KR102140810B1 - Converting ginsenoside Rb3 to ginsenoside Rd using beta-xylosidase from Paenibacillus woosongensis - Google Patents

Abstract

The present invention relates to the conversion of ginsenoside Rb3 to ginsenoside Rd using beta- xylosidase derived from Panicillus usongensis , specifically, beta- xylosidase (beta) derived from Paenibacillus woosongensis -xylosidase) is a method for producing ginsenoside Rd, characterized in that it reacts with ginsenoside Rb3, and an enzyme composition for ginsenoside Rb conversion of ginsenoside Rb3 containing the beta-xyloxidase.
According to the method of the present invention, ginsenoside Rd having excellent physiological activity can be produced very efficiently from ginsenoside Rb3. In addition, when the enzyme composition of the present invention is used, conversion of ginsenoside Rb3 to ginsenoside Rd can be performed very efficiently and easily.

Description

Conversion of ginsenoside Rb3 to ginsenoside Rd using beta-xylosidase derived from Panicillus usongensis {Converting ginsenoside Rb3 to ginsenoside Rd using beta-xylosidase from Paenibacillus woosongensis}

The present invention relates to the conversion of ginsenoside Rb3 to ginsenoside Rd using beta- xylosidase derived from Panicillus usongensis , specifically, beta- xylosidase (beta) derived from Paenibacillus woosongensis -xylosidase) is a method for producing ginsenoside Rd, characterized in that it reacts with ginsenoside Rb3, and an enzyme composition for ginsenoside Rb conversion of ginsenoside Rb3 containing the beta-xyloxidase.

Saponin refers to a substance composed of several cyclic compounds in a non-sugar part of a glycoside widely present in the plant world. Triterpene saponin, a saponin component contained in ginseng or red ginseng as a main bioactive component, has a different chemical structure from saponins found in other plants, so to differentiate these ginseng saponins from other plant-based saponins, ginseng ) Glycoside is called ginsenoside.

Ginsenosides are protopanaxadiol-type (PPD type) ginsenosides, protopanaxatriol-type (PPT type) ginsenosides and oleanolic acid based on the structure of aglycone (oleanolic acid-type) It can be classified into three types of ginsenosides. These three groups are again classified according to the position and number of sugar moieties attached by glycosicid bonds to the 3, 6, and 20 carbon positions of the ring in the compound structure. . Currently, more than 40 ginsenosides have been isolated, most of which are PPD type ginsenosides. Ginsenosides of PPD type include Rb1, Rb2, Rb3, Rc, Rd, gypenoside XVII, compound O, compound Mc1, compound Mc1, F2, compound Y (compound Y), compound Mc (compound Mc), Rg3, Rh2, CK. Ginsenosides of the PPT type include Re, Rg1, Rf, Rg2, Rh1, and the like.

Among these ginsenosides, ginsenoside Rd is known to have various pharmaceutical effects such as anti-cancer effect, antioxidant effect, arteriosclerosis treatment, and neuroprotective effect. In this regard, ginsenoside Rd promotes differentiation of neural stem cells into astrocytes (Shi et al., 2005), inhibits the activation of tyrosine kinase protein by hypoxia/reoxygenation (Dou et al., 2001), reducing aging-associated oxidative damage in aging-promoting mice (Yokozawa et al., 2004), reducing kainic acid-induced mortality in mice (Lee et al., 2003), and vascular smooth muscle Good physiological activity has been reported, such as blocking calcium entry through receptor- and storage-operating Ca ²⁺ channels in cells (Guan et al., 2006).

Several methods for producing ginsenoside Rd from the major ginsenosides of this PPD type are known, but it is necessary to develop new methods and diversify the production method in addition to the existing methods, and also more efficient ginsenosides We need a way to produce side Rd.

Accordingly, the present inventors studied a new and efficient method for producing ginsenoside Rd, and as a result, the beta-xylosidase derived from Panicillus usongensis can convert ginsenoside Rb3 to ginsenoside Rd very efficiently. Upon confirmation, the present invention has been completed.

