) recovering the PCR product by using a product recovery kit to obtain the full-length sequence of PnGh1, wherein an agarose gel electrophoresis diagram is shown in figure 1.
EXAMPLE 2 selection, construction and expression of recombinant plasmids
The target gene PnGh1 obtained by amplification in example 1 and an expression vector pET32a are connected by using Clonexpress seamless cloning ligase according to a seamless cloning connecting system at 37 ℃ for 30min, a connecting product is transferred into clone strain Trans1-T1 phase resistance competent cells, colony PCR screening is carried out after overnight culture, screened positive clone bacterial liquid is amplified and cultured in LB culture medium (ampicillin, 100 mg/mL), bacterial bodies are collected, plasmids are extracted by using a plasmid small extraction kit, and sequencing verification sequences are carried out.
The recombinant plasmid pET32a-PnGh1 with correct sequencing is transferred into an escherichia coli expression strain E.coli Transetta (DE 3), screened and cultured on an ampicillin-containing LB solid medium plate, single colonies which are positive and correct in sequencing and screened by colony PCR are picked, subjected to small-scale culture in an LB liquid medium, and activated overnight at 37 ℃ (ampicillin-containing 100 mg/mL).
Amplifying culturing the activated bacterial liquid in LB liquid medium (ampicillin, 100 mg/mL) at a ratio of 1:100 (V/V), and culturing at 37deg.C to OD 600 At values between 0.4 and 0.6, IPTG was added to a final concentration of 0.5mM, the low temperature culture was continued at 18℃and expression was induced for 18h. The cells were collected by centrifugation (7500 Xg) at 4℃for 5min, the collected cells were resuspended in pre-chilled lysis buffer, 1% (V/V) glycerol was added, and sonicated in an ice bath, the procedure set to: crushing for 2s, stopping for 4s, and crushing for 10min in total. Crushing the mixed solution at 4 ℃,8000 Xg, centrifuging for 40min, collecting supernatant containing target protein, purifying PnGH1 protein by using a nickel ion affinity chromatography column, eluting the target protein by using an imidazole gradient of 20-500 mM, combining the target protein-containing fractions, centrifuging and concentrating by using a Centricon Plus-30 Millipore ultrafiltration centrifuge tube, eluting by using a desalting buffer solution to remove imidazole, concentrating to a proper concentration, and packaging at-80 ℃. Protein purity was checked by SDS-PAGE gel electrophoresis, and the results are shown in FIG. 2, while protein concentration was measured by BCA method.
EXAMPLE 3 glycosyl hydrolasePnGH1 3 Hydrolyzing ginsenoside Rb to obtain notoginsenosideFd
Ginsenoside Rb 3 As a substrate, an in vitro enzymatic reaction is carried out under the action of PnGH1 enzyme, and the enzyme reaction product is analyzed by utilizing LCMS-IT-TOF. 100. Mu.L of the system contains an enzyme (PnGH 1, 0.03. Mu.g/. Mu.L), a substrate (ginsenoside Rb) 3 0.5 mM), buffer (Tris-HCl, 0.5mM,pH 7.4), water bath reaction at 50 ℃ for 2 hours, adding 2 times of methanol to stop the reaction, shaking and mixing uniformly, centrifuging at 12 rpm for 30 minutes, and sucking the supernatant for liquid phase detection. Liquid phase detection is carried out by taking 20 mu L of the liquid phase detector into an Agilent 1260 analysis type high performance liquid chromatograph, and 15 mu L of the liquid phase detector into an LCMS-IT-TOF liquid chromatograph.
Liquid phase analysis conditions: the chromatographic column is Aglient C 18 Columb (4.6mm.times.250 mm,5 μm), flow rate of 0.8mL/min, DAD detector full-wave scanning, mobile phase gradient elution with 0.1% formic acid water (A) -acetonitrile (B), elution procedure of 0-3min,15% B;3-12min,15% -35% B;12-18min, 35-40％B；18-23min，40％-50％B；23-25min，50％-95％B；25-35min，95％-15％B。
Liquid analysis conditions: the chromatographic column is Agilent extension C 18 The chromatographic column (4.6mm×250mm,5 μm) was scanned at a flow rate of 0.8mL/min over the full wavelength of SPD-M20A detector, the mobile phase was eluted with an acetonitrile-0.1% aqueous formic acid gradient, the elution procedure was identical to the liquid phase elution procedure, and the product structure was analyzed based on mass spectral data of the enzyme reaction product and mass spectral data comparison with the standard. The enzyme reaction product is identified as notoginsenoside Fd, and the nuclear magnetic data of the product are as follows:
HR-ESI-MS gives [ M+HCOO ]] - Peak, m/z:961.5378 predicted molecular formula C 47 H 80 O 17 。 1 H NMR(500MHz,pyridine-d 5 )δ H :4.06 (1H, m, H-1 a), 2.83 (1H, overlap, H-1 b), 2.40 (1H, overlap, H-2 a), 1.44 (1H, overlap, H-2 b), 2.59 (1H, overlap, H-3 a), 2.42 (1H, overlap, H-3 b), 2.63 (1H, overlap, H-6 a), 2.32 (1H, d, J=19.0 Hz, H-6 b), 1.98 (1H, overlap, H-8 a), 1.98 (1H, overlap, H-8 b), 3.87 (1H, m, H-9 a), 3.20 (1H, m, H-9 b), 2.71 (1H, overlap, H-10 a), 1.98 (1H, overlap, H-10 b), 2.83 (1H, overlap, H-11 a), 2.71 (1H, overlap, H-11 b), 2.51 (1H, overlap, H-14 a), 1.90 (1H, d, J=15.0 Hz, H-14 b), 2.09 (1H, m, H-15), 1.13 (3H, d, J=6.5 Hz, H) 3 -16)。 13 C NMR (125 MHz, pyridine-d) 5 )δ C :39.4 (C-1), 26.2 (C-2), 89.1 (C-3), 39.8 (C-4), 56.7 (C-5), 18.7 (C-6), 35.3 (C-7), 40.3 (C-8), 50.6 (C-9), 37.3 (C-10), 31.1 (C-11), 70.4 (C-12), 49.5 (C-13), 51.8 (C-14), 31.2 (C-15), 27.2 (C-16), 52.0 (C-17), 16.3 (C-18), 16.7 (C-19), 83.8 (C-20), 36.8 (C-21), 36.8 (C-22), 23.5 (C-23), 126.4 (C-24), 131.4 (C-25), 26.9 (C-26), 18.3 (C-27), 28.5 (C-28), 17.2 (C-29), 17.8 (C-9), 16.3 (C-9), 16.8 (C-8), 16.8 (C-35), 16) and (C-35.8 (C-9), and (C-35) glc-8 (C-3), and (C-8) as glc-3, 35 (C-8), and (C-8) as glc-3.8 (C-8) and (C-7 (C-3) and 3.7 (C-8) and 35 (C-7) and (C-8) and 35 (C-3). 75.3 (C-glc-2 "), 78.4 (C-glc-3"), 72.3 (C-glc-4 "), 77.4 (C-glc-5"), 71.5 (C-glc-6 "), 106.3 (C-glc-1 '), 76.2 (C-glc-2 '), 79.2 (C-glc-3 '), 72.0 (C-glc-4 '), 68.1 (C-glc-5 '). The data are compared with the literature to identify the enzyme reaction product as threeHeptasaponin Fd.
EXAMPLE 4 glycosyl hydrolase PnGH1 hydrolyzes other PPD-type ginsenosides
The reaction products were analyzed and detected by LC-MS to determine the products obtained after selective hydrolysis of the different substrates. The result shows that PnGH1 can catalyze ginsenoside Rb 1 Ginsenoside Rb 2 Ginsenoside Ra 1 Ginsenoside Ra 2 Ginsenoside Ra 3 Ginsenoside Rc, ginsenoside Rd, ginsenoside Rg 3 Notoginseng radix saponin R 4 The hydrolysis of the 1, 2-linked glucose on the C-3 (carbon 3) sugar chain of the isoparaffin diol type triterpene saponin (see Table 1, table 2 and Table 3 above) was carried out, and in addition, the substrate was completely converted when the reaction time was prolonged to 48 hours. The EIC analysis is shown in fig. 3.
Example 5 stability investigation of PnGH1 protein
Accurately preparing ginsenoside Rb with concentration of 1mg/mL 3 The standard mother solution of the notoginsenoside Fd is reserved, different groups are set according to the following requirements, and the system is 100 mu L:
blank group: 100. Mu.L of the system contains the enzyme (PnGH 1, 0.03. Mu.g/. Mu.L);
control group ginsenoside Rb 3 :100 mu L of the system contains a substrate (ginsenoside Rb) 3 0.5 mM); control group notoginsenoside Fd: 100. Mu.L of the system contained the product (notoginsenoside Fd,0.5 mM);
protein baking group: 100 mu L of the system comprises drying and redissolving enzyme (PnGH 1 protein solution is dried at 70 ℃, dd H2O is added into powder for vortex redissolving, 0.03 mu g/mu L), substrate (ginsenoside Rb) 3 ，0.5mM)；
Protein blow-drying group: the 100 mu L system comprises blow-drying of the re-dissolved enzyme (PnGH 1 protein solution is taken to blow-dry at room temperature, powder is added with dd H) 2 O vortex redissolution, 0.03 μg/μl), substrate (ginsenoside Rb 3 ，0.5mM)。
Protein lyophilization group: 100. Mu.L of the system comprises freeze-dried re-dissolved enzyme (PnGH 1 protein solution is taken and freeze-dried, powder is added with dd H) 2 O vortex redissolution, 0.03 μg/μl), substrate (ginsenoside Rb 3 ，0.5mM)；
Protein inactivation group: 100. Mu.L of the system contains inactivated enzyme (PnGH 1 heated at 99deg.C for 10min and cooled on ice, 0.03. Mu.g/. Mu.L), substrate (ginsenoside Rb) 3 ，0.5mM)；
Experimental group: 100. Mu.L of the system contains an enzyme (PnGH 1, 0.03. Mu.g/. Mu.L), a substrate (ginsenoside Rb) 3 ，0.5mM)；
Incubating the above groups in a water bath at 50 ℃ for 2 hours; the reaction was terminated by adding 200. Mu.L of methanol, and the product was detected in the same manner as in example 3. The results are shown in FIG. 4. In FIG. 4, I) 70℃oven-dried protein and ginsenoside Rb 3 Carrying out activity measurement by mixing reaction; II) drying protein liquid and ginsenoside Rb at about 30 ℃ at room temperature 3 Carrying out activity measurement by mixing reaction; III) -80 ℃ freeze-drying protein liquid and ginsenoside Rb 3 Carrying out activity measurement by mixing reaction; IV) carrying out activity measurement by heating the protein mixture reaction at 99 ℃; v) PnGH1 protein and ginsenoside Rb 3 Carrying out activity measurement by mixing reaction; VI) ginsenoside Rb 3 A standard; VII) notoginsenoside Fd standard.