Shi et al., 2005, Life Sciences 76, 983-995. Dou et al., 2001, Planta Medica 67, 19-23. Yokozawa et al., 2004, Journal of Pharmacy and Pharmacology 56, 107-113. Lee et al., 2003, Planta Medica 69, 230-234. Guan et al., 2006, European Journal of Pharmacology 548, 129-136.

Therefore, the main object of the present invention is to provide a new method for efficiently producing ginsenoside Rd.

Another object of the present invention is to provide a means that makes it easier to apply the method.

According to an aspect of the present invention, the present invention is a method for producing ginsenoside Rd, characterized in that beta-xylosidase derived from Paenibacillus woosongensis is reacted with ginsenoside Rb3. to provide.

In the method for producing ginsenoside Rd of the present invention, the beta-xyloxidase is composed of the amino acid sequence of SEQ ID NO: 1, or that the tag comprises a tag at the N-terminal or C-terminal of the sequence desirable.

According to another aspect of the present invention, the present invention provides an enzyme composition for converting ginsenoside Rb3 to ginsenoside Rd, including beta-xylosidase derived from Paenibacillus woosongensis do.

In the enzyme composition of the present invention, the beta-xyloxidase is preferably made of the amino acid sequence of SEQ ID NO: 1, or preferably comprises a tag at the N-terminal or C-terminal of the sequence.

According to the method of the present invention, ginsenoside Rd having excellent physiological activity can be produced very efficiently from ginsenoside Rb3. In addition, when the enzyme composition of the present invention is used, conversion of ginsenoside Rb3 to ginsenoside Rd can be performed very efficiently and easily.

1 is a result of analyzing the reaction product by TLC (Thin Layer Chromatography) after reacting (24 hours) beta-xylosidase derived from Paenibacillus woosongensis to ginsenoside Rb3. . Std. : Standard substance of each ginsenoside, 1: ginsenoside Rb3 (substrate), 2: reaction product.
FIG. 2 shows a result of analyzing a reaction product (24 hours) by beta-xylosidase from Paenibacillus woosongensis to ginsenoside Rb3, and analyzing the reaction product by HPLC (High Performance Liquid Chromatography). to be. A: ginsenoside Rb3 (substrate), B: reaction product.
3 is reacted (24 hours) with beta-xylosidase from Paenibacillus woosongensis on a substrate mixed with ginsenoside Rb3 and Rb2 (24 hours), and then the reaction product is HPLC (High Performance Liquid) Chromatography). A: Ginsenoside Rb3 and Rb2 mixed substrate, B: reaction product.

The method for producing ginsenoside Rd of the present invention is characterized by reacting beta-xylosidase derived from Paenibacillus woosongensis with ginsenoside Rb3.

In the present invention, beta-xylosidase is obtained through a process such as purification from a culture of Panicillus usongensis, or a method for cloning and expressing a heterologous beta-xyloxidase gene from the genome of Panicillus usongensis Can be obtained. As a heterologous expression method, for example, an E. coli expression system can be used.

The panicillus Woosong Ensis can be distributed from biological resource centers such as KCTC.

In the present invention, the beta-xyloxidase is preferably derived from the Ph. Bacillus usongensis KCTC 3953 ^T strain, consisting of the amino acid sequence of SEQ ID NO: 1, or tagging the N-terminal or C-terminal of this sequence It is good to include (tag). In this case, for example, a GST (Glutathione S-transferase) sequence for ease of purification of a protein, or the like, or a sequence in which a plurality of histidines are linked may be used.

The sequence encoding beta-xylosidase in the genome of the Ph. aureus Usongensis KCTC 3953 ^T strain is shown in SEQ ID NO: 2.

In the present invention, ginsenoside Rd is prepared by reacting the above beta-xylosidase with ginsenoside Rb3, wherein ginsenoside Rb3 is used in a purified state or irradiated with ginsenoside Rb3 ( crude saponin).