Conclusion: pgGH1 has stable catalytic ginsenoside Rb 3 The function of the arasaponin Fd is converted, the high-efficiency catalytic function can be maintained at 50 ℃, but the arasaponin Fd is deactivated after drying treatment at 70 ℃.
3 Example 6 catalytic Activity of homologous proteins of PnGH1 in Panax on ginsenoside Rb
According to the method of example 1, two homologous sequences PgGH1 and PqGH1 are found in ginseng and American ginseng respectively, the amino acid sequences of the two homologous sequences are shown in sequence tables SEQ ID NO. 4 and SEQ ID NO. 6, the similarity with PnGH1 is 88.28% and 90.11%, and the sequence table comparison of the three sequences is shown in figure 7. RNA of ginseng and American ginseng was extracted and reverse transcribed into cDNA, respectively, according to the method of example 1. Specific primers were designed and synthesized based on the base sequence, see Table 4, whose sequence listing is shown in SEQ ID NO:7, and proteins PgGH1 and PqGH1 were expressed and isolated according to the methods of examples 2 and 3, and it was verified that both proteins could hydrolyze Rb as well 3 A glucosyl group outside the 3 rd carbon of (c). HPLC analysis is shown in FIG. 5.
TABLE 4 Table 4
Example 7 PnGH1, pgGH1, pqGH1 catalytic Critical sites
To explore the catalytic key sites of PnGH1, the present application developed a mutation experiment. Using the specific primers in Table 4, the pET32a-PnGh1 plasmid was used as a template for amplification using Vazyme 2X TransStart FastPfu Fly PCR SuperMix, and the amplification system and PCR procedure are shown in Table 5. Taking 10 mu LPCR products, detecting the size of a strip by 1% agarose gel electrophoresis, adding 1 mu LDMT enzyme into the PCR products when the size of a target strip is correct, mixing uniformly, and incubating at 37 ℃ for 1h. The 5. Mu. LDMT enzyme digestion product was transformed into DMT competent cells. And obtaining positive mutation monoclonal through colony PCR and sequencing verification. Plasmids of positive mutants were extracted using Vazyme DC201-01 and transformed into a Transetta (DE 3) expressing strain.
Table 5 mutant construction System and procedure
/>
The mutant protein E188A, E188D, E3525A, E232D, E425A, E425D was then expressed and isolated as described in example 2 and the activity of the mutant was tested as described in example 3 and shown in FIG. 6.
Glycoside hydrolases are catalyzed by two amino acid residues, one being a proton donor and the other being a carboxylic acid residue (glutamic acid or aspartic acid) of a nucleophile. As can be seen from FIG. 5, when glutamic acid (Glu, E) at positions 188, 232, 425 was mutated to alanine (Ala, A), the activity was almost completely lost compared to PnGH1 of the Wild Type (WT), whereas when these sites were mutated to another acidic amino acid aspartic acid (Asp, E), the activity was recovered to a different extent. Therefore, glutamic acid at positions 188, 232 and 425 can be considered as a key site for PnGH1 hydrolysis of glucose, wherein the glutamic acid at position 425 is particularly important, and even if the glutamic acid is replaced by another acidic amino acid aspartic acid, the activity is low, probably because of spatial deformation, and even if the glutamic acid can be used as a nucleophile, the glutamic acid is unfavorable for binding with a substrate, and the activity is low.
Two genes with the same function in American ginseng are found by comparing and analyzing, and glutamic acid is adopted at 188, 232 and 425 (with PnGH1 serial number as reference site) (see sequence table SEQ ID NO: 7), so that the three amino acids can be considered as key sites of glucose outside carbon 3 of the protein hydrolysis PPD type ginsenoside. Therefore, it can be also demonstrated that the three amino acid sequences are homologous proteins with the same catalytic function and the same mechanism.
The present invention is not limited to the above-described embodiments, and any modifications, improvements, substitutions, and the like, which may occur to those skilled in the art, fall within the scope of the present invention without departing from the spirit of the invention.