The reaction can be induced by contacting the beta-xyloxidase with ginsenoside Rb3, wherein the reaction pH is preferably 6 to 8, and the reaction temperature is preferably 30 to 40°C, more Preferably, the pH is preferably 6.5 to 7.5 and 30 to 37°C. For example, the beta-xylosidase and ginsenoside Rb3 (or ginsenoside Rb3-containing sapononin) can be added to a solution containing a buffer capable of maintaining the pH condition and capable of maintaining the temperature. It is possible to induce the above-described reaction by injecting and maintaining the thermostat.

The irradiation saponin can be obtained by using a method of extraction from the leaves and roots of other ginseng, including Korean ginseng, ginseng ginseng, bamboo ginseng, and more preferably, sugar and protopanaxatriol-based ginsenosides using a porous resin. It is good to use by removing.

The enzyme composition of the present invention is to make it easier to apply conversion of ginsenoside Rb3 to ginsenoside Rd, and is characterized by containing the beta-xyloxidase.

The enzyme composition of the present invention can be used as a method of adding to ginsenoside Rb3 or irradiated saponin containing Rb3. The method for inducing a reaction for converting ginsenoside Rb3 to ginsenoside Rd after addition may apply the criteria as described above.

The enzyme composition of the present invention may include additives such as buffers or excipients to stably maintain enzymatic activity in addition to the beta-xyloxidase, and further include other enzymes having the same or similar enzymatic activity Will be able to.

Hereinafter, the present invention will be described in more detail through examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

[Example]

1. Preparation of beta-xyloxidase

1-1. Production of recombinant expression vectors and transforming microorganisms

Beta-Xylosidase was screened from the Paenibacillus woosongensis KCTC 3953 ^T strain, which was named XylPw.

Specifically, genomic DNA was extracted from the KCTC 3953T strain, and polymerase chain reaction (PCR) was performed using the forward primer (SEQ ID NO: 3) and the reverse primer (SEQ ID NO: 4) using the genomic DNA as a template ( See Table 1).

primer Sequence (5'->3') XylPw forward primer GGTTCCGCGTGGATCCATGACAAAACAAGGTTTGAATCCATAT XylPw reverse primer GATGCGGCCGCTCGAGTTATTCCAGCGTGAACGAGGCCAAGC

The fragment amplified by the PCR reaction was inserted into the plasmid vector pGEX4T-1 (GE Healthcare, USA) into which the glutathione S-transferase gene was inserted, using an EzCloning Kit (Enzynomics), thereby producing a recombinant expression vector GST-XylPw. . The recombinant expression vector was transformed into E. coli BL21 (DE3) strain by a conventional transformation method to prepare a transformed strain.

1-2. Beta-Xylosidase Expression

To mass-produce beta-xyloxidase, the transformed strain of Example 1-1 was inoculated into an Erlenmeyer flask containing 100 ml of LB medium to which ampicillin was added, and the absorbance at 600 nm was 0.6. Seed culture was carried out at 200 rpm in a shaking incubator at 37° C. until. To confirm the expression of the soluble protein according to various temperatures (18, 22, 25, 30, 37°C), IPTG (isopropyl-beta-D-thiogalactoside) was added to the final 0.1 mM concentration to beta-xyl. Mass expression of sidase was induced. When the strain is in a stationary phase, the culture medium of the strain is centrifuged at 6,000xg at 4°C for 10 minutes to obtain a cell, and suspended by adding 100 mM sodium phosphate buffer (pH 7.0). , Cells were crushed with a sonicator. The cell lysate was centrifuged again at 13,000xg for 15 minutes at 4°C to obtain a supernatant, and beta-xyloxidase in the supernatant was confirmed by SDS-PAGE.

2. Evaluation and analysis of ginsenoside conversion ability of beta-xyloxidase

After dissolving ginsenoside Rb1, Rb2, Rb3 or Rc in 0.1M to 2% (w/v) in phosphate buffer 0.1M (pH 7.0), the supernatant of Example 1-2 containing beta-xyloxidase was added. It was added at 1/20 to 1/4 of the total volume, and reacted under conditions of pH 7.0 and 30 to 37°C. Samples were collected at appropriate intervals for the entire reaction period, and the reaction was terminated by adding an equivalent volume of aqueous solution-saturated n-butanol. The n-butanol fraction was dried to evaporate, and the residue was dissolved in CH ₃ OH and analyzed by TLC and HPLC. As a result, ginsenosides Rb3 of ginsenosides (Rb1, Rb2, Rc, Rd) were converted to Rd (see FIGS. 1 and 2).

3. Mass production of ginsenoside Rd using beta-xyloxidase

3-1. Acquisition of enzyme solution containing beta-xyloxidase

In order to obtain a large amount of enzyme solution for producing 100 g of trace ginsenosides, a strain transformed in a fermentor of 10 L must be cultured, and the following process was performed.

Prior to the main culture, a method of adding a pre-culture solution to a 10 L fermenter containing 6 L of LB medium the next day by inoculating the transformed strain of Example 1-1 into LB medium containing ampicillin in a 500 ml flask the day before And incubated at 500 rpm in a 37°C shake incubator until the absorbance at 600 nm was 3. In order to induce the expression of beta-xyloxidase, the temperature of the fermenter was lowered to 30°C, and 200-500 ml of a glucose solution (600 g/L) was added to facilitate further growth of the cells, and 1M sodium phosphate buffer 300 A stable pH condition was sought by adding ~ 500 ml. In addition, the final IPTG concentration was added so that it was 0.1 mM, thereby inducing large-scale expression of beta-xyloxidase. By culturing this for 20 to 36 hours, when the strain was put into a stationary phase, the culture medium of the strain was centrifuged at 6,000xg at 4°C for 15 minutes to obtain 200 g of the cells (before and after 30g/L). The obtained cells were suspended by adding 100 mM sodium phosphate buffer (pH 7.0), and then the cells were crushed with a sonicator. The cell lysate was centrifuged again at 13,000xg at 4°C for 15 minutes to obtain a large amount of an enzyme solution containing water-soluble beta-xyloxidase.

3-2. Mass production of ginsenoside Rd

6 L of a mixture of PPD type ginsenoside Rb2 and Rb3 having a maximum concentration of 1% (w/v) in 2 L of the enzymatic solution obtained in a large amount in Example 3-1 was reacted for 48 hours while stirring at a temperature of 37°C at 150 rpm. In order to stop the reaction and recover the converted ginsenoside Rd, the alcohol was added in an amount of 70% (v/v) to inactivate the recombinant enzyme, and the ginsenoside Rd was dissolved. The dissolved ginsenoside is again lowered in alcohol concentration, adsorbed with HP20 porous resin, washed with water, desorbed using 80% (v/v) ethanol, and then removed with a vacuum rotary evaporator to obtain high purity ginsenoside Rd. Could be obtained. Finally, 60 g of the ginsenoside Rb2 and Rb3 mixture was reacted to obtain a reactant containing 42 g of ginsenoside Rd. As a result of HPLC analysis, the purity of ginsenoside Rd was 52.3% in the ratio of the area ratio of the chromatogram (see FIG. 3).

3-3. Ginsenoside Rd production with 98% purity

Habon's Prep-HPLC system was used to increase the purity of ginsenoside Rd obtained in Example 3-2. Dissolve 22 g of the final reactant of Example 3-2 in 40% (v/v) ACN to collect the solvent (ACN 40%) under the same conditions with an ODS Taesan DAC column (100 φ x 500 mm) at a rate of 400 ml/min. Thus, it was possible to obtain 8.3 g of ginsenoside Rd having a purity of 98% in terms of the area ratio of the chromatogram.

<110> AceEMzyme co., Ltd. <120> Converting ginsenoside Rb3 to ginsenoside Rd using beta-xylosidase from Paenibacillus woosongensis <130> PA-D18323 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 474 <212> PRT <213> Unknown <220> <223> Paenibacillus woosongensis <400> 1 Met Thr Lys Gln Gly Leu Asn Pro Tyr Leu Pro Ser Trp Glu Tyr Val 1 5 10 15 Pro Asp Gly Glu Pro His Val Phe Asn Asp Arg Val Tyr Val Tyr Gly 20 25 30 Ser His Asp Arg Phe Asn Gly His Ala Phe Cys Leu Asn Asp Tyr Val 35 40 45 Cys Trp Ser Ala Pro Val Ala Asp Leu Ala Asp Trp Arg Tyr Glu Gly 50 55 60 Val Ile Tyr Lys Lys Thr Asp Asp Pro Leu Asn Pro Asp Gly Ser Met 65 70 75 80 Cys Leu Tyr Ala Pro Asp Val Thr Val Gly Pro Asp Gly Arg Tyr Tyr 85 90 95 Leu Tyr Tyr Val Leu Asp Lys Val Pro Ile Val Ser Val Ala Val Cys 100 105 110 Asp Ser Pro Ala Gly Glu Tyr Glu Phe Tyr Gly Tyr Val Arg Tyr Ser 115 120 125 Asp Gly Thr Arg Leu Gly Glu Arg Gln Gly Asp Glu Pro Gln Phe Asp 130 135 140 Pro Ala Val Leu Thr Glu Gly Glu Phe Thr Tyr Leu Tyr Thr Gly Phe 145 150 155 160 Cys Ala Ile Gly Asp Lys Ser Arg Lys Gly Ala Met Ala Thr Val Leu 165 170 175 Gly Arg Asp Met Leu Thr Ile Val Glu Glu Pro Val Phe Val Ala Pro 180 185 190 Ser Glu Pro Tyr Ser Lys Gly Ser Gly Phe Glu Gly His Glu Phe Phe 195 200 205 Glu Ala Pro Ser Ile Arg Lys Arg Gly Asp Thr Tyr Tyr Leu Ile Tyr 210 215 220 Ser Ser Val Val Met His Glu Leu Cys Tyr Ala Thr Ser Pro Phe Pro 225 230 235 240 Thr Lys Gly Phe Thr Tyr Gln Gly Val Ile Val Ser Asn Asn Asp Leu 245 250 255 His Ile Asp Ser Tyr Lys Pro Ala Asp Lys Pro Met Tyr Tyr Gly Gly 260 265 270 Asn Asn His Gly Gly Ala Val Glu Ile Gln Gly Gln Trp Tyr Ile Phe 275 280 285 Tyr His Arg His Thr Asn Gly Thr Ala Phe Ser Arg Gln Gly Cys Met 290 295 300 Glu Pro Ile Ser Phe Arg Glu Asp Gly Thr Ile Pro Gln Val Glu Met 305 310 315 320 Thr Ser Cys Gly Pro Asn Gly Gly Pro Leu Ala Gly Arg Gly Glu Tyr 325 330 335 Pro Ala Tyr Leu Ala Cys Asn Leu Phe Cys Lys Asp Glu Glu Leu Tyr 340 345 350 Thr Gly Gly Phe Gly Ala Ser Gly Ala Trp Met Asp Ser Arg Phe Pro 355 360 365 Lys Ile Thr Gln Asp Gly Lys Asp Gly Asp Glu Glu Met Gly Tyr Ile 370 375 380 Ala Asn Met Thr Asp Ser Ala Thr Ala Gly Phe Lys Tyr Phe Asp Cys 385 390 395 400 His Gly Ile Arg Arg Met Thr Ile Gln Val Arg Gly Tyr Cys Arg Gly 405 410 415 Ala Phe Glu Ile Lys Thr Ala Trp Asn Gly Pro Val Leu Gly Thr Ile 420 425 430 Pro Val Glu Phe Ser Asn Val Trp Lys Pro Tyr Ser Thr Glu Leu Val 435 440 445 Ile Pro Asp Gly Ile Gln Ala Leu Tyr Phe Thr Tyr Thr Gly Met Gly 450 455 460 Ser Ala Ser Leu Ala Ser Phe Thr Leu Glu 465 470 <210> 2 <211> 1425 <212> DNA <213> Unknown <220> <223> Paenibacillus woosongensis <400> 2 atgacaaaac aaggtttgaa tccatatctt ccatcctggg aatacgttcc tgacggggag 60 ccgcatgttt ttaacgacag ggtttatgtt tacggctccc atgatcgctt taacggacat 120 gctttttgtt taaacgacta tgtatgctgg tcagcacccg tagcagattt ggcggactgg 180 cggtatgaag gtgtgattta caaaaaaaca gacgatccgc ttaatccgga cggcagcatg 240 tgtctgtatg caccggatgt caccgtggga cctgatggac ggtactatct gtactatgtc 300 ctagataagg ttcccattgt ttcggttgcc gtctgtgact ctccagctgg tgaatatgag 360 ttctatggct atgtgagata ttcggatgga acacgtctag gagaaagaca gggcgatgag 420 cctcaatttg atcctgccgt gctgacagaa ggggaattca cttatctgta taccggcttt 480 tgtgccatcg gggacaaatc aagaaaaggg gccatggcca cggtgctcgg ccgggatatg 540 ctcaccatcg tggaagaacc ggtgtttgtt gcgccaagcg aaccgtacag caagggcagc 600 ggatttgaag gacatgagtt tttcgaggcg ccatccatca ggaagcgagg cgatacttat 660 tatctgatct attcttcggt tgtcatgcat gagttgtgtt atgcgaccag cccatttccg 720 acaaagggct ttacatatca gggagtcatt gtaagcaata atgatcttca tattgattct 780 tataaaccag ctgacaaacc gatgtattac ggaggcaata accatggcgg tgctgtggaa 840 attcaggggc aatggtacat tttctatcac aggcatacca atggtaccgc atttagccgc 900 caggggtgta tggagcccat ttcattccgg gaggacggaa cgatccctca ggtggagatg 960 acctcctgtg gcccgaacgg agggccgctt gcagggcgcg gcgaatatcc tgcatatttg 1020 gcatgcaacc tgttttgtaa agacgaagag ctgtatacag gaggttttgg cgcttccggg 1080 gcatggatgg acagccggtt tccgaaaata acccaggatg gaaaagacgg cgatgaggag 1140 atgggatata tcgccaatat gacggattcg gctacggcgg ggttcaagta ttttgactgc 1200 catggaatca ggaggatgac catccaggtg cgcgggtatt gccgtggtgc ctttgaaatc 1260 aaaaccgcat ggaacggccc tgttctcgga acgattccgg ttgaattttc aaacgtatgg 1320 aaaccgtatt ctacagaact tgtcattccc gatggcatcc aagccttgta ttttacatac 1380 actggcatgg gaagcgcgag cttggcctcg ttcacgctgg aataa 1425 <210> 3 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for XylPw <400> 3 ggttccgcgt ggatccatga caaaacaagg tttgaatcca tat 43 <210> 4 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for XylPw <400> 4 gatgcggccg ctcgagttat tccagcgtga acgaggccaa gc 42

Claims (4)

A beta-xylosidase derived from Paenibacillus woosongensis consisting of the amino acid sequence of SEQ ID NO: 1 or including a tag at the N-terminus or C-terminus of the sequence. Ginsenoside Rd production method characterized in that it reacts with ginsenoside Rb3. delete A beta-xylosidase derived from Paenibacillus woosongensis consisting of the amino acid sequence of SEQ ID NO: 1 or including a tag at the N-terminus or C-terminus of the sequence. Enzyme composition for ginsenoside Rd conversion of ginsenoside Rb3 containing.
delete

Images