Claims (10)

1. A glycosyl hydrolase for selectively hydrolyzing a glucosyl group on carbon 3 of PPD-type ginsenoside, characterized in that the glycosyl hydrolase is (a) or (b):
(a) Glycosyl hydrolase with the amino acid sequence shown as SEQ ID NO. 1;
(b) Glycosyl hydrolase derived from (a) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 1.
2. A glycosyl hydrolase, wherein the glycosyl hydrolase is derived from a plant of the genus panax and is a homologous amino acid sequence of the glycosyl hydrolase of claim 1.
3. The glycosyl hydrolase of claim 2, wherein the glycosyl hydrolase has at least 80% similarity to the glycosyl hydrolase of claim 1.
4. A glycosyl hydrolase according to claim 3, characterised in that the glycosyl hydrolase is any of the following:
(c) Glycosyl hydrolase with an amino acid sequence shown as SEQ ID NO. 4;
(d) Glycosyl hydrolase derived from (c) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 4;
(e) Glycosyl hydrolase with an amino acid sequence shown as SEQ ID NO. 6;
(f) Glycosyl hydrolase derived from (e) with equivalent function and formed by replacing, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 6.
5. A nucleotide sequence encoding the glycosyl hydrolase of any of claims 1-4.
6. The nucleotide sequence of claim 5, wherein the nucleotide sequence encoding the glycosylhydrolase of (a) is set forth in SEQ ID No. 2; the nucleotide sequence of the coded glycosyl hydrolase is shown as SEQ ID NO. 3; the nucleotide sequence of the glycosyl hydrolase of the code (e) is shown as SEQ ID NO. 5.
7. A recombinant expression vector comprising the nucleotide sequence of claim 5 or 6.
8. A recombinant host cell comprising the nucleotide sequence of claim 5 or comprising the recombinant expression vector of claim 7.
9. The recombinant host cell according to claim 8, wherein the host cell used is selected from the group consisting of bacteria, actinomycetes, filamentous fungi, yeasts, plant cells and animal cells.
10. Use of any one of the glycosyl hydrolase of claims 1-4, the nucleotide sequence of claim 5 or 6, the recombinant expression vector of claim 7 and the recombinant host cell of claim 8 or 9 for selectively hydrolyzing the glucosyl group on carbon 3 of PPD-type ginsenoside.
CN202211100249.0A 2022-09-08 2022-09-08 Glycosyl hydrolase, gene, vector, host cell and application Pending CN117660416A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211100249.0A CN117660416A (en) 2022-09-08 2022-09-08 Glycosyl hydrolase, gene, vector, host cell and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211100249.0A CN117660416A (en) 2022-09-08 2022-09-08 Glycosyl hydrolase, gene, vector, host cell and application

Publications (1)

Publication Number Publication Date
CN117660416A true CN117660416A (en) 2024-03-08

Family

ID=90073988

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211100249.0A Pending CN117660416A (en) 2022-09-08 2022-09-08 Glycosyl hydrolase, gene, vector, host cell and application

Country Status (1)

Country Link
CN (1) CN117660416A (en)

Similar Documents

Publication Publication Date Title
JP6479084B2 (en) A series of glycosyltransferases and their applications
CN104232723B (en) Group of glycosyltransferases and application thereof
KR102338008B1 (en) A group of UDP-glycosyltransferases and their applications to catalyze sugar chain extension
WO2015188742A2 (en) Group of glycosyltransferases and use thereof
WO2002053722A1 (en) Ginsenoside glycosidase which hydrolyzes ginsenoside glycosyl and the use thereof
CN114107255B (en) Panax japonicus saponin glycoside hydrolase and application thereof in production of ginger-like notoginsenoside R1
CN109796516B (en) A method for synthesizing natural and unnatural protopanaxatriol type ginsenoside
US10870857B2 (en) Method of producing ginsenosides 20(S)-Rg3 and 20(S)-Rh2 using ginsenoside glycosidases
CN109182439A (en) The bioconversion method of the rare saponin(e Rg3 of ginseng
KR102258788B1 (en) Novel Aspergillus niger C2-2 isolated from Nu-ruk producing ginsenoside compound K biotransformation enzyme and use thereof
CN113980931B (en) Application of glucuronic acid hydrolase and mutant thereof in preparation of oleanolic acid-beta-D-glucopyranosyl ester
CN117660416A (en) Glycosyl hydrolase, gene, vector, host cell and application
CN117897480A (en) Mouse Li Tanggao degree specific glycosyltransferase and application thereof
CN112831481B (en) Glycosyltransferase and method for catalyzing sugar chain extension
CN109402090B (en) Beta-1,3 endoglucanase with immune enhancing activity and derived from scapharca broughtonii and encoding polynucleotide thereof
CN112375752A (en) Trans-glycoside hydrolase and application thereof in glycoside structure modification and modification
CN108588054B (en) Application of notoginsenoside glycoside hydrolase and its mutant in producing Vietnam ginsenoside R7
CN116410959B (en) Salt-tolerant alcohol-tolerant beta-glucosidase and application thereof in conversion of ginsenoside
KR102140810B1 (en) Converting ginsenoside Rb3 to ginsenoside Rd using beta-xylosidase from Paenibacillus woosongensis
KR102011853B1 (en) Manufacturing method of ginsenoside C-K
KR20220058286A (en) Endo-1,4-beta glucosidase derived from Paenibacillus mucilaginosus, and use thereof
Zhu et al. Molecular cloning, expression, purification, and characterization of Bacillus subtilis hydrolyzed ginsenoside Rc of α-L-arabinofuranosidase in Escherichia coli
CN118109439A (en) Beta-glucosidase for converting esculin and ginsenoside and application thereof
KR20230095539A (en) Endo-1,4-beta glucosidase derived from Paenibacillus mucilaginosus, and use thereof
KR20110136161A (en) A novel soil microorganism, a novel oxidoreductase seperated from the said soil microorganism, a gene encoding the said oxidoreductase and a methods for producing effective ginsenosides using thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination