CN104232723A

CN104232723A - Glycosyl transferases and applications of glycosyl transferases

Info

Publication number: CN104232723A
Application number: CN201410254022.0A
Authority: CN
Inventors: 周志华; 严兴; 王平平; 魏勇军; 魏维; 范云
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Shenghe Everything (Shanghai) Biotechnology Co.,Ltd.
Priority date: 2013-06-07
Filing date: 2014-06-09
Publication date: 2014-12-24
Anticipated expiration: 2034-06-09
Also published as: CN104232723B

Abstract

The invention relates to a group of glycosyl transferases and applications of the glycosyl transferases. Particularly, the invention provides applications of glycosyl transferases gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7, 3GT1, 3GT2, 3GT3 and 3GT4, and derived peptides of the glycosyl transferases in glycosylation catalysis and new saponin synthesis of terpenoids. The glycosyl transferases can specifically and efficiently catalyze hydroxyl glycosylation of C-20 bit and/or C-6 bit and/or C-3 of a tetracyclic triterpenoid compound substrate, and/or transfers the glycosyl groups from glycosyl donors to the first glycosyl groups of the C-3 bit and C-6 bit of the tetracyclic triterpenoid compound to extend a carbohydrate chain. The glycosyl transferases disclosed by the invention can also be applied to building synthetic rare ginsenosides and a plurality of novel ginsenosides and derivatives of the ginsenosides.

Description

One group of glycosyltransferase and application thereof

Technical field

The present invention relates to biotechnology and plant biology field, particularly, the present invention relates to a kind of glycosyltransferase and application thereof.

Background technology

Ginsenoside is the general name of the saponin(e be separated to from ginseng and congener (as pseudo-ginseng, Radix Panacis Quinquefolii etc.) thereof, belongs to Triterpene saponins, is to mainly contain effective constituent in ginseng.At present, from ginseng, isolated at least 60 kinds of saponin(es, some of them ginseng saponin(e is proved has physiological function and pharmaceutical use widely: comprise antitumor, immunomodulatory, antifatigue, protect the heart, protect the functions such as liver.

Structure, ginsenoside is the bioactive small molecule that sapogenin is formed after glycosylation.The sapogenin of ginsenoside only has limited several, mainly the protopanoxadiol of dammarane type and Protopanaxatriol, and olea alkanoic acid.In recent years, people have been separated to again new sapogenin from pseudo-ginseng, 25-OH-PPD and 25-OCH ₃-PPD, these new sapogenins all have extraordinary anti-tumor activity.

Sapogenin, by after glycosylation, can improve water-soluble, and produce different physiologically actives.The sugar chain of protopanaxadiol-type's saponin(e be generally combined in sapogenin C3 (with) or C20 hydroxyl on.Protopanaxatriol's saponin(e is compared with protopanoxadiol saponin(e, many hydroxyls in C6 position, Protopanaxatriol's type saponin(e of current discovery be all C6 (with) or C20 hydroxyl in conjunction with glycosylation, on C3, in conjunction with Protopanaxatriol's type saponin(e of glycosyl, there is not been reported.Glycosyl can be glucose, rhamnosyl, wood sugar and pectinose.

Different glycosyl binding sites, sugar chain composition and length make ginsenoside produce great difference in physiological function and pharmaceutical use.Such as, ginsenoside Rb1, Rd and Rc is take protopanoxadiol as the saponin(e of sapogenin, the difference between them be glycosyl modified on difference, but the physiological function between them just has a lot of difference.Rb1 has the function of stable center neuron system, and the function of Rc suppresses the function of central nervous metasystem, and widely, and Rd only has very limited several functions to the physiological function of Rb1.

Structure diversity between ginsenoside sapogenin and saponin(e is also embodied on stereoeffect, although there is a lot of chiral carbon atoms in the skeleton of tetracyclic triterpene, can produce stereoeffect mainly on C20 position.Almost all there is the epimer of C20 position in often kind of ginsenoside and sapogenin.In ginseng, the ginsenoside of C20 position S configuration and sapogenin content will far away higher than ginsenoside and the saponin(es of C20 position R configuration, so the generally ginsenoside of C20 position S configuration that all refers to of said ginsenoside and sapogenin and sapogenin.But the epimer of ginsenoside and sapogenin C20 position has visibly different physiologically active.Such as, S configuration ginsenoside Rh2 (3-O-β-(D-glucopyranosyl)-20 (S)-protopanaxadiol) obviously can suppress prostate cancer cell, but the inhibition of R configuration ginsenoside Rh2 (3-O-β-(D-glucopyranosyl)-20 (R)-protopanaxadiol) is very poor.R configuration ginsenoside Rh2 can optionally suppress osteoclast generation and without any cytotoxic effect, but S configuration ginsenoside Rh2 suppress osteoclast generate effect very weak, but but have very strong cytotoxic effect to osteoclast.And also there is very large difference for the regulating effect of P-glycoprotein in S configuration and R configuration ginsenoside Rh2.

The function of glycosyltransferase is transferred on different glycosyl acceptors by such as, glycosyl on glycosyl donor (nucleoside diphosphate sugar, UDPG).According to the difference of aminoacid sequence, current glycosyltransferase has 94 families.In the Plant Genome checked order at present, find hundreds of above different glycosyltransferase.The glycosyl acceptor of these glycosyltransferases comprises sugar, fat, albumen, nucleic acid, microbiotic and other small molecules.In ginseng, participate in the glycosyltransferase of saponin glycosyl, its effect is that the glycosyl on glycosyl donor is transferred on the hydroxyl of C-3, C-6 or C-20 of sapogenin or aglycon, thus forms the saponin(e with different pharmaceutical use.

At present, by ginseng, the transcriptome analysis of Radix Panacis Quinquefolii and pseudo-ginseng, researchist has had been found that a large amount of glycosyltransferase genes, but also which glycosyltransferase indefinite take part in the synthesis of ginsenoside.Due to the glycosyltransferase containing One's name is legion in ginseng, and their content is all very low, so the progress of their separation and purification is slow.

Rare ginsenoside refers to the saponin(e that content is extremely low in ginseng.Ginsenoside compound K (20-O-β-(D-glucopyranosyl)-20 (S)-protopanaxadiol) belongs to the saponin(e of protopanoxadiol class, and the C-20 position hydroxyl of sapogenin is connected with a glucosyl group.Ginsenoside compound K content in ginseng is extremely low, it be protopanaxadiol-type's saponin(e in human intestinal by the main metabolites produced after microbial hydrolytic.Research shows, just can be absorbed by the body after most protopanaxadiol-type's saponin(e is only metabolised to CK, so Ginsenoside compound K is directly by body absorption and the real entity played a role, and other saponin(es are prodrug.Ginsenoside compound K has good anti-tumor activity, can inducing apoptosis of tumour cell, and inhibition tumor cell shifts.It and radiation and chemotherapy binding tests, can strengthen the effect of radiation and chemotherapy.In addition, Ginsenoside compound K has antiallergic activity in addition, anti-inflammatory activity, and can play neuroprotective, antidiabetic effect and function of anti-skin aging.The pharmacologically active of Ginsenoside compound K has Mutiple Targets, high reactivity and hypotoxic feature.

GF1 (20-O-β-D-glucopyranosyl-20 (S)-protopanaxatriol) belongs to Protopanaxatriol's type saponin(e, and its content in ginseng is also very low, also belongs to rare ginsenoside.The structure of GF1 and CK closely, are also be connected with a glucosyl group on the C-20 position hydroxyl of sapogenin.GF1 also has unique pharmaceutical use.It has anti-ageing and oxidation resistant function.

Ginsenoside Rh1 (6-O-β-D-glucopyranosyl-20 (S)-protopanaxatriol) belongs to Protopanaxatriol's type saponin(e, and its content in ginseng is also very low, also belongs to rare ginsenoside.The structure of ginsenoside Rh1 and F1 closely, but its glycosylation site is the hydroxyl on C6 position.Ginsenoside Rh1 also has special physiological function, can antianaphylaxis and anti-inflammatory.

Content is extremely low in ginseng for ginsenoside Rh2 (3-O-β-(D-glucopyranosyl)-20 (S)-protopanaxadiol), its content approximately only has ten thousand/left and right of ginseng dry weight, also belongs to rare ginsenoside.But ginsenoside Rh2 has good anti-tumor activity, be one of topmost antitumor activity component in ginseng, can inhibition tumor cell growth, inducing apoptosis of tumour cell, anti metastasis.Research shows that ginsenoside Rh2 can suppress lung cancer cells3LL (mice), Morris liver cancer cells (rats), B-16melanoma cells (mice), and the increment of HeLa cells (human).Clinically, ginsenoside Rh2 and radiotherapy or chemotherapy combined treatment, can strengthen the effect of radiation and chemotherapy.The effects such as in addition, ginsenoside Rh2 also has antianaphylaxis, improves the function of immunity of organisms, the inflammation suppressing NO and PGE to produce.

Ginsenoside Rg3 content in ginseng is also very low, and have obvious antineoplastic action, have complementarity with ginsenoside Rh2 in antineoplastic function aspects, Clinical practice proves, the synergism of its treatment tumour of Rg3 and Rh2 conbined usage improves further.

Due to rare ginsenoside CK, F1, Rh1, the content of Rh2 and Rg3 is very low, so the method for producing at present is from a large amount of saponin(es in ginseng, again carries out Isolation and purification after being transformed by the method for selective hydrolysis glycosyl.With the total saponins of panax species or protopanoxadiol saponins for raw material, to transform, separation and extraction 20 (S)-former ginsenoside-Rh2.The advantage of this preparation method make use of a large amount of glycols saponin(es, but need react at high temperature and pressure (preparation method of .20 (the S)-ginsenoside-Rh2s such as Song Changchun and pharmaceutical composition thereof and application [P]. Chinese patent: 1225366,1999 years).Ginseng Dohanykutato Intezet of Korea S discloses the method that 2 kinds are prepared 20 (R & S)-ginsenoside-Rh2 from constituent of ginseng.It is characterized in that first obtaining protopanoxadiol saponin(e component, then obtain 20 (R & S)-ginsenoside-Rg3 through acid hydrolysis process, then ginsenoside Rg3 process is obtained ginsenoside Rh2.These method major defects are that the parent material of product needs protopanoxadiol class series monomers saponin(e above, make reactions steps more loaded down with trivial details, and significant loss is comparatively large, complex operation, thus causes cost to increase, and are difficult to improve productive rate.Because the glycosyl of CK and F1 in C-20 position is easily destroyed in hydrolytic process, so chemical method is not suitable for the production of CK and F1.And the productive rate that acid system and alkali process hydrolysis saponin(e prepare Rh1 is very low, but also there is a lot of by product.

Due to the mild condition of enzyme transforming process, specificity is strong, the feature of the easily separated purifying of product, is the main method of producing CK, F1 and Rh1 at present.For the preparation of Ginsenoside compound K, the enzyme of F1, Rh1 and Rh2 mainly contains naringinase, polygalacturonase, cellulase and Sumylact L etc.Ginsenoside compound K also can be obtained by the method for microbial transformation, mainly utilizes the anerobe that enteron aisle is originated.Although, biotransformation method (enzyme process and microbial method) is prepared rare ginsenoside CK, F1, Rh1 and Rh2 and has been made significant headway, but because its raw material is ginsenoside, so the cost of preparation CK, F1, Rh1 and Rh2 is still very high, and its output also quite limited (Chinese patent: CN1105781C; Jin Dongshi etc., Journal of Dalian Institute of Light, calendar year 2001).

Due to the economic worth that the important biomolecule of ginsenoside Rh2 is active and huge, people also attempt utilizing the method for chemosynthesis to produce this saponin(e always in decades, its basic ideas are contracted by protopanoxadiol and corresponding glycosyl and formed, i.e. semi-synthesis method (Japanese Patent: Unexamined Patent 8-208688,1996).The method take protopanoxadiol as semi-synthetic 20 (the S)-former ginsenoside-Rh2 of raw material, its synthesis step is divided into six steps, and the silver carbonate employing equivalent in glycosylation reaction is as catalyzer, the valuable cost of the method that makes of price is higher, the stereoselectivity of this catalyzer is not high simultaneously, and efficiency of pcr product is low.Another kind method make use of acyl group or the alkyl replacement protopanoxadiol C-12 position hydroxyl of arene; again under the protection of organic solvent and rare gas element; add and activated the glucosyl group donor that C-1 is hydroxyl; exist and the raw condensation reaction of hair tonic under lewis acidic catalysis at molecular sieve; the product generated goes out blocking group after column chromatography or recrystallization purifying; obtain 20 (S)-ginsenoside-Rh2 (Hui Yongzhengs etc.; the preparation method of 20 (S)-ginsenoside-Rh2s; Chinese patent: CN1587273A, 2005)

Current this area still lacks the method for a kind of effective production rare ginsenoside CK, F1, Rh1, Rh2 and Rg3, therefore in the urgent need to developing the glycosyltransferase of multiple differential high efficient.

Summary of the invention

Object of the present invention is just to provide one group of glycosyltransferase and application thereof.

In a first aspect of the present invention, provide a kind of external glycosylation process, comprise step:

Under glycosyltransferase exists, the glycosyl of glycosyl donor is transferred on the following site of tetracyclic triterpenoid:

On first glycosyl of on C-20 position, C-6 position, C-3 position or C-3, C-6 position;

Thus form glycosylated tetracyclic triterpenoid;

Wherein, described glycosyltransferase is selected from:

Glycosyltransferase as shown in SEQ ID NOs.:2,16,18,20,22,24,26,28,41,43,55,57,59 or 61.

Second aspect present invention, provides a kind of isolated polypeptide, and described polypeptide is selected from lower group:

A () has the polypeptide of arbitrary shown aminoacid sequence in SEQ ID NOs.:2,16,18,20,26,28,41,43,55,57,59 or 61;

(b) polypeptide of arbitrary shown aminoacid sequence in SEQ ID NOs.:2,16,18,20,26,28,41,43,55,57,59 or 61 is formed after the replacement of one or more amino-acid residue, disappearance or interpolation form or add signal peptide sequence and there is the derivative polypeptide of glycosyl transferase activity;

Derivative polypeptide containing peptide sequence described in (a) or (b) in (c) sequence;

Homology >=85% of aminoacid sequence shown in arbitrary or >=90% (preferably >=95%) in (d) aminoacid sequence and SEQ ID NOs:2,16,18,20,26,28,41,43,55,57,59 or 61, and there is the derivative polypeptide of glycosyl transferase activity.

In another preference, described sequence (c) is served as reasons the fusion rotein formed after (a) or (b) with the addition of sequence label, signal sequence or secretory signal sequence.

In another preference, described polypeptide is SEQ ID NOs.:2, the polypeptide of aminoacid sequence shown in 16,18,20,26,28,41,43,55,57,59 or 61.

A third aspect of the present invention, provides a kind of isolated polypeptide, and described polypeptide is selected from lower group:

(a1) there is the polypeptide of arbitrary shown aminoacid sequence in SEQ ID NOs.:22,24;

(b1) polypeptide containing peptide sequence described in (a1) in sequence; And/or

Described polypeptide is selected from lower group:

(a2) there is the polypeptide of arbitrary shown aminoacid sequence in SEQ ID NOs.:4 or 6;

(b2) that the polypeptide of arbitrary shown aminoacid sequence in SEQ ID NOs.:4 or 6 is formed after the replacement of one or more amino-acid residue, disappearance or interpolation form or add signal peptide sequence and there is the derivative polypeptide of glycosyl transferase activity;

(c2) the derivative polypeptide containing peptide sequence described in (b2) in sequence;

(d2) homology >=85% (preferably >=95%) of aminoacid sequence shown in arbitrary in aminoacid sequence and SEQ ID NOs.:4 or 6, and there is the derivative polypeptide of glycosyl transferase activity.

In another preference, described sequence (c2) is served as reasons the fusion rotein formed after (a2) or (b2) with the addition of sequence label, signal sequence or secretory signal sequence.

In a fourth aspect of the present invention, provide a kind of polynucleotide of separation, described polynucleotide are be selected from the sequence of lower group:

(A) to encode the nucleotide sequence of polypeptide described in first or second aspect;

(B) nucleotide sequence of coding polypeptide as shown in SEQ ID NOs.:2,4,6,16,18,20,22,24,26,28,41,43,55,57,59 or 61;

(C) nucleotide sequence as shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60;

(D) with the nucleotide sequence of homology >=95% (preferably >=98%) of sequence shown in SEQ ID NOs.:1,3,5,15,17,19,21,27,40,42,54,56,58 or 60;

(E) nucleotide sequence that the 5 ' end and/or 3 ' of nucleotide sequence holds brachymemma or interpolation 1-60 (preferably 1-30, more preferably 1-10) Nucleotide to be formed shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60;

(F) nucleotide sequence of arbitrary described nucleotide sequence complementary (preferably complete complementary) with (A)-(E).

In another preference, the sequence of described Nucleotide is as shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60.

In another preference, the polypeptide of the polynucleotide encoding aminoacid sequence of sequence as shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60 respectively as shown in SEQ ID NOs.:2,4,6,16,18,20,22,24,26,28,41,43,55,57,59 or 61.

In a fifth aspect of the present invention, provide a kind of carrier, described carrier contains the polynucleotide described in the third aspect.Preferably, described carrier comprises expression vector, shuttle vectors, integrative vector.

In a sixth aspect of the present invention, provide the purposes of isolated polypeptide described in the present invention first or second aspect, it is used to one or more reactions of below catalysis, or be used to the catalyst formulations preparing one or more reactions of below catalysis: the glycosyl from glycosyl donor is transferred to the hydroxyl of tetracyclic triterpenoid C-20 position and/or C-6 position and/or C-3 position to replace the H of described hydroxyl, and the glycosyl from glycosyl donor is transferred on the C-3 position of tetracyclic triterpenoid or first glycosyl of C6 position to extend sugar chain.

In another preference, described glycosyl donor comprises the nucleoside diphosphate sugar being selected from lower group: UDPG, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-ethanoyl glucose, ADP-ethanoyl glucose, TDP-ethanoyl glucose, CDP-ethanoyl glucose, GDP-ethanoyl glucose, UDP-wood sugar, ADP-wood sugar, TDP-wood sugar, CDP-wood sugar, GDP-wood sugar, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-semi-lactosi, ADP-semi-lactosi, TDP-semi-lactosi, CDP-semi-lactosi, GDP-semi-lactosi, UDP-pectinose, ADP-pectinose, TDP-pectinose, CDP-pectinose, GDP-pectinose, UDP-rhamnosyl, ADP-rhamnosyl, TDP-rhamnosyl, CDP-rhamnosyl, GDP-rhamnosyl, or other nucleoside diphosphate hexoses or nucleoside diphosphate pentose, or its combination.

In another preference, described glycosyl donor comprises uridine diphosphate (UDP) (UDP) sugar being selected from lower group: UDPG, UDP-galacturonic acid, UDP-semi-lactosi, UDP-pectinose, UDP-rhamnosyl, or other uridine diphosphate (UDP) hexoses or uridine diphosphate (UDP) pentose, or its combination.

In another preference, described isolated polypeptide is used for catalysis one or more reactions following or is used to prepare the catalyst formulations of catalysis one or more reactions following:

Formula (I) Formula (II) compound

Wherein, R1 is H, monose glycosyl or polysaccharide glycosyl; R2 and R3 is H or OH; R4 is glycosyl; Described polypeptide is selected from SEQ ID NO:2,16 or 18 or its derivative polypeptide.

In another preference; described monose comprises glucose (Glc); rhamnosyl (Rha); ethanoyl glucose (Glc (6) Ac); arbinofuranose (Araf); arabopyranose (Arap), wood sugar (Xyl) etc.

In another preference, described polysaccharide comprises Glc (2-1) Glc, Glc (6-1) Glc, Glc (6) Ac, Glc (2-1) Rha, Glc (6-1) Arap, Glc (6-1) Xyl, Glc (6-1) Araf, Glc (3-1) Glc (3-1), Glc (2-1) Glu (6) Ac, Glc (6-1) Arap (4-1) Xyl, Glc (6-1) Arap (2-1) Xyl, or the polysaccharide of 2-4 the monose composition such as Glc (6-1) Arap (3-1) Xyl.

Compound after R1-R4 is substituted is as shown in the table:

Substrate	R1	R2	R3	R4	Product
						PPD	H	H	OH	Glycosyl	CK
Rh2	1 glycosyl	H	OH	Glycosyl	F2
						Rg3	2 glycosyls	H	OH	Glycosyl	Rd
PPT	H	OH	OH	Glycosyl	F1
						DM	H	H	H	Glycosyl	20-G-DM

Namely, when described R1, R2 be H, R3 are OH, described formula (I) compound is protopanoxadiol (PPD)

R1 is a glucosyl group, and R2 is H, R3 when being OH, and described formula (I) compound is ginsenoside RH2

R1 is two glucosyl groups, and R2 is H, R3 when being OH, and described formula (I) compound is ginsenoside RG3

R1 is H, R2 be OH, R3 is OH, and described formula (I) compound is Protopanaxatriol (PPT)

R1 is H, R2 be H, R3 is H, described formula (I) compound dammarenediol (DM)

Formula (III) Formula (IV) compound

Wherein, R1 is H or glycosyl, R2 glycosyl, and R3 is glycosyl, and described polypeptide is selected from SEQ ID NOs.:2,16,18 or 20 or its derivative polypeptide;

Or R1 is H or glycosyl; R2 is H; R3 is glycosyl, and described polypeptide is selected from SEQ ID NO.:20 or its derivative polypeptide.

Compound after R1-R3 is substituted is as shown in the table:

Substrate	R1	R2	R3	Product
					F1	H	Glycosyl	Glycosyl	Rg1
PPT	H	H	Glycosyl	Rh1

Namely work as R1, when R2 is H, described formula (III) compound is Protopanaxatriol (PPT).

R1 is H, R2 when being glucosyl group, and described formula (III) compound is GF1.

Formula (V) Formula (VI) compound

Wherein, R1 is H or OH; R2 is H or OH; R3 is H or glycosyl; R4 is glycosyl, and described polypeptide is selected from SEQ ID NOs.:22,24,41 or 43 or its derivative polypeptide.

Compound after R1-R4 is substituted is as shown in the table:

Substrate	R1	R2	R3	R4	Product
						PPD	H	OH	H	Glycosyl	Rh2
CK	H	OH	Glycosyl	Glycosyl	F2
						PPT	OH	OH	H	Glycosyl	3-G-PPT
F1	OH	OH	Glycosyl	Glycosyl	3-G-F1
						DM	H	H	H	Glycosyl	3-G-DM

Namely, when R1 and R3 be H, R2 is OH, described formula (V) compound is protopanoxadiol (PPD);

R1 is H, R2 when be OH, R3 being glucosyl group, and described formula (V) compound is Ginsenoside compound K;

R1 is OH, R2 when be OH, R3 being H, and described formula (V) compound is Protopanaxatriol (PPT);

R1 is OH, R2 when be OH, R3 being glucosyl group, and described formula (V) compound is GF1;

R1 to be H, R2 be OH, R3 is for during for H, and described formula (V) compound is dammarenediol (DM).

When substrate is PPD, described polypeptide is selected from SEQ ID NOs.:22,24,41 or 43 or its derivative polypeptide; When substrate is CK, described polypeptide is selected from SEQ ID NOs.:22,24 or 43 or its derivative polypeptide; When substrate is PPT, described polypeptide is selected from SEQ ID NOs.:22,24 or 41 or its derivative polypeptide; When substrate is F1 and DM, described polypeptide is selected from SEQ ID NOs.:22 or 24 or its derivative polypeptide.

Formula (VII) Formula (VIII) compound

Wherein, R1 is OH or OCH ₃; R2 is glycosyl, and described polypeptide is selected from SEQ ID NOs.:22,24,41 or 43 or its derivative polypeptide.

Compound after R1-R2 is substituted is as shown in the table:

Substrate	R1	R2	Product
				25-OH-PPD	OH	Glycosyl	3-G-25-OH-PPD
25-OCH ₃-PPD	OCH ₃	Glycosyl	3-G-25-OCH ₃-PPD

Namely, when R1 is OH, described formula (VII) compound is 25-OH-PPD;

When R1 is OCH, described formula (VII) compound is 25-OCH ₃-PPD.

Formula (IX) Formula (X) compound

Wherein, R1 is glycosyl; R2 and R3 is OH or H; R4 is glycosyl or H; R5 is glycosyl, and R5-R1-O is the derivative glycosyl of C3 first glycosyl, and described polypeptide is selected from SEQ ID NOs.:26,28,55,57,59 or 61 or its derivative polypeptide.

Compound after R1-R4 is substituted is as shown in the table:

Substrate	R1	R2	R3	R4	Product
						Rh2	Glycosyl	H	OH	H	Rg3
F2	Glycosyl	H	OH	Glycosyl	Rd

Namely when R1 is glucosyl group; R2 is H, R3 be OH, R4 is H, and formula (IX) compound is Rh2.

R1 is glucosyl group; R2 is H, R3 be OH, R4 is glucosyl group, and formula (IX) compound is F2.

Formula (XI) Formula (XII) compound

Described polypeptide is selected from SEQ ID NO:22 or SEQ ID NO:24 or its derivative polypeptide.Formula (XI) compound is lanosterol (lanosterol), and formula (XII) compound is 3-O-β-(D-glucopyranosyl)-lanosterol.

Formula (XIII) Formula (XIV) compound

Wherein, R1 and R2 is H or glycosyl, R3 and R4 is glycosyl.R3-R4-O is the derivative glycosyl of C6 first glycosyl, and described polypeptide is selected from SEQ ID NOs.:55,57,59 or 61 or its derivative polypeptide.

When R1 and R2 be H, R3 is glucosyl group, formula (XIII) compound is Rh1.

Formula (XV) Formula (XVI) compound

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or its derivative polypeptide.Formula (XV) compound is ganoderic acid C 2 (Ganoderic acid C2), and formula (XVI) compound is 3-O-β-(D-glucopyranosyl)-Ganoderic acid C2.

Formula (XVII) Formula (XVIII) compound

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or its derivative polypeptide.Formula (XVII) compound is Agladupol A (Ganoderic acid C2), and formula (XVIII) compound is 3-O-β-(D-glucopyranosyl)-Agladupol A.

Formula (XIX) Formula (XX) compound

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or 41 or 43 or its derivative polypeptide.Formula (XVII) compound is Hispidol B, and formula (XVIII) compound is 3-O-β-(D-glucopyranosyl)-Hispidol B.

Formula (XXI) Formula (XXII) compound

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or 41 or its derivative polypeptide.Formula (XXI) compound is 24 (R)-Cycloartane-3beta, 24,25-triol, and formula (XXII) compound is 3-O-β-(D-glucopyranosyl)-24 (R)-Cycloartane-3beta, 24,25-triol.

In another preference, described glycosyl is selected from: glucosyl group, galacturonic acidic group, galactosyl, aralino, rhamanopyranosyl, and other hexose-baseds or pentose base.

In another preference, described reaction formula (I), (III), (V), (VII), (IX), (XI), (XIII), (XV), (XVII), (XIX) or (XXI) compound include, but is not limited to: the dammarane type four-ring triterpenoid compounds of S configuration or R configuration, lanolin alkane type tetracyclic triterpenoid, apotirucallane type tetracyclic triterpene, root of gansui alkane type tetracyclic triterpenoid, cycloartane (cyclic-ahltin alkane) type tetracyclic triterpenoid, cucurbitane tetracyclic triterpenoid, or chinaberry alkane type tetracyclic triterpenoid.

In another preference, described polypeptide is selected from lower group:

Homology >=85% of aminoacid sequence shown in arbitrary or >=90% (preferably >=95%) in (d) aminoacid sequence and SEQ ID NO:2,16,18,20,26,28,41,43,55,57,59 or 61, and there is the derivative polypeptide of glycosyl transferase activity.

In another preference, described polypeptide is selected from lower group:

Described polypeptide is selected from lower group:

In another preference, the polynucleotide described in the Nucleotide of coding said polypeptide are be selected from the sequence of lower group:

(A) code book invents the nucleotide sequence of polypeptide described in first or second aspect;

(D) with the nucleotide sequence of homology >=95% (preferably >=98%) of sequence shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60;

In a seventh aspect of the present invention, provide a kind of method of carrying out the reaction of glycosyl transfer catalysis, comprise step: under the polypeptide described in the present invention second or the third aspect or its derivative polypeptide existent condition, carry out the reaction of glycosyl transfer catalysis.

In another preference, described method also comprises step:

Glycosyl donor and as described in second aspect present invention or the third aspect polypeptide and derivative polypeptide thereof existence under, by formula (II) compound that described formula (I) converting compounds is described, or formula (III) converting compounds is described formula (IV) compound, or formula (V) converting compounds is described formula (VI) compound, or formula (VII) converting compounds is described formula (VIII) compound, or formula (Ⅸ) converting compounds is described formula (X) compound, or formula (XI) converting compounds is described formula (XII) compound,

In another preference, described method also comprises and described polypeptide and derivative polypeptide thereof is added catalyzed reaction respectively; And/or

Described polypeptide and derivative polypeptide thereof are added catalyzed reaction simultaneously.

In another preference, described method is also included in glycosyl donor and in polypeptide and derivative polypeptide thereof as described in second aspect present invention and the third aspect under the common existent condition of two or more polypeptide, be formula (IV) by formula (I) converting compounds, (VI), (VIII), and the compound of (XIV) (X), or formula (III) converting compounds is formula (II), (VI), (VIII), the compound of (X) and (XIV); Or formula (V) converting compounds formula (II), (IV), (VIII), and the compound of (XIV) (X), or formula (VII) converting compounds formula (II), (IV), (VI), and the compound of (XIV) (X), or (IX) converting compounds formula (II), (IV), (VI), and the compound of (XIV) (VIII), or (XIII) converting compounds is (II), (IV), (VI), (VIII), the compound of (X).

In another preference, described method also comprises the nucleotide sequence of encoding glycosyltransferases and the key gene coexpression in host cell reached in the rare glycol of agate and/or protopanoxadiol and/or Protopanaxatriol's metabolic pathway of synthesizing, thus the formula (II) described in obtaining, (IV), (VI), (VIII), (X), (XII) or (XIV) compound.

In another preference, described host cell is yeast or intestinal bacteria.

In another preference, described polypeptide is for having the polypeptide of aminoacid sequence shown in SEQ ID NOs.:2,4,6,16,18,20,22,24,26,28,41,43,55,57,59 or 61 and derivative polypeptide thereof.

In another preference, the nucleotide sequence of coding said polypeptide is as shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60.

In another preference, described method also comprises: the additive being provided for regulatory enzyme activity in reaction system.

In another preference, the described additive for regulatory enzyme activity is: the additive improving enzymic activity or inhibitory enzyme activity.

In another preference, the described additive for regulatory enzyme activity is selected from lower group: Ca ²⁺, Co ²⁺, Mn ²⁺, Ba ²⁺, Al ³⁺, Ni ²⁺, Zn ²⁺, or Fe ²⁺.

In another preference, the described additive for regulatory enzyme activity is: can generate Ca ²⁺, Co ²⁺, Mn ²⁺, Ba ²⁺, Al ³⁺, Ni ²⁺, Zn ²⁺, or Fe ²⁺material.

In another preference, described glycosyl donor is nucleoside diphosphate sugar, be selected from lower group: UDPG, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-ethanoyl glucose, ADP-ethanoyl glucose, TDP-ethanoyl glucose, CDP-ethanoyl glucose, GDP-ethanoyl glucose, UDP-wood sugar, ADP-wood sugar, TDP-wood sugar, CDP-wood sugar, GDP-wood sugar, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-semi-lactosi, ADP-semi-lactosi, TDP-semi-lactosi, CDP-semi-lactosi, GDP-semi-lactosi, UDP-pectinose, ADP-pectinose, TDP-pectinose, CDP-pectinose, GDP-pectinose, UDP-rhamnosyl, ADP-rhamnosyl, TDP-rhamnosyl, CDP-rhamnosyl, GDP-rhamnosyl, or other nucleoside diphosphate hexoses or nucleoside diphosphate pentose, or its combination.

In another preference, described glycosyl donor is uridine diphosphate (UDP) sugar, is selected from lower group: UDPG, UDP-galacturonic acid, UDP-semi-lactosi, UDP-pectinose, UDP-rhamnosyl, or other uridine diphosphate (UDP) hexoses or uridine diphosphate (UDP) pentose, or its combination.

In another preference, the pH of reaction system is: pH4.0-10.0, and preferred pH is 5.5-9.0.

In another preference, the temperature of reaction system is: 10 DEG C-105 DEG C, preferably 20 DEG C-50 DEG C.

In another preference, the described key gene reached in the rare glycol metabolic pathway of synthesizing of agate includes, but is not limited to: dammarenediol synthase gene.

In another preference, key gene in described protopanoxadiol metabolic pathway of synthesizing includes, but is not limited to: the reductase gene of dammarenediol synthase gene, Cytochrome P450 CYP716A47 gene and P450CYP716A47, or its combination.

In another preference, key gene in described Protopanaxatriol's metabolic pathway of synthesizing includes, but is not limited to: the reductase gene of dammarenediol synthase gene, Cytochrome P450 CYP716A47 gene, P450CYP716A47 and Cytochrome P450 CYP716A53V2 gene and reductase gene thereof, or its combination.

In another preference, the substrate of described glycosyl catalyzed reaction is formula (I), (III), (V), (VII), (IX), (XI), (XIII), (XV), (XVII), (XIX) or (XXI) compound, and described substrate is (II), (IV), (VI), (VIII), (X), (XII), (XIV), (XVI), (XVIII), (XX) or (XXII) compound;

In another preference, described formula (I) compound is protopanoxadiol PPD (Protopanaxadiol), and formula (II) compound is Ginsenoside compound K (20-O-β-(D-glucopyranosyl)-protopanoxadiol) (20-O-β-(D-glucopyranosyl)-protopanaxadiol));

Or, described formula (I) compound is ginsenoside Rh2 (3-O-β-(D-glucopyranosyl)-protopanoxadiol) (3-O-β-(D-glucopyranosyl)-protopanaxadiol)), and formula (II) compound is GF2 (3-O-β-(D-glucopyranosyl)-20-O-β-(D-glucopyranosyl)-protopanoxadiol) (3-O-β-(D-glucopyranosyl)-20-O-β-(D-glucopyranosyl)-protopanaxadiol));

Or described formula (I) compound is ginsenoside Rg3, and formula (II) compound is Ginsenoside Rd;

Or, described formula (I) compound is Protopanaxatriol PPT (Protopanaxatriol), and formula (II) compound is GF1 (20-O-β-(D-glucopyranosyl)-Protopanaxatriol) (20-O-β-(D-glucopyranosyl)-protopanaxatriol));

Or, described formula (I) compound is dammarenediol DM (Dammarenediol II), and formula (II) compound is ginsenoside 20-O-β-(D-glucopyranosyl)-dammarenediol (20-O-β-(D-glucopyranosyl)-Dammarenediol II;

Or, described formula (III) compound is Protopanaxatriol PPT, and formula (IV) compound is ginsenoside Rh1 (6-O-β-(D-glucopyranosyl)-Protopanaxatriol) (6-O-β-(D-glucopyranosyl)-protopanaxatriol));

Or, described formula (III) compound is GF1, and formula (IV) compound is ginsenoside Rg1 (6-O-β-(D-glucopyranosyl)-20-O-β-(D-glucopyranosyl)-protopanoxadiol) (6-O-β-(D-glucopyranosyl)-20-O-β-(D-glucopyranosyl)-protopanaxadiol));

Or, described formula (V) compound is protopanoxadiol, and formula (VI) compound is ginsenoside Rh2 (3-O-β-(D-glucopyranosyl)-protopanoxadiol) (3-O-β-(D-glucopyranosyl)-protopanaxadiol));

Or, described formula (V) compound is CK, and formula (VI) compound is GF2 (3-O-β-(D-glucopyranosyl)-20-O-β-(D-glucopyranosyl)-protopanoxadiol) (3-O-β-(D-glucopyranosyl)-20-O-β-(D-glucopyranosyl)-protopanaxadiol));

Or, described formula (V) compound is Protopanaxatriol PPT, and formula (VI) compound is ginsenoside 3-O-β-(D-glucopyranosyl)-Protopanaxatriol (3-O-β-(D-glucopyranosyl)-protopanaxatriol);

Or, described formula (V) compound is GF1, and formula (VI) compound is ginsenoside 3-O-β-(D-glucopyranosyl)-F1 (3-O-β-(D-glucopyranosyl)-F1);

Or, described formula (V) compound is dammarenediol DM, and formula (VI) compound is ginsenoside 3-O-β-(D-glucopyranosyl)-dammarenediol (3-O-β-(D-glucopyranosyl)-Dammarenediol II);

Or, described formula (VII) compound is 25-OH-protopanoxadiol (25-OH-protopanaxadiol), and formula (VIII) compound is ginsenoside 3-O-β-(D-glucopyranosyl)-25-OH-protopanoxadiol (3-O-β-(D-glucopyranosyl)-25-OH-protopanaxadiol);

Or described formula (VII) compound is 25-OCH ₃-protopanoxadiol (25-OCH ₃-protopanaxadiol), and formula (VIII) compound is ginsenoside 3-O-β-(D-glucopyranosyl)-25-OCH ₃-protopanoxadiol (3-O-β-(D-glucopyranosyl)-25-OCH ₃-protopanaxadiol);

Or described formula (IX) compound is ginsenoside Rh2, and formula (X) compound is ginsenoside Rg3;

Or described formula (IX) compound is GF2, and formula (X) compound is Ginsenoside Rd;

Or, described formula (XI) compound is lanosterol (lanosterol), and formula (XII) compound is 3-O-β-(D-glucopyranosyl)-lanosterol (3-O-β-(D-glucopyranosyl)-lanosterol;

Or described formula (XIII) compound is ginsenoside Rh1, and formula (XIV) compound is ginsenoside Rf;

Or, described formula (XV) compound is ganoderic acid C 2 (Ganoderic acid C2), and formula (XVI) compound is 3-O-β-(D-glucopyranosyl)-ganoderic acid C 2 (3-O-β-(D-glucopyranosyl)-Ganoderic acid C2);

Or, described formula (XVII) compound is Agladupol A, and formula (XVIII) compound is 3-O-β-(D-glucopyranosyl)-Agladupol A (3-O-β-(D-glucopyranosyl)-Agladupol A);

Or, described formula (XIX) compound is Hispidol B, and formula (XX) compound is 3-O-β-(D-glucopyranosyl)-Hispidol B (3-O-β-(D-glucopyranosyl)-Hispidol B);

Or, described formula (XXI) compound is 24 (R)-cycloartane-3 β, 24,25-triol (24 (R)-Cycloartane-3 β, 24,25-triol), and formula (XXII) compound is 3-O-β-(D-glucopyranosyl)-24 (R)-cycloartane-3 β, 24,25-triol (3-O-β-(D-glucopyranosyl)-24 (R)-Cycloartane-3beta, 24,25-triol).

In a eighth aspect of the present invention, provide a kind of genetically engineered host cell, described host cell contains the carrier described in fifth aspect present invention, or integrates the polynucleotide described in fourth aspect present invention in its genome.

In another preference, described glycosyltransferase is the polypeptide described in such as the present invention second or the third aspect or its derivative polypeptide.

In another preference, the nucleotide sequence of described glycosyltransferase of encoding is as described in fourth aspect present invention.

In another preference, described cell is prokaryotic cell prokaryocyte or eukaryotic cell.

In another preference, described host cell is eukaryotic cell, as yeast cell or vegetable cell.

In another preference, described host cell is brewing yeast cell.

In another preference, described host cell prokaryotic cell prokaryocyte, as intestinal bacteria.

In another preference, described host cell is ginseng-cell.

In another preference, described host cell is not natural production (II), (IV), (VI), (VIII), (X), the cell of (XII) compound.

In another preference, described host cell is not natural generation rare ginsenoside CK and/or rare ginsenoside F1 and/or rare ginsenoside Rh2 and/or Rg3 and/or Rh1, and/or new ginsenoside 20-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl)-PPT, 3-O-β-(D-glucopyranosyl)-F1, 3-O-β-(D-glucopyranosyl)-DM, 3-O-β-D-glucopyranosyl)-25-OH-PPD, 3-O-β-(D-glucopyranosyl)-25-OCH ₃-PPD, and and/or the cell of Rh1, F2, Rd and Rg1 etc.

In another preference, the key gene that described host cell contains in protopanoxadiol metabolic pathway of synthesizing includes, but is not limited to: the reductase gene of dammarenediol synthase gene, Cytochrome P450 CYP716A47 gene and P450CYP716A47, or its combination.

In another preference, the key gene that described host cell contains in Protopanaxatriol's metabolic pathway of synthesizing includes, but is not limited to: the reductase gene of dammarenediol synthase gene, Cytochrome P450 CYP716A47 gene, P450CYP716A47 and Cytochrome P450 CYP716A53V2 gene, or its combination.

In a ninth aspect of the present invention, provide the purposes of the host cell described in eighth aspect, for the preparation of enzyme catalysis reagent, or produce glycosyltransferase or as activated cell or production (II), (IV), (VI), (VIII), (X), (XII), (XIV), (XVI), (XVIII), (XX) or (XXII) compound.

In another preference, described host cell is used for by the glycosylation reaching the rare glycol of agate (DM) and/or protopanoxadiol (PPD) and/or Protopanaxatriol (PPT), produce new saponin(e 20-O-β-(D-glucopyranosyl)-dammarendiolII and/or 3-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl) – protopanaxatriol, 3-O-β-(D-glucopyranosyl)-F1 and/or rare ginsenoside CK and/or rare ginsenoside F1 and/or rare ginsenoside Rh1 and/or rare ginsenoside Rh2 and/or rare ginsenoside Rg3.

In a tenth aspect of the present invention, provide a kind of method producing transgenic plant, comprise step: the genetically engineered host cell described in eighth aspect is regenerated as plant, and described genetically engineered host cell is vegetable cell.

In another preference, described genetically engineered host cell is ginseng-cell.

Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.

Accompanying drawing explanation

Following accompanying drawing for illustration of specific embodiment of the invention scheme, and is not used in the scope of the invention limiting and defined by claims.

Fig. 1 is gGT25 gene, gGT25-1 gene, the agarose gel electrophoretogram of gGT25-3 and gGT25-5 gene PCR product.

Fig. 2 is that SDS-PAGE detects gGT25, gGT25-1, gGT25-3 and the gGT25-5 expression in yeast saccharomyces cerevisiae; Swimming lane 1, the electrophoresis result of albumen Marker (molecular weight is followed successively by 200 from top to bottom, 116,97.2,66.4,44.3kDa); The lysate supernatant of swimming lane 2, gt25-pYES2 yeast recon; The lysate supernatant of swimming lane 3, gt25-1-pYES2 yeast recon; The lysate supernatant of swimming lane 4, gt25-3-pYES2 yeast recon; The lysate supernatant of swimming lane 5, gt25-5-pYES2 yeast recon; The lysate supernatant of swimming lane 6, pYES2 empty carrier recon.

Fig. 3 shows Western Blot and detects the expression of gGT25, gGT25-1, gGT25-3 and gGT25-5 gene in yeast saccharomyces cerevisiae; The lysate supernatant of swimming lane 1, gt25-pYES2 yeast recon; The lysate supernatant of swimming lane 2, gt25-1-pYES2 yeast recon; The lysate supernatant of swimming lane 4, gt25-3-pYES2 yeast recon; The lysate supernatant of swimming lane 5, gt25-5-pYES2 yeast recon; The lysate supernatant of swimming lane 3, pYES2 empty carrier recon.

Fig. 4 is that SDS-PAGE detects the expression of gGT13 and gGT30 in yeast saccharomyces cerevisiae; The lysate supernatant of swimming lane 1, gt30-pYES2 yeast recon; The lysate supernatant of swimming lane 2, gt13-pYES2 yeast recon; Swimming lane 3, the lysate supernatant of empty carrier pYES2 recon.

Fig. 5 shows Western Blot and detects the expression of gGT13 and gGT30 in yeast saccharomyces cerevisiae; The lysate supernatant of swimming lane 1, gt30-pYES2 yeast recon; The lysate supernatant of swimming lane 2, gt13-pYES2 yeast recon; Swimming lane 3, the lysate supernatant of empty carrier pYES2 recon.

Fig. 6 shows glycosyltransferase gGT25, and the product TLC of gGT25-1 and gGT25-3 catalysis protopanoxadiol and protopanaxadiol-type's saponin(e detects collection of illustrative plates.Swimming lane 25, gGT25 crude enzyme liquid (gt25-pYES2 yeast recon cracking supernatant); Swimming lane 25-1, gGT25-1 crude enzyme liquid (gt25-1-pYES2 yeast recon cracking supernatant); Swimming lane 25-3, gGT25-3 crude enzyme liquid (gt25-3-pYES2 yeast recon cracking supernatant); Swimming lane "-", negative contrast, the lysate supernatant of empty carrier yeast replaces enzyme liquid; Swimming lane M, the mixed sample of protopanoxadiol and protopanaxadiol-type's saponin(e.

Fig. 7 shows glycosyltransferase gGT25, and the product TLC of gGT25-1, gGT25-3 and gGT25-5 catalysis Protopanaxatriol and Protopanaxatriol's type saponin(e detects collection of illustrative plates; Swimming lane M, the hybrid standard sample of Protopanaxatriol (PPT) and Protopanaxatriol's type saponin(e; Swimming lane 25, gGT25 crude enzyme liquid (gt25-pYES2 yeast recon cracking supernatant); Swimming lane 25-1, gGT25-1 crude enzyme liquid (gt25-1-pYES2 yeast recon cracking supernatant); Swimming lane 25-3, gGT25-3 crude enzyme liquid (gt25-3-pYES2 yeast recon cracking supernatant); Swimming lane 25-5, gGT25-5 crude enzyme liquid (gt25-5-pYES2 yeast recon cracking supernatant); Swimming lane "-", negative contrast, the cracking of empty carrier recombination yeast replaces enzyme liquid.

Fig. 8 shows glycosyltransferase gGT25, and the product TLC of gGT25-1 and gGT25-3 catalysis dammarenediol detects collection of illustrative plates.Swimming lane 25, gGT25 crude enzyme liquid (gt25-pYES2 yeast recon cracking supernatant); Swimming lane 25-1, gGT25-1 crude enzyme liquid (gt25-1-pYES2 yeast recon cracking supernatant); Swimming lane 25-3, gGT25-3 crude enzyme liquid (gt25-3-pYES2 yeast recon cracking supernatant); Swimming lane "-", negative contrast, the cracking of empty carrier yeast replaces enzyme liquid; Swimming lane M, standard model dammarenediol (DM).

The product TLC that Fig. 9 shows glycosyltransferase gGT13 and gGT30 catalysis protopanoxadiol and triol detects collection of illustrative plates; Swimming lane M1, protopanoxadiol saponin(e hybrid standard sample; Swimming lane M2, Protopanaxatriol's saponin(e hybrid standard sample; Swimming lane 1, gGT13 crude enzyme liquid catalysis protopanoxadiol; Swimming lane 2, gGT30 crude enzyme liquid catalysis protopanoxadiol; Swimming lane 3, negative contrast, ddH2O replaces enzyme liquid; Swimming lane 4, gGT13 crude enzyme liquid catalysis Protopanaxatriol; Swimming lane 5, gGT30 crude enzyme liquid catalysis Protopanaxatriol; Swimming lane 6, negative contrast, ddH2O replaces enzyme liquid.

The product HPLC that Figure 10 shows glycosyltransferase gGT25 catalysis protopanoxadiol detects, the second row sample: the hybrid standard sample of protopanoxadiol (PPD) and multiple saponin(e (CK, Rh2, F2, Rg3); The first row sample: gGT25 crude enzyme liquid catalysis PPD; The third line sample: negative contrast 1, empty carrier recombination yeast lysate catalysis PPD; Fourth line sample: negative contrast 2, dH2O.

The product HPLC that Figure 11 shows glycosyltransferase gGT25 catalysis Protopanaxatriol detects, the second row sample: the hybrid standard sample of Protopanaxatriol (PPT) and multiple saponin triol (F1, Rh1, Rg1); The first row sample: gGT25 crude enzyme liquid catalysis PPT; The third line sample: negative contrast 1, empty carrier recombination yeast lysate catalysis PPT;

The LC/MS that Figure 12 shows glycosyltransferase gGT25 catalysis protopanoxadiol product detects, and shows the mass spectrum of peak 2 (product peak) and standard C K sample in Figure 10.

The LC/MS that Figure 13 shows glycosyltransferase gGT25 catalysis Protopanaxatriol product detects, and shows the mass spectrum of peak 1 (product peak) and standard F1 sample in Figure 11.

Figure 14 shows Western Blot and detects the expression of gGT25-pET28a in E.coli BL21; Swimming lane 1-3 is total protein, upper cleer and peaceful precipitation after 50uM IPTG induces respectively.

The product TLC that Figure 15 shows gGT25-pET28a recombinant Bacillus coli cells lysate catalysed in vitro PPD checks collection of illustrative plates; The standard model mixture of swimming lane 1, PPD and CK; (50 μMs of IPTG) cell lysate supernatant catalysis PPD after the induction of swimming lane 2, gGT25-pET28a recombination bacillus coli.

Figure 16 shows the HPLC producing CK Yeast engineering bacteria A cell pyrolysis liquid extract and detects, the first row sample: the hybrid standard sample of protopanoxadiol (PPD), dammarenediol and CK; Second row sample: produce CK Yeast engineering bacteria A cell pyrolysis liquid; The third line sample: negative contrast 1, the lysate of yeast starting strain.

The product HPLC that Figure 17 shows glycosyltransferase gGT25-5 catalysis Protopanaxatriol detects, the first row sample: the hybrid standard sample of Protopanaxatriol (PPT) and multiple saponin triol (F1, Rh1, Rg1 and Re); Second row sample: the product after gGT25-5 crude enzyme liquid catalysis PPT.

The product LC/MS that Figure 18 shows glycosyltransferase gGT25-5 catalysis Protopanaxatriol detects, and shows the mass spectrum of P1 peak in Figure 17 (product Rh1 peak) and Rh1 standard model.

Figure 19 is (a) 3GT1 and 3GT2, and the agarose gel electrophoresis of (b) 3GT3 and (c) 3GT4 gene PCR product detects collection of illustrative plates.

Figure 20 is that SDS-PAGE detects the expression of (a) 3GT1 and 3GT2, (b) 3GT3 and (c) 3GT4 gene in intestinal bacteria; The lysate total protein of (a) swimming lane 1, pet28a empty carrier intestinal bacteria recon; The lysate supernatant of swimming lane 2,3GT1-pet28a intestinal bacteria recon; The lysate precipitation of swimming lane 3,3GT1-pet28a intestinal bacteria recon; The total protein of swimming lane 4,3GT1-pet28a intestinal bacteria recon; ; The lysate supernatant of swimming lane 5,3GT2-pet28a intestinal bacteria recon; The lysate precipitation of swimming lane 6,3GT2-pet28a intestinal bacteria recon; The total protein of swimming lane 7,3GT2-pet28a intestinal bacteria recon; Swimming lane 8, molecular weight of albumen Marker (b) swimming lane 1, molecular weight of albumen Marker; The lysate supernatant of swimming lane 2,3GT3-pET28a intestinal bacteria recon; The lysate precipitation of swimming lane 3,3GT3-pET28a intestinal bacteria recon; The lysate total protein of swimming lane 4,3GT3-pET28a intestinal bacteria recon; (c), the lysate total protein of swimming lane 1,3GT4-pET28a intestinal bacteria recon; The lysate precipitation of swimming lane 2,3GT4-pET28a intestinal bacteria recon; The lysate supernatant of swimming lane 3,3GT4-pET28a intestinal bacteria recon; The lysate of swimming lane 4, pet28a empty carrier intestinal bacteria recon; Swimming lane 5, molecular weight of albumen Marker.The position of arrow points target protein.

Figure 21 is that Western Blot detects the expression of (a) 3GT1 and 3GT2, (b) 3GT3 and (c) 3GT4 gene in intestinal bacteria; The lysate total protein of (a) swimming lane 1, pet28a empty carrier intestinal bacteria recon; The lysate supernatant of swimming lane 2,3GT1-pet28a intestinal bacteria recon; The lysate precipitation of swimming lane 3,3GT1-pet28a intestinal bacteria recon; The total protein of swimming lane 4,3GT1-pet28a intestinal bacteria recon; ; The lysate supernatant of swimming lane 5,3GT2-pet28a intestinal bacteria recon; The lysate precipitation of swimming lane 6,3GT2-pet28a intestinal bacteria recon; The total protein of swimming lane 7,3GT2-pet28a intestinal bacteria recon; The lysate supernatant of (b) swimming lane 1,3GT3-pET28a intestinal bacteria recon; The lysate precipitation of swimming lane 2,3GT3-pET28a intestinal bacteria recon; The lysate total protein of swimming lane 3,3GT3-pET28a intestinal bacteria recon; (c), the lysate total protein of swimming lane 1,3GT4-pET28a intestinal bacteria recon; The lysate precipitation of swimming lane 2,3GT4-pET28a intestinal bacteria recon; The lysate supernatant of swimming lane 3,3GT4-pET28a intestinal bacteria recon; The lysate of swimming lane 4, pet28a empty carrier intestinal bacteria recon.

The product TLC that Figure 22 shows glycosyltransferase 3GT1 and 3GT2 catalysis protopanoxadiol and CK detects collection of illustrative plates.Swimming lane 1, protopanaxadiol-type's saponin(e standard specimen, swimming lane 2, glycosyltransferase 3GT1 catalysis protopanoxadiol generates Rh2; Swimming lane 3, glycosyltransferase 3GT1 catalysis Ginsenoside compound K generates F2; Swimming lane 4, glycosyltransferase 3GT2 catalysis protopanoxadiol generates Rh2; Swimming lane 5, glycosyltransferase 3GT2 catalysis Ginsenoside compound K generates F2.

The product TLC that Figure 23 shows glycosyltransferase 3GT1 and 3GT2 catalysis dammarenediol (DM) and 25-OH-PPD detects collection of illustrative plates (A) 3GT1 crude enzyme liquid crude enzyme liquid (3GT1-pet28a intestinal bacteria recon cracking supernatant) catalysis dammarenediol (DM) and 25-OH-PPD.Swimming lane 1,25-OH-PPD standard specimen, swimming lane 2,3GT1 crude enzyme liquid catalysis 25-OH-PPD generates 3-O-β-(D-glucopyranosyl)-25-OH-protopanaxadiol; Swimming lane 3, dammarenediol standard specimen; Swimming lane 4,3GT1 crude enzyme liquid catalysis dammarenediol generates 3-O-β-(D-glucopyranosyl)-dammarendiolII; (B) 3GT2 crude enzyme liquid (3GT2-pet28a intestinal bacteria recon cracking supernatant) catalysis dammarenediol (DM) and 25-OH-PPD.Swimming lane 1,25-OH-PPD standard specimen, swimming lane 2,3GT2 crude enzyme liquid catalysis 25-OH-PPD generates 3-O-β-(D-glucopyranosyl)-25-OH-protopanaxadiol; Swimming lane 3, dammarenediol standard specimen; Swimming lane 4,3GT2 crude enzyme liquid catalysis dammarenediol generates 3-O-β-(D-glucopyranosyl)-dammarendiolII.

Figure 24 show glycosyltransferase 3GT1 and 3GT2 catalysis PPT and F1 product TLC detect, swimming lane 1,3GT1 crude enzyme liquid (3GT1-pet28a intestinal bacteria recon cracking supernatant) catalysis PPT generates 3-O-β-(D-glucopyranosyl)-protopanaxatriol; Swimming lane 2,3GT1 crude enzyme liquid catalysis F1 generates 3-O-β-(D-glucopyranosyl)-F1; Swimming lane 3,3GT2 crude enzyme liquid (3GT2-pet28a intestinal bacteria recon cracking supernatant) catalysis PPT generates 3-O-β-(D-glucopyranosyl)-protopanaxatriol; Swimming lane 4,3GT2 crude enzyme liquid catalysis F1 generates 3-O-β-(D-glucopyranosyl)-F1.

The product TLC that Figure 25 shows glycosyltransferase 3GT1 and 3GT2 catalysis 20 (R)-PPD detects.Swimming lane 1,20 (R)-PPD standard specimen; Swimming lane 2,3GT1 crude enzyme liquid (3GT1-pet28a intestinal bacteria recon cracking supernatant) catalysis 20 (R)-PPD generates 20 (R)-Rh2; Swimming lane 3,3GT2 crude enzyme liquid (3GT2-pet28a intestinal bacteria recon cracking supernatant) catalysis 20 (R)-PPD generates 20 (R)-Rh2; Swimming lane 4, contrast, pet28a empty carrier intestinal bacteria recon cracking supernatant substituted enzyme liquid; Swimming lane 5,20 (R)-Rh2 standard specimen.

The product TLC that Figure 26 shows glycosyltransferase 3GT1 catalysis lanosterol (lanosterol) detects.Swimming lane 1,3GT1 crude enzyme liquid (3GT1-pet28a intestinal bacteria recon cracking supernatant) catalysis lanosterol; Swimming lane 2,3GT2 crude enzyme liquid (3GT2-pet28a intestinal bacteria recon cracking supernatant) catalysis lanosterol; Swimming lane 3: contrast, pet28a empty carrier intestinal bacteria recon cracking supernatant substituted enzyme liquid.

Figure 27 shows glycosyltransferase 3GT3 catalysis protopanoxadiol, and the product TLC of Protopanaxatriol and 25-OH-PPD detects collection of illustrative plates.A () 3GT3 crude enzyme liquid (3GT3-pet28a intestinal bacteria recon cracking supernatant) catalysis protopanoxadiol generates Rh2, M is protopanaxadiol-type's saponin(e mixed sample, and the former ginsenoside triol of (b) 3GT3 crude enzyme liquid catalysis generates 3-O-β-(D-glucopyranosyl)-PPT (3-G-PPT); C () 3GT3 crude enzyme liquid catalysis 25-OH-PPD generates 3-O-β-(D-glucopyranosyl)-25-OH-PPD (3-G-25-OH-PPD).

Figure 28 shows glycosyltransferase 3GT4 catalysis protopanoxadiol, and the product TLC of CK and 25-OH-PPD detects collection of illustrative plates.A () 3GT4 crude enzyme liquid (3GT4-pet28a intestinal bacteria recon cracking supernatant) catalysis protopanoxadiol generates Rh2, M is protopanaxadiol-type's saponin(e mixed sample, "+" representative adds the sample of 3GT4 crude enzyme liquid, "-" is contrast, namely replaces enzyme liquid (b) 3GT4 crude enzyme liquid catalysis CK to generate F2 with pet28a empty carrier intestinal bacteria recon cracking supernatant; "+" representative adds the sample of 3GT4 crude enzyme liquid, and "-" is contrast, namely replaces enzyme liquid with pet28a empty carrier intestinal bacteria recon cracking supernatant; C () glycosyltransferase 3GT4 catalysis 25-OH-PPD generates 3-O-β-(D-glucopyranosyl)-25-OH-PPD (3-G-25-OH-PPD), "+" representative adds the sample of 3GT4 crude enzyme liquid, "-" is contrast, namely replaces enzyme liquid with pet28a empty carrier intestinal bacteria recon cracking supernatant.

Figure 29 shows glycosyltransferase 3GT1, and the HPLC that 3GT3 and 3GT4 catalysis protopanoxadiol generates Rh2 detects, the first row sample: the hybrid standard sample of Ginsenoside compound K, Rh2 and F2; Second row sample: the product after glycosyltransferase 3GT1 crude enzyme liquid (3GT1-pet28a intestinal bacteria recon cracking supernatant) catalysis PPD; The third line; Product after 3GT3 crude enzyme liquid (3GT3-pet28a intestinal bacteria recon cracking supernatant) catalysis PPD; Fourth line: the product after 3GT4 crude enzyme liquid (3GT4-pet28a intestinal bacteria recon cracking supernatant) catalysis PPD.

Figure 30 shows glycosyltransferase 3GT1, and the LC/MS of 3GT3 and 3GT4 catalysis protopanoxadiol product detects.P1 peak (the product peak of 3GT1) in the mass spectrum of display Rh2 standard model and Figure 29, the mass spectrum at P2 peak (the product peak of 3GT2) and P3 peak (the product peak of 3GT4).

Figure 31 shows the agarose gel electrophoresis figure of (a) gGT29/gGT29-3 gene and (b) gGT29-4/gGT29-5/gGT29-6 and gGT29-7 gene PCR product.(b) swimming lane 1, nucleic acid Marker; Swimming lane 2, gGT29/gGT29-3 gene PCR product; (b) swimming lane 1, gGT29-4/gGT29-5/gGT29-6 gene PCR product; Swimming lane 2, gGT29-7 gene PCR product; Swimming lane 3, nucleic acid Marker.

Figure 32 shows SDS-PAGE and detects the expression of gGT29 and gGT29-3 in yeast saccharomyces cerevisiae; Swimming lane 1, the lysate supernatant of empty carrier pYES2 recon; The lysate supernatant of swimming lane 2, gGT29-pYES2 yeast recon; The lysate supernatant of swimming lane 3, gGT29-3-pYES2 yeast recon.

Figure 33 shows Western Blot and detects the expression of gGT29 and gGT29-3 in yeast saccharomyces cerevisiae; Swimming lane 1, the lysate supernatant of empty carrier pYES2 recon; The lysate supernatant of swimming lane 2, gGT29-pYES2 yeast recon; The lysate supernatant of swimming lane 3, gGT29-3-pYES2 yeast recon.

The TLC that Figure 34 shows the product of glycosyltransferase gGT29 and gGT29-3 catalysis ginsenoside Rh2 and F2 detects collection of illustrative plates; Swimming lane 1, PPD and PPD type saponin(e mixed sample, swimming lane 2, gGT29 crude enzyme liquid (the lysate supernatant of gGT29-pYES2 yeast recon) catalysis Rh2 generates Rg3, swimming lane 3, gGT29 crude enzyme liquid catalysis Rh2 contrasts, and adds pYES2 empty plasmid yeast recon lysate and substitutes enzyme liquid; Swimming lane 4, gGT29 catalysis F2 generates Rd, and swimming lane 5, gGT29 catalysis F2 contrasts, and adds pYES2 empty plasmid yeast recon lysate and substitutes enzyme liquid; Swimming lane 6, gGT29-3 crude enzyme liquid (the lysate supernatant of gGT29-3-pYES2 yeast recon) catalysis Rh2 generates Rg3; Swimming lane 7, gGT29-3 crude enzyme liquid catalysis F2 generates Rd.

The TLC that Figure 35 shows glycosyltransferase gGT29 and 3GT1 or gGT29 and 3GT4 associating catalysis PPD product detects; (a) gGT29 and 3GT1 associating catalysis PPD, swimming lane 1, PPD and PPD type saponin(e mixed sample; Swimming lane 2,3GT1 catalysis PPD generates Rh2; Swimming lane 3, gGT29 catalysis Rh2 generates Rg3; Swimming lane 4,3GT1 and gGT29 associating catalysis PPD generate Rg3; (b) gGT29 and 3GT4 associating catalysis PPD, swimming lane 1, PPD and PPD type saponin(e mixed sample; Swimming lane 2,3GT4 catalysis PPD generates Rh2; Swimming lane 3, PPD; Swimming lane 4,3GT4 and gGT29 associating catalysis PPD generate Rg3.

The product TLC that Figure 36 shows glycosyltransferase 3GT1 and gGT29 difference catalysis 20 (R)-PPD and 20 (R)-PPD and associating catalysis 20 (R)-PPD detects collection of illustrative plates; Swimming lane 1,3GT1 catalysis 20 (R)-PPD generates 20 (R)-Rh2; Swimming lane 2, gGT29 catalysis 20 (R)-Rh2 generates 20 (R)-Rg3; Swimming lane 3,3GT1 and gGT29 associating catalysis 20 (R)-PPD generate 20 (R)-Rg3.

Figure 37 show glycosyltransferase gGT29 and 3GT1 or gGT29 and 3GT4 associating catalysis PPD product HPLC detected result.The first row, Rg3, Rh2 and PPD hybrid standard sample; Second row, gGT29 and 3GT1 associating catalysis PPD, the third line, gGT29 and 3GT4 associating catalysis PPD.

Figure 38 shows the product LC/MS detected result of glycosyltransferase gGT29 and 3GT1 or gGT29 and 3GT4 associating catalysis PPD.Show the mass spectrum at P1 peak (product of gGT29 and 3GT1 associating catalysis PPD) and P2 peak (the product product peak of gGT29 and 3GT4 associating catalysis PPD) in the mass spectrum of standard model Rg3 and Figure 37.

Figure 39 shows the HPLC detected result of producing Rh2 Yeast engineering bacteria A1 cell pyrolysis liquid extract, the first row sample: protopanoxadiol (PPD), dammarenediol (DM), the hybrid standard sample of ginsenoside Rh2 and Rg3; Second row sample: produce Rh2 Yeast engineering bacteria A1 cell pyrolysis liquid extract.

Figure 40 shows the HPLC detected result of producing Rg3 Yeast engineering bacteria A2 cell pyrolysis liquid extract, the first row sample: protopanoxadiol (PPD), dammarenediol (DM), the hybrid standard sample of ginsenoside Rh2 and Rg3; Second row sample: produce Rg3 Yeast engineering bacteria A2 cell pyrolysis liquid extract.

Figure 41 shows the HPLC detected result of producing Rh1 Yeast engineering bacteria A3 cell pyrolysis liquid extract, the first row sample: the standard model of Protopanaxatriol (PPT) and ginsenoside Rh1; Second row sample: produce Rh1 Yeast engineering bacteria A3 cell pyrolysis liquid extract;

Figure 42 shows the HPLC detected result of producing F1 Yeast engineering bacteria A4 cell pyrolysis liquid extract, the first row sample: the standard model of Protopanaxatriol (PPT) and GF1; Second row sample: produce F1 Yeast engineering bacteria A4 cell pyrolysis liquid extract.

Figure 43 shows the HPLC detected result of producing Rh2 Yeast engineering bacteria A5 cell pyrolysis liquid extract, the first row sample: dammarenediol (DM), protopanoxadiol (PPD), the standard model of ginsenoside Rh2 and ginsenoside Rg3; Second row sample: produce Rh2 Yeast engineering bacteria A5 cell pyrolysis liquid extract.

Figure 44 shows SDS-PAGE and detects gGT29-4, gGT29-5, gGT29-6, the gGT29-7 expression in recombination bacillus coli.Swimming lane 1, gGT29-4-pET28a recombination bacillus coli body cracking total protein; Swimming lane 2, gGT29-4-pET28a recombination bacillus coli body cracking supernatant; Swimming lane 3, gGT29-5-pET28a recombination bacillus coli body cracking total protein; Swimming lane 4, gGT29-5-pET28a recombination bacillus coli body cracking supernatant; Swimming lane 5, gGT29-6-pET28a recombination bacillus coli body cracking total protein; Swimming lane 6, gGT29-6-pET28a recombination bacillus coli body cracking supernatant; Swimming lane 7, gGT29-7-pET28a recombination bacillus coli body cracking total protein; Swimming lane 8, gGT29-7-pET28a recombination bacillus coli body cracking supernatant; Swimming lane 9, molecular weight of albumen Marker.

Figure 45 shows Western Blot and detects gGT29-4, gGT29-5, gGT29-6, the gGT29-7 expression in recombination bacillus coli.Swimming lane 1, gGT29-4-pET28a recombination bacillus coli body cracking total protein; Swimming lane 2, gGT29-4-pET28a recombination bacillus coli body cracking supernatant; Swimming lane 3, gGT29-5-pET28a recombination bacillus coli body cracking total protein; Swimming lane 4, gGT29-5-pET28a recombination bacillus coli body cracking supernatant; Swimming lane 5, gGT29-6-pET28a recombination bacillus coli body cracking total protein; Swimming lane 6, gGT29-6-pET28a recombination bacillus coli body cracking supernatant; Swimming lane 7, gGT29-7-pET28a recombination bacillus coli body cracking total protein; Swimming lane 8, gGT29-7-pET28a recombination bacillus coli body cracking supernatant.

Figure 46 shows glycosyltransferase gGT29-4, and the product TLC of gGT29-5, gGT29-6, gGT29-7 difference catalysis Rh2 and F2 detects collection of illustrative plates.Swimming lane Rh2 expression saponin(e Rh2 is substrate; Swimming lane F2 expression saponin(e F2 is substrate.GGT29-4, gGT29-5, gGT29-6, gGT29-7 represent and carry out catalyzed reaction with different enzyme liquid.

Figure 47 shows glycosyltransferase gGT29-4, and the product TLC of gGT29-5, gGT29-6, gGT29-7 difference catalysis Rh1 detects collection of illustrative plates.A () swimming lane 1,2 and 3 represents glycosyltransferase gGT29-4 respectively, the product of gGT29-5 and gGT29-6 difference catalysis Rh1, and swimming lane 4 represents Protopanaxatriol's type saponin(e mixed sample; B () swimming lane 1 represents the product of glycosyltransferase gGT29-7 catalysis Rh1, swimming lane 2 represents Protopanaxatriol's type saponin(e mixed sample;

Figure 48 shows glycosyltransferase 3GT1, and the product TLC of the dissimilar tetracyclic triterpene substrate of 3GT3 and 3GT4 difference catalysis detects collection of illustrative plates.(a) catalysis lanosterol type tetracyclic triterpene Ganoderic acid C2 (ganoderic acid C 2); (b) catalysis apotirucallane type tetracyclic triterpene Agladupol A; (c) catalysis root of gansui alkane type tetracyclic triterpene Hispidol B; (d) catalysis cycloartane triterpenoid 24 (R)-Cycloartane-3beta, 24,25-triol.Glycosyltransferase 3GT1 is used in swimming lane 3GT3,3GT3 and 3GT4 representative, 3GT3 and 3GT4 carries out catalysis, and swimming lane M represents corresponding substrate standard specimen.Arrow represents the product of generation.

Embodiment

The present inventor is through extensive and deep research, glycosyltransferase gGT25 (SEQ ID NO.:2) is provided first, gGT25-1 (SEQ ID NO.:16), gGT25-3 (SEQ ID NO.:18), gGT25-5 (SEQ ID NO.:20), gGT29 (SEQ ID NO.:26), gGT29-3 (SEQ ID NO.:28), gGT29-4 (SEQ ID NO.:55), gGT29-5 (SEQ ID NO.:57), gGT29-6 (SEQ ID NO.:59), gGT29-7 (SEQ ID NO.:61) and 3GT1 (SEQ ID NO.:22), 3GT2 (SEQ ID NO.:24), 3GT3 (SEQ ID NO.:41), 3GT4 (SEQ ID NO.:43), gGT13 (SEQ ID NO.:4), the application of gGT30 (SEQ ID NO.:6) in terpenoid glycosylation catalysis and new saponin formation.Particularly, glycosyltransferase of the present invention can the special and C-20 position of the substrate of catalysis tetracyclic triterpenoids compound efficiently and/or the hydroxyl glycosylation of C-6 position and/or C-3, and/or the glycosyl from glycosyl donor is transferred to tetracyclic triterpenoid C-3 position first glycosyl on to extend sugar chain.Particularly protopanoxadiol can be converted into rare ginsenoside CK and Rh2 with antitumour activity, Protopanaxatriol is converted into there is the rare ginsenoside F1 of activity of fighting against senium and the rare ginsenoside Rh1 of anti-allergic effects, Rh2 is converted into the rare ginsenoside Rg3 that antitumour activity is excellent.Glycosyltransferase of the present invention can also will reach the rare glycol of agate, Protopanaxatriol, F1,25-OH-PPD, 25-OCH ₃-PPD, lanosterol, Ganoderic acid C2, Agladupol A, Hispidol B and 24 (R)-Cycloartane-3beta, 24, new saponin(e 20-O-β-(D-glucopyranosyl)-dammarendiolII of report is had no before 25-triol synthesis, 3-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl)-PPT, 3-O-β-(D-glucopyrano-syl)-F1, 3-O-β-(D-glucopyranosyl)-25-OH-PPD, 3-O-β-(D-glucopyrano-syl)-25-OCH ₃-PPD, 3-O-β-(D-glucopyranosyl)-lanosterol, 3-O-β-(D-glucopyranosyl)-Ganoderic acid C2,3-O-β-(D-glucopyranosyl)-Agladupol A, 3-O-β-(D-glucopyranosyl)-Hispidol B and 3-O-β-(D-glucopyranosyl)-24 (R)-Cycloartane-3beta, 24,25-triol.。

Rh2, CK, Rg3 can also be separately converted to ginsenoside GF2, Rd and Rg1 etc. by glycosyltransferase of the present invention.Present invention also offers conversion and catalysis process.Glycosyltransferase of the present invention also can with the key enzyme coexpression in host cell in dammarenediol and/or protopanoxadiol or Protopanaxatriol's metabolic pathway of synthesizing, or be applied to and prepare dammarenediol (DM), in the genetically engineered cell of protopanoxadiol (PPD) and Protopanaxatriol (PPT), be applied to and build synthetic rare ginsenoside CK, F1, Rh1, Rh2 and Rg3, and new ginsenoside 20-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl)-PPT, 3-O-β-(D-glucopyranosyl)-F1, 3-O-β-(D-glucopyranosyl) – dammarendiolII, 3-O-β-(D-glucopyranosyl)-25-OH-PPD, 3-O-β-(D-glucopyranosyl)-25-OCH ₃in the pathways metabolism of-PPD and F2, Rd and Rg1 etc.Complete the present invention on this basis.

Definition

As used herein, term " active polypeptide ", " polypeptide of the present invention and derivative polypeptide thereof ", " enzyme of the present invention ", " glycosyltransferase ", " gGT25 of the present invention, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, 3GT1, 3GT2, 3GT3, 3GT4 albumen " or " glycosyltransferase of the present invention ", all refer to glycosyltransferase gGT25 (SEQ ID NO.:2), gGT13 (SEQ ID NO.:4), gGT30 (SEQ ID NO.:6), gGT25-1 (SEQ ID NO.:16), gGT25-3 (SEQ ID NO.:18), gGT25-5 (SEQ ID NO.:20), gGT29 (SEQ ID NO.:26), gGT29-3 (SEQ ID NO.:28), gGT29-4 (SEQ ID NO.:55), gGT29-5 (SEQ ID NO.:57), gGT29-6 (SEQ ID NO.:59), gGT29-7 (SEQ ID NO.:61) and 3GT1 (SEQ ID NO.:22), 3GT2 (SEQ ID NO.:24), 3GT3 (SEQ ID NO.:41), 3GT4 (SEQ ID NO.:43) polypeptide and derivative polypeptide thereof.

If not otherwise indicated, ginsenoside mentioned herein and sapogenin, the ginsenoside of the C20 position S configuration being and sapogenin.

As used herein, " isolated polypeptide " refers to that described polypeptide is substantially free of natural other albumen relative, lipid, carbohydrate or other material.Those skilled in the art can purify described polypeptide with the purified technology of protein of standard.Substantially pure polypeptide can produce single master tape on non-reducing polyacrylamide gel.The purity of described polypeptide can also be further analyzed with aminoacid sequence.

Active polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, improvement on synthesis.Polypeptide of the present invention can be native purified product, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (such as, bacterium, yeast, plant).The host used according to recombinant production scheme, polypeptide of the present invention can be glycosylated, can be maybe nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.

The present invention also comprises the fragment of described polypeptide, derivative and analogue.As used herein, term " fragment ", " derivative " and " analogue " refer to the polypeptide substantially keeping biological function that described polypeptide is identical or activity.

Polypeptide fragment of the present invention, derivative or analogue can be the polypeptide that (i) has one or more conservative or non-conservative amino acid residue (preferred conservative amino acid) and be substituted, and the amino-acid residue of such replacement can may not be and encoded by genetic code, or (ii) has the polypeptide of substituted radical in one or more amino-acid residue, or (iii) mature polypeptide and another compound (such as extend the compound of polypeptide transformation period, such as polyoxyethylene glycol) merge the polypeptide formed, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide formed (as leader sequence or secretion sequence or be used for the sequence of this polypeptide of purifying or proprotein sequence, or with the fusion rotein of the formation of antigen I gG fragment).According to instruction herein, these fragments, derivative and analogue belong to the known scope of those skilled in the art.

At active polypeptide of the present invention, there is glycosyl transferase activity, and can one or more reactions below catalysis:

Formula (I) Formula (II) compound

In another preference, described polysaccharide comprises Glc (2-1) Glc, Glc (6-1) Glc, Glc (6) Ac, Glc (2-1) Rha, Glc (6-1) Arap, Glc (6-1) Xyl, Glc (6-1) Araf, Glc (3-1) Glc (3-1), Glc (2-1) Glu (6) Ac, Glc (6-1) Arap (4-1) Xyl, the polysaccharide of 2-4 the monose composition such as Glc (6-1) Arap (2-1) Xyl, Glc (6-1) Arap (3-1) Xyl.

Compound after R1-R4 is substituted is as shown in the table:

Substrate	R1	R2	R3	R4	Product
						PPD	H	H	OH	Glycosyl	CK
Rh2	1 glycosyl	H	OH	Glycosyl	F2
						Rg3	2 glycosyls	H	OH	Glycosyl	Rd

PPT	H	OH	OH	Glycosyl	F1
						DM	H	H	H	Glycosyl	20-G-DM

R1 is a glucosyl group, and R2 is H, R3 when being OH, and described formula (I) compound is ginsenoside RH2.

R1 is two glucosyl groups, and R2 is H, R3 when being OH, and described formula (I) compound is ginsenoside RG3.

R1 is H, R2 be OH, R3 is OH, and described formula (I) compound is Protopanaxatriol (PPT).

R1 is H, R2 be H, R3 is H, described formula (I) compound dammarenediol (DM).

Formula (III) Formula (IV) compound

Or R1 is H or glycosyl; R2 is H or glycosyl; R3 is glycosyl, and described polypeptide is selected from SEQ ID NO.:20 or its derivative polypeptide.

Compound after R1-R3 is substituted is as shown in the table:

Substrate	R1	R2	R3	Product
					F1	H	Glycosyl	Glycosyl	Rg1
PPT	H	H	Glycosyl	Rh1

Formula (V) Formula (VI) compound

Compound after R1-R4 is substituted is as shown in the table:

Substrate	R1	R2	R3	R4	Product
						PPD	H	OH	H	Glycosyl	Rh2
CK	H	OH	Glycosyl	Glycosyl	F2
						PPT	OH	OH	H	Glycosyl	3-G-PPT
F1	OH	OH	Glycosyl	Glycosyl	3-G-F1

DM

H

Glycosyl

3-G-DM

When R1 and R3 be H, R2 is OH, described formula (V) compound is protopanoxadiol (PPD), and described polypeptide is selected from SEQ ID NOs.:22,24,41 or 43 or its derivative polypeptide.

When R1 be H, R2 be OH, R3 is glucosyl group, described formula (V) compound is Ginsenoside compound K, and described polypeptide is selected from SEQ ID NOs.:22,24 or 43 or its derivative polypeptide;

When R1 be OH, R2 be OH, R3 is H, described formula (V) compound is Protopanaxatriol (PPT), and described polypeptide is selected from SEQ ID NOs.:22,24 or 41 or its derivative polypeptide;

When R1 be OH, R2 be OH, R3 is glucosyl group, described formula (V) compound is GF1, and described polypeptide is selected from SEQ ID NOs.:22 or 24 or its derivative polypeptide;

When R1 to be H, R2 be OH, R3 is for during for H, described formula (V) compound is selected from SEQ ID NOs.:22 or 24 or its derivative polypeptide for the polypeptide described in dammarenediol (DM).

Formula (VII) Formula (VIII) compound

Compound after R1-R2 is substituted is as shown in the table:

Namely, when R1 is OH, described formula (VII) compound is 25-OH-PPD;

When R1 is OCH, described formula (VII) compound is 25-OCH ₃-PPD.

Formula (IX) Formula (X) compound

Wherein, R1 is glycosyl; R2 and R3 is OH or H; R4 is glycosyl or H; R5 is glycosyl, and described polypeptide is selected from SEQ ID NOs.:26,28,55,57,59 or 61 or its derivative polypeptide.

Compound after R1-R4 is substituted is as shown in the table:

Formula (XI) Formula (XII) compound

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or its derivative polypeptide.

Formula (XIII) Formula (XIV) compound

When R1 and R2 be H, R3 is glucosyl group, formula (XIII) compound is Rh1.

Formula (XV) Formula (XVI) compound

Formula (XVII) Formula (XVIII) compound

Formula (XIX) Formula (XX) compound

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or 41 or 43 or its derivative polypeptide.

Formula (XXI) Formula (XXII) compound

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or 41 or its derivative polypeptide.

Described polypeptide preferred sequence is SEQ ID NOs.:2,16,18,20,22,24,41,26,28,43, the polypeptide shown in 55,57,59 or 61, this term also comprise have to have with shown polypeptide identical function, SEQ ID NOs.:2,16,18,20,22,24,41,26,28,43,55,57, the variant form of 59 or 61 sequences and derivative polypeptide.These variant forms comprise (but being not limited to): one or morely (be generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally within 20, within being preferably 10, within being more preferably 5) amino acid.Such as, in the art, when replacing with similar nature or similar amino acid, the function of protein can not usually be changed.Again such as, add at C-terminal and/or N-terminal the function that or several amino acid also can not change protein usually.This term also comprises active fragments and the reactive derivative of Human epidermal growth factor receptor vA albumen.The present invention also provides the analogue of described polypeptide.The difference of these analogues and natural human EGFRvA polypeptide can be the difference on aminoacid sequence, can be also the difference do not affected on the modified forms of sequence, or have both at the same time.These polypeptide comprise genetic variant that is natural or induction.Induce variation body can be obtained by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also by site-directed mutagenesis or the biological technology of other known moleculars.Analogue also comprises the analogue with the residue (as D-amino acid) being different from natural L-amino acids, and has the analogue of amino acid (as β, gamma-amino acid) that is that non-natural exists or synthesis.Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide exemplified.

(usually the not changing primary structure) form of modification comprises: the chemically derived form of the polypeptide that body is interior or external is as acetylize or carboxylated.Modify and also comprise glycosylation, as carried out glycosylation modified and polypeptide that is that produce in those in the synthesis of polypeptide and processing or further procedure of processing.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) by being exposed to by polypeptide and completing.Modified forms also comprises the sequence with phosphorylated amino acid residue (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Also comprise and modified thus improve its anti-proteolysis performance or optimize the polypeptide of solubility property.

GGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of the present invention, gGT29, gGT29-3, gGT29-4, gGT29-5, the aminoterminal of gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 albumen or carboxyl terminal also can contain one or more polypeptide fragment, as protein tag.Any suitable label may be used to the present invention.Such as, described label can be FLAG, HA, HA1, c-Myc, Poly – His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out purifying to albumen.Table 1 lists some labels wherein and sequence thereof.

Table 1

Express (as being secreted into extracellular) to make the protein excretion of translation, also can at described gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, the amino amino end of gGT29-7 and 3GT1,3GT2,3GT3,3GT4 adds upper signal peptide sequence, as pelB signal peptide etc.Signal peptide can be cut from intracellular secretory process out at polypeptide.

Polynucleotide of the present invention can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-strand.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can the varient of or degeneracy identical with the coding region sequence shown in SEQ ID NOs.:1.As used herein, " varient of degeneracy " refer in the present invention coding have SEQ ID NOs.:2,4,6,16,18,20,22,24,26,28,41,43,55,57, the protein of 59 or 61, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60.

Coding SEQ ID NOs.:2,4,6,16,18,20,22,24,26,28,41,43,55,57, the polynucleotide of the mature polypeptide of 59 or 61 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional coding sequence; The encoding sequence (with optional additional coding sequence) of mature polypeptide and non-coding sequence.

Term " polynucleotide of coded polypeptide " can be the polynucleotide comprising encoding such peptides, also can be the polynucleotide also comprising additional code and/or non-coding sequence.

The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, the sum analogous to general Dedekind sum of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient of non-natural generation.These nucleotide variants comprise and replace varient, Deletion variants and insertion varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be the replacement of one or more Nucleotide, disappearance or insertion, but can not from the function of polypeptide changing in fact its coding.

The invention still further relates to and above-mentioned sequence hybridization and have at least 50% between two sequences, preferably at least 70%, the more preferably polynucleotide of at least 80% homogeny.The present invention be more particularly directed to polynucleotide interfertile with polynucleotide of the present invention under stringent condition (or stringent condition).In the present invention, " stringent condition " refers to: (1) compared with the hybridization under low ionic strength and comparatively high temps and wash-out, as 0.2 × SSC, 0.1%SDS, 60 DEG C; Or be added with denaturing agent during (2) hybridization, and as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 DEG C etc.; Or (3) homogeny only between two sequences, at least more than 90%, is just hybridized when being more preferably more than 95%.Further, the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in SEQ ID NOs.:2,4,6,16,18,20,22,24,26,28,41,43,55,57,59 or 61.

The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment ", at least containing 15 Nucleotide, is better at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to be separated coding gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, the polynucleotide of gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 albumen.

Polypeptide in the present invention and polynucleotide preferably provide with the form be separated, and are more preferably purified to homogeneous.

GGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of the present invention, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 Nucleotide full length sequence or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic usually.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the cDNA storehouse prepared by ordinary method well known by persons skilled in the art as template, amplification and relevant sequence.When sequence is longer, usually needs to carry out twice or repeatedly pcr amplification, and then the fragment that each time amplifies is stitched together by proper order.

Once obtain relevant sequence, just relevant sequence can be obtained in large quantity with recombination method.This is normally cloned into carrier, then proceeds to cell, is then separated from the host cell after propagation by ordinary method and obtains relevant sequence.

In addition, also relevant sequence can be synthesized, when especially fragment length is shorter by the method for synthetic.Usually, by first synthesizing multiple small segment, and then carry out connect can obtain the very long fragment of sequence.

At present, the DNA sequence dna of code book invention albumen (or its fragment, or derivatives thereof) can be obtained completely by chemosynthesis.Then this DNA sequence dna can be introduced in various existing DNA molecular (or as carrier) as known in the art and cell.In addition, also by chemosynthesis, sudden change is introduced in protein sequence of the present invention.

The method of application round pcr DNA amplification/RNA is optimized for and obtains gene of the present invention.When being particularly difficult to obtain the cDNA of total length from library, preferably can use RACE method (RACE-cDNA end rapid amplification), primer for PCR suitably can be selected according to sequence information of the present invention disclosed herein, and using conventional procedures synthesis.Using conventional procedures is as the DNA/RNA fragment increased by gel electrophoresis abstraction and purification.

The present invention also relates to the carrier comprising polynucleotide of the present invention, and with carrier of the present invention or gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, the host cell that gGT29-7 and 3GT1,3GT2,3GT3,3GT4 albumen coded sequence produce through genetically engineered, and the method for polypeptide of the present invention is produced through recombinant technology.

By the recombinant DNA technology of routine, polynucleotide sequence of the present invention can be utilized to can be used to gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of expression or Restruction, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 polypeptide.In general following steps are had:

(1). with coding gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of the present invention, gGT29, gGT29-3, gGT29-4, gGT29-5, the polynucleotide (or varient) of gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 polypeptide, or transform or suitable host cell of transduceing with the recombinant expression vector containing these polynucleotide;

(2). the host cell cultivated in suitable substratum;

(3). separation, protein purification from substratum or cell.

In the present invention, gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 polynucleotide sequence can be inserted in recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell is viral, mammalian cell is viral as adenovirus, retrovirus or other carriers.As long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is usually containing replication orgin, promotor, marker gene and translation controlling elements.

Method well-known to those having ordinary skill in the art can be used for building containing gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 DNA sequences encoding and the suitable expression vector of transcribing/translating control signal.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, synthesizes to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; Lambda particles phage PL promotor; Eukaryotic promoter comprise CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus LTRs and some other known can the promotor expressed in protokaryon or eukaryotic cell or its virus of controlling gene.Expression vector also comprises ribosome bind site and the transcription terminator of translation initiation.

In addition, expression vector preferably comprises one or more selected marker, to be provided for the phenotypic character selecting the host cell transformed, as Tetrahydrofolate dehydrogenase, neomycin resistance and green fluorescent protein (GFP) that eukaryotic cell is cultivated, or for colibacillary tsiklomitsin or amicillin resistance.

Comprise the carrier of above-mentioned suitable DNA sequence dna and suitably promotor or control sequence, may be used for transforming suitable host cell, with can marking protein.

Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell is as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast etc. of CHO, COS, 293 cells or Bowes melanoma cells.

When polynucleotide of the present invention are expressed in higher eucaryotic cells, if will make to transcribe to be enhanced when inserting enhancer sequence in the carrier.Enhanser is the cis-acting factors of DNA, and nearly 10 to 300 base pairs, act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period, the polyoma enhancer in replication origin side in late period and adenovirus cancers etc.

Persons skilled in the art all know how to select suitable carrier, promotor, enhanser and host cell.

Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host be prokaryotic organism as intestinal bacteria time, the competent cell that can absorb DNA can be gathered in the crops at exponential growth after date, uses CaCl ₂method process, step used is well-known in this area.Another kind method uses MgCl ₂.If needed, transform and also can be undertaken by the method for electroporation.When host is eukaryote, can select following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods is as microinjection, electroporation, liposome packaging etc.

The transformant obtained can be cultivated by ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to host cell used, substratum used in cultivation can be selected from various conventional medium.Cultivate under the condition being suitable for host cell growth.When after host cell growth to suitable cell density, the promotor selected with the induction of suitable method (as temperature transition or chemical induction), cultivates for some time again by cell.

Recombinant polypeptide in the above methods can be expressed or be secreted into extracellular in cell or on cytolemma.If needed, can utilize its physics, the albumen of being recombinated by various separation method abstraction and purification with other characteristic of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation process, combination by protein precipitant process (salting-out method), centrifugal, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.

Application

The active polypeptide that the present invention relates to or peptidyl transferase gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, the purposes of gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 includes, but is not limited to: special and the C-20 position of the substrate of catalysis tetracyclic triterpenoids compound efficiently and/or the hydroxyl glycosylation of C-6 position and/or C-3 or transferred to by the glycosyl from glycosyl donor on the C-3 position of tetracyclic triterpenoid and first glycosyl of C-6 position to extend sugar chain.Particularly protopanoxadiol can be converted into rare ginsenoside CK and Rh2 with antitumour activity, Protopanaxatriol is converted into there is the rare ginsenoside F1 of activity of fighting against senium and the rare ginsenoside Rh1 of anti-allergic effects, Rh2 is converted into the rare ginsenoside Rg3 that antitumour activity is more excellent.Glycosyltransferase of the present invention can also will reach the rare glycol of agate, Protopanaxatriol, F1,25-OH-PPD, 25-OCH ₃new saponin(e 20-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl)-PPT, 3-O-β-(D-glucopyranosyl)-F1,3-O-β-(D-glucopyranosyl)-25-OH-PPD, 3-O-β-(D-glucopyranosyl)-25-OCH of report is had no before-PPD synthesis ₃-PPD.Rh2, CK, Rg3 can also be converted into ginsenoside GF2, Rd and Rg1 etc. by glycosyltransferase of the present invention.

Described tetracyclic triterpenoids compound includes, but is not limited to: the tetracyclic triterpenoid such as dammarane type, lanolin alkane type, root of gansui alkane type, cycloartane (cyclic-ahltin alkane) type, apotirucallane type, cucurbitane, chinaberry alkane type of S configuration or R configuration.

The invention provides a kind of commercial catalytic processes, comprise: under the condition that glycosyl donor is provided, with gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of the present invention, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7,3GT1,3GT2,3GT3 and/or 3GT4 active polypeptide or peptidyl transferase obtain (II), (IV), (VI), (VIII), (X), (XII), (XIV), (XVI), (XVIII), (XX) or (XXII) compound.Specifically, in described (a) reaction, polypeptide used is selected from SEQ ID NOs.:2,16 or 18; In described (b) reaction, polypeptide used is selected from SEQ ID NOs.:20,2,16 or 18; The polypeptide that described (c) and (d) reacts used is selected from SEQ ID NOs.:22,24,41 and 43; In described (e) reaction, polypeptide used is selected from the active polypeptide of aminoacid sequence shown in SEQ ID NOs.:26,28,55,57,59 or 61; In described (F) reaction, polypeptide used is selected from the active polypeptide of aminoacid sequence shown in SEQ ID NOs.:22 or 24; .

Described glycosyl donor is nucleoside diphosphate sugar, be selected from lower group: UDPG, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-ethanoyl glucose, ADP-ethanoyl glucose, TDP-ethanoyl glucose, CDP-ethanoyl glucose, GDP-ethanoyl glucose, UDP-wood sugar, ADP-wood sugar, TDP-wood sugar, CDP-wood sugar, GDP-wood sugar, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-semi-lactosi, ADP-semi-lactosi, TDP-semi-lactosi, CDP-semi-lactosi, GDP-semi-lactosi, UDP-pectinose, ADP-pectinose, TDP-pectinose, CDP-pectinose, GDP-pectinose, UDP-rhamnosyl, ADP-rhamnosyl, TDP-rhamnosyl, CDP-rhamnosyl, GDP-rhamnosyl, or other nucleoside diphosphate hexoses or nucleoside diphosphate pentose, or its combination.

Described glycosyl donor is preferably uridine diphosphate (UDP) sugar, is selected from lower group: UDPG, UDP-galacturonic acid, UDP-semi-lactosi, UDP-pectinose, UDP-rhamnosyl, or other uridine diphosphate (UDP) hexoses or uridine diphosphate (UDP) pentose, or its combination.

In the process, enzymic activity additive (improving the additive of enzymic activity or inhibitory enzyme activity) can also be added.The additive of described enzymic activity can be selected from lower group: Ca ²⁺, Co ²⁺, Mn ²⁺, Ba ²⁺, Al ³⁺, Ni ²⁺, Zn ²⁺, or Fe ²⁺; Or for can Ca be generated ²⁺, Co ²⁺, Mn ²⁺, Ba ²⁺, Al ³⁺, Ni ²⁺, Zn ²⁺, or Fe ²⁺material.

The pH condition of described method is: pH4.0-10.0, preferred pH6.0-pH8.5, more preferably 8.5.

The temperature condition of described method is: 10 DEG C-105 DEG C, preferably 25 DEG C-35 DEG C, more preferably 35 DEG C.

Present invention also offers a kind of composition, it contains active polypeptide of the present invention or peptidyl transferase gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of significant quantity, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7,3GT1,3GT2,3GT3 and 3GT4, and in bromatology or industrial acceptable carrier or vehicle.This kind of carrier comprises (but being not limited to): water, damping fluid, glucose, water, glycerine, ethanol and combination thereof.

The material regulating gGT25 enzymic activity of the present invention also can be added in described composition.Any material with raising enzymic activity function is all available.Preferably, the material selected from mercapto ethanol of described raising gGT25 enzymic activity of the present invention.In addition, a lot of material can reduce enzymic activity, includes but not limited to: Ca ²⁺, Co ²⁺, Mn ²⁺, Ba ²⁺, Al ³⁺, Ni ²⁺, Zn ²⁺and Fe ²⁺; Or hydrolyzable forms Ca after being added into substrate ²⁺, Co ²⁺, Mn ²⁺, Ba ²⁺, Al ³⁺, Ni ²⁺, Zn ²⁺and Fe ²⁺material.

Obtaining gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of the present invention, gGT29, gGT29-3, gGT29-4, after gGT29-5, gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4, those skilled in the art can apply this enzyme to play the effect turning glycosyl easily, particularly to the transglycosylation reaching the rare glycol of agate, protopanoxadiol and Protopanaxatriol.As optimal way of the present invention, additionally provide the method that two kinds form rare ginsenoside, one of the method comprises: with gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5 of the present invention, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7, the substrate of 3GT1 and/or 3GT2 ferment treatment glycosyl to be turned, described substrate comprises and reaches the rare glycol of agate, protopanoxadiol and the tetracyclic triterpenoid such as Protopanaxatriol and derivative thereof.Preferably, under pH3.5-10 condition, with described gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, the substrate of gGT29-5, gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4 ferment treatment glycosyl to be turned.Preferably, under temperature 30-105 DEG C of condition, with described gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1,3GT2,3GT3,3GT4, gGT29-3, the substrate of 3GT1 and/or 3GT2 ferment treatment glycosyl to be turned.

Two of the method comprises: by gGT25 of the present invention, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 gene proceeds to synthesize and reaches the rare glycol of agate, the engineering bacteria of protopanoxadiol or Protopanaxatriol (such as, yeast or colibacillus engineering) in, or, by gGT25, gGT13, gGT30, gGT25-1, gGT25-3, gGT25-5, gGT29, gGT29-3, gGT29-4, gGT29-5, gGT29-6, gGT29-7 and 3GT1, 3GT2, 3GT3, 3GT4 gene with reach the rare glycol of agate, key gene in protopanoxadiol and Protopanaxatriol's metabolic pathway of synthesizing is coexpression in host cell (such as yeast cell or intestinal bacteria), obtain direct production rare ginsenoside CK, Rh2, Rg3, the recombinant bacterium of Rh1 or F1.

The described key gene reached in the rare glycol metabolic pathway of synthesizing of agate includes, but is not limited to: dammarenediol synthase gene.

In another preference, key gene in described protopanoxadiol metabolic pathway of synthesizing includes, but is not limited to: the reductase gene of dammarenediol synthase gene, Cytochrome P450 CYP716A47 gene and P450CYP716A47, or its combination.Or the isozyme of above various enzyme and combination thereof.Wherein, epoxy squalene (yeast saccharomyces cerevisiae self synthesis) is converted into dammarenediol by dammarenediol synthetic enzyme, and dammarenediol is converted into protopanoxadiol by Cytochrome P450 CYP716A47 and reductase enzyme again thereof.(Han?et.al，plant&cell?physiology，2011，52.2062-73)

In another preference, key gene in described Protopanaxatriol's metabolic pathway of synthesizing includes, but is not limited to: the reductase gene of dammarenediol synthase gene, Cytochrome P450 CYP716A47 gene, P450CYP716A47 and Cytochrome P450 CYP716A53V2 gene, or its combination.Or the isozyme of above various enzyme and combination thereof.Wherein, epoxy squalene (yeast saccharomyces cerevisiae self synthesis) is converted into dammarenediol by dammarenediol synthetic enzyme, dammarenediol is converted into protopanoxadiol by Cytochrome P450 CYP716A47 and reductase enzyme again thereof, and protopanoxadiol is converted into Protopanaxatriol by the reductase enzyme of Cytochrome P450 CYP716A53v2 (JX036031) and P450CYP716A47 more further.(Han?et.al，plant&cell?physiology，2012，53.1535-45)

Major advantage of the present invention:

(1) glycosyltransferase of the present invention can specificity and proceed to glucose by the C-20 position of tetracyclic triterpenoids compound substrate and/or C-6 position and/or C-3 position hydroxyl efficiently;

(2) glycosyltransferase of the present invention can specificity and being transferred to by the glycosyl from glycosyl donor efficiently on the C-3 position of tetracyclic triterpenoid and first glycosyl of C-6 position to extend sugar chain

(3) protopanoxadiol and Protopanaxatriol can be converted into rare ginsenoside CK, Rh2 or the Rg3 with antitumour activity and the rare ginsenoside F1 with activity of fighting against senium, have the rare ginsenoside Rh1 of anti-allergic effects by glycosyltransferase of the present invention especially respectively;

(4) glycosyltransferase of the present invention can also will reach the rare glycol of agate, Protopanaxatriol, F1,25-OH-PPD, 25-OCH ₃-PPD, lanosterol, Ganoderic acid C2, Agladupol A, Hispidol B and 24 (R)-Cycloartane-3beta, 24, new compound 20-O-β-(D-glucopyranosyl)-dammarendiolII of report is had no before 25-triol synthesis, 3-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl)-PPT, 3-O-β-(D-glucopyranosyl)-F1, 3-O-β-(D-glucopyranosyl)-25-OH-PPD, 3-O-β-D-glucopyranosyl)-25-OCH ₃-PPD, 3-O-β-(D-glucopyranosyl)-lanosterol, 3-O-β-(D-glucopyranosyl)-Ganoderic acid C2,3-O-β-(D-glucopyranosyl)-Agladupol A, 3-O-β-(D-glucopyranosyl)-Hispidol B and 3-O-β-(D-glucopyranosyl)-24 (R)-Cycloartane-3beta, 24,25-triol.

(5) 3GT1,3GT2, gGT29, the catalytic activity of gGT29-3 and gGT25-5 by the impact of 20 hydroxyls in tetracyclic triterpenoids compound or glycosyl sterie configuration, both can the ginsenoside (sapogenin) of catalysis 20 (S) configuration also can the ginsenoside (sapogenin) of catalysis 20 (R) configuration.

(6) in yeast, construct ginsengenin (reach the rare glycol of agate, protopanoxadiol and Protopanaxatriol) route of synthesis, thus realize with monose such as glucose as substrate, fermentative production new compound 20-O-β-(D-glucopyranosyl)-dammarendiolII is carried out with yeast, 3-O-β-(D-glucopyranosyl)-dammarendiolII, 3-O-β-(D-glucopyranosyl)-PPT, 3-O-β-(D-glucopyranosyl)-F1, 3-O-β-(D-glucopyranosyl)-lanosterol etc. and rare ginsenoside CK, F1, Rh1, Rh2 and Rg3, this not only can solve the raw material sources problem that saponin(e is produced, and significantly can reduce rare saponin(e CK, F1, Rh1, the production cost of Rh2 and Rg3.

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.

Embodiment 1

The separation of glycosyltransferase and encoding gene thereof

The cDNA sequence of more than 100 prediction glycosyltransferase is extracted from the panax species express spectra data delivered, therefrom clone 60 cDNA full length sequences and expression and Transglycosylation analysis have been carried out to them, wherein having had 11 kinds of expression products to have ginsengenin and saponin(e and turn glycosyl activity.

Extract ginseng RNA and carry out reverse transcription, obtaining the cDNA of ginseng.Carry out pcr amplification with this cDNA for template, use wherein primer pair 1 (SEQ ID NOs.:7,8); Primer pair 2 (SEQ ID NOs.:9,10); Primer pair 3 (SEQ ID NOs.:11,12); Primer pair 5 (SEQ ID NOs.:34,35); Primer pair 7 (SEQ ID NOs.:46,47); Primer pair 8 (SEQ ID NOs.:62,63); Primer pair 9 (SEQ ID NOs.:64,65) all obtains amplified production.Archaeal dna polymerase selects the KOD archaeal dna polymerase of the high-fidelity of precious biotechnology company limited.PCR primer detects (Fig. 1,19 (c) and 31) through agarose gel electrophoresis.Irradiate under ultraviolet, cut target dna band.Then adopt Axygen Gel Extraction Kit (AEYGEN company) from sepharose, reclaim DNA and be the DNA fragmentation amplified.The rTaq archaeal dna polymerase of this DNA fragmentation with precious biotechnology company limited is connected with commercially available cloning vector pMD18-T Vector after end adds A, connect the intestinal bacteria EPI300 competent cell that product conversion is commercially available, Escherichia coli bacteria liquid after transforming is coated on the LB flat board of interpolation penbritin 50ug/mL, IPTG0.5mM, X-Gal25 μ g/mL, and further by PCR and digestion verification recombinant clone.Choose respectively after one of them clone extracts recombinant plasmid and check order.Open reading frame (ORF) is found with BESTORF software.By sequence alignment, ORF encodes glycosyltransferase the 1st family's conserved functional domains, is shown to be glycosyltransferase gene.

With the gene that primer pair 1 (SEQ ID NOs.:7,8) obtains have SEQ ID NOs.:1,15, the nucleotide sequence shown in 17 and 19, respectively called after gGT25, gGT25-1, gGT25-3 and gGT25-5.From the albumen coded sequence (CDS) that 5 ' of SEQ ID NO.:1 end the 1 to 1425 Nucleotide is gGT25, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:1 is the initiator codon ATG of gGT25 gene.In sequence table, 5 ' end the 1 to 1428 Nucleotide of SEQ ID NO.:15 is the open reading frame (ORF) of gGT25-1, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:15 is the initiator codon ATG of gGT25-1 gene, and the 1426 to 1428 Nucleotide held from 5 ' of SEQ ID NO.:15 is the terminator codon TAA of gGT25-1 gene.From the open reading frame (ORF) that 5 ' end the 1 to 1428 Nucleotide of SEQ ID NO.:17 is gGT25-3, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:17 is the initiator codon ATG of gGT25-3 gene, and the 1426 to 1428 Nucleotide held from 5 ' of SEQ ID NO.:17 is the terminator codon TAA of gGT25-3 gene.From the open reading frame (ORF) that 5 ' end the 1 to 1419 Nucleotide of SEQ ID NO.:19 is gGT25-5, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:19 is the initiator codon ATG of gGT25-5 gene, and the 1426 to 1428 Nucleotide held from 5 ' of SEQ ID NO.:19 is the terminator codon TAA of gGT25-5 gene.

There is the nucleotide sequence shown in SEQ ID NO.:3, called after gGT13 with the gene that primer pair 2 (SEQ ID NOs.:9,10) obtains.From the open reading frame (ORF) that 5 ' end the 1 to 1431 Nucleotide of SEQ ID NO.:3 is gGT13, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:3 is the initiator codon ATG of gGT13 gene, and the 1429 to 1431 Nucleotide held from 5 ' of SEQ ID NO.:1 is the terminator codon TAA of gGT13 gene.

There is the nucleotide sequence shown in SEQ ID NO.:5, called after gGT30 with the gene that primer pair 3 (SEQ ID NOs.:11,12) obtains.From the open reading frame (ORF) that 5 ' end the 1 to 1353 Nucleotide of SEQ ID NO.:5 is gGT30, from the initiator codon ATG that position, the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:5 holds is gGT30 gene, the 1351 to 1353 Nucleotide held from 5 ' of SEQ ID NO.:5 is the terminator codon TAA of gG30 gene.

Obtain gene with primer pair 5 (SEQ ID NOs.:34,35) and there is SEQ ID NOs.:25, the nucleotide sequence shown in 27, respectively called after gGT29 and gGT29-3.From the open reading frame (ORF) that 5 ' end the 1 to 1329 Nucleotide of SEQ ID NO.:25 is gGT29, from the initiator codon ATG that position, the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:25 holds is gGT29 gene, the 1327 to 1329 Nucleotide held from 5 ' of SEQ ID NO.:25 is the terminator codon TAG of gG29 gene.From the initiator codon ATG that position, the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:27 holds is gGT29-3 gene, the 1327 to 1329 Nucleotide held from 5 ' of SEQ ID NO.:27 is the terminator codon TAG of gGT29-3 gene.

Obtain gene with primer pair 6 (SEQ ID NOs.:46,47) and there is the nucleotide sequence shown in SEQ ID NO.:42, called after 3GT4.From the open reading frame (ORF) that 5 ' end the 1 to 1374 Nucleotide of SEQ ID NO.:42 is 3GT4, from the initiator codon ATG that the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:42 holds is 3GT4 gene, the 1372 to 1374 Nucleotide held from 5 ' of SEQ ID NO.:42 is the terminator codon TAG of 3GT4 gene.

Obtain gene with primer pair 7 (SEQ ID NOs.:62,63) and there is the nucleotide sequence shown in SEQ ID NO.54,56,58, called after gGT29-4, gGT29-5 and gGT29-6.From the open reading frame (ORF) that 5 ' end the 1 to 1341 Nucleotide of SEQ ID NO.:54 is gGT29-4, from the initiator codon ATG that the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:54 holds is gGT29-4 gene, the 1339 to 1341 Nucleotide held from 5 ' of SEQ ID NO.:54 is the terminator codon TAG of gGT29-4 gene.From the open reading frame (ORF) that 5 ' end the 1 to 1341 Nucleotide of SEQ ID NO.:56 is gGT29-5, from the initiator codon ATG that the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:56 holds is gGT29-5 gene, the 1339 to 1341 Nucleotide held from 5 ' of SEQ ID NO.:56 is the terminator codon TAG of gGT29-5 gene.From the open reading frame (ORF) that 5 ' end the 1 to 1341 Nucleotide of SEQ ID NO.:58 is gGT29-6, from the initiator codon ATG that the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:58 holds is gGT29-6 gene, the 1339 to 1341 Nucleotide held from 5 ' of SEQ ID NO.:58 is the terminator codon TAG of gGT29-6 gene.

Obtain gene with primer pair 8 (SEQ ID NOs.:64,65) and there is the nucleotide sequence shown in SEQ ID NO.60, called after gGT29-7.From the open reading frame (ORF) that 5 ' end the 1 to 1341 Nucleotide of SEQ ID NO.:60 is gGT29-7, from the initiator codon ATG that the 1-3 position Nucleotide that 5 ' of SEQ ID NO.:60 holds is gGT29-7 gene, the 1339 to 1341 Nucleotide held from 5 ' of SEQ ID NO.:60 is the terminator codon TAG of gGT29-7 gene.Synthetic has SEQ ID NOs.:21, the nucleotide sequence shown in 23 and 40, respectively called after 3GT1,3GT2 and 3GT3.From the open reading frame (ORF) that 5 ' end the 1 to 1488 Nucleotide of SEQ ID NO.:21 is 3GT1, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:21 is the initiator codon ATG of 3GT1 gene, and the 1486 to 1488 Nucleotide held from 5 ' of SEQ ID NO.:21 is the terminator codon TAA of 3GT1 gene.From the open reading frame (ORF) that 5 ' end the 1 to 1488 Nucleotide of SEQ ID NO.:23 is 3GT2, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:23 is the initiator codon ATG of 3GT2 gene, and the 1486 to 1488 Nucleotide held from 5 ' of SEQ ID NO.:23 is the terminator codon TAA of 3GT2 gene.From the open reading frame (ORF) that 5 ' end the 1 to 1494 Nucleotide of SEQ ID NO.:40 is 3GT3, the 1-3 position Nucleotide held from 5 ' of SEQ ID NO.:40 is the initiator codon ATG of 3GT3 gene, and the 1492 to 1494 Nucleotide held from 5 ' of SEQ ID NO.:40 is the terminator codon TAA of 3GT3 gene.With primer pair 4 (SEQ ID NOs.:29,30) carry out pcr amplification to the gene (SEQ ID NO.:21 and SEQ ID NO.:23) of wherein two synthetic, the PCR primer of acquisition has the nucleotide sequence (Figure 19 (a)) shown in SEQ ID NO.:21 and SEQ ID NO.:23; Carry out pcr amplification with the gene (SEQ ID NO.:40) of primer pair 6 (SEQ ID NOs.:44,45) to an other synthetic, the PCR primer of acquisition has the nucleotide sequence (Figure 19 (b)) shown in SEQ ID NO.:40.

Glycosyltransferase gene gGT25 encodes one containing 475 amino acid whose protein gGT25, have in sequence table shown in SEQ ID NO.:2 aminoacid sequence.Be 53kDa, iso-electric point pI by the theoretical molecular size of this protein of software prediction be 5.14.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 344-387 position of SEQ ID NO.:2.The Amino acid sequence identity of the saponin glycosyl transferase gene predicted in this glycosyltransferase and ginseng transcript profile is lower than 52%.

Glycosyltransferase gene gGT25-1 encodes one containing 475 amino acid whose protein gGT25-1, have in sequence table shown in SEQ ID NO.:16 aminoacid sequence.Be 53kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 4.91.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 344-387 position of SEQ ID NO.:16.The Amino acid sequence identity of the saponin glycosyl transferase gene predicted in this glycosyltransferase and ginseng transcript profile is lower than 52%.

Glycosyltransferase gene gGT25-3 encodes one containing 475 amino acid whose protein gGT25-3, have in sequence table shown in SEQ ID NO.:18 aminoacid sequence.Be 53kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.05.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 344-387 position of SEQ ID NO.:18.The Amino acid sequence identity of the saponin glycosyl transferase gene predicted in this glycosyltransferase and ginseng transcript profile is lower than 52%.

Glycosyltransferase gene gGT25-5 encodes one containing 472 amino acid whose protein gGT25-5, have in sequence table shown in SEQ ID NO.:20 aminoacid sequence.Be 53kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 4.98.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 343-386 position of SEQ ID NO.:20.The Amino acid sequence identity of the saponin glycosyl transferase gene predicted in this glycosyltransferase and ginseng transcript profile is lower than 52%.

Glycosyltransferase gene gGT13 encodes one containing 476 amino acid whose protein gGT13, have in sequence table shown in sequence SEQ ID NO.:4 aminoacid sequence.Be 53kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 4.91.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 343-386 position of SEQ ID NO.:4.The Amino acid sequence identity of the saponin glycosyl transferase gene predicted in this glycosyltransferase and ginseng transcript profile is up to 99.5%.

Glycosyltransferase gene gGT30 encodes one containing 451 amino acid whose protein gGT30, have in sequence table shown in SEQ ID NO.:6 aminoacid sequence.Be 51kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 6.79.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 318-361 position of SEQ ID NO.:6.Glycosyltransferase (XP_002271587) similarity the highest (53%) of the same Wine Grape of this glycosyltransferase (Vitis vinifera), shows that this glycosyltransferase is new enzyme.

Glycosyltransferase gene 3GT1 encodes one containing 495 amino acid whose protein 3GT1, have in sequence table shown in SEQ ID NO.:22 aminoacid sequence.Be 56kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.52.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 355-398 position of SEQ ID NO.:22.The glycosyltransferase UGT73C10 homology >99% that this glycosyltransferase and European yellor rocket (Barbarea vulgaris) are originated

Glycosyltransferase gene 3GT2 encodes one containing 495 amino acid whose protein 3GT2, have in sequence table shown in SEQ ID NO.:24 aminoacid sequence.Be 56kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.62.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 355-398 position of SEQ ID NO.:24.The glycosyltransferase UGT73C12 homology >99% that this glycosyltransferase and European yellor rocket (Barbarea vulgaris) are originated

Glycosyltransferase gene gGT29 encodes one containing 442 amino acid whose protein gGT29, have in sequence table shown in SEQ ID NO.:26 aminoacid sequence.Be 49kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.93.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 317-360 position of SEQ ID NO.:26.The sequence similarity of the glycosyltransferase that this glycosyltransferase and Wine Grape (Vitis vinifera) are originated is lower than 56%.

Glycosyltransferase gene gGT29-3 encodes one containing 442 amino acid whose protein gGT29-3, have in sequence table shown in SEQ ID NO.:28 aminoacid sequence.Be 49kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.48.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 317-360 position of SEQ ID NO.:28.The sequence similarity of the glycosyltransferase that this glycosyltransferase and Wine Grape (Vitis vinifera) are originated is lower than 56%.

Glycosyltransferase gene 3GT3 encodes one containing 497 amino acid whose protein 3GT3, have in sequence table shown in SEQ ID NO.:41 aminoacid sequence.Be 55kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.50.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 350-393 position of SEQ ID NO.:41.The glycosyltransferase homology >99% that this glycosyltransferase and M. truncatula (Medicago truncatula) are originated.

Glycosyltransferase gene 3GT4 encodes one containing 458 amino acid whose protein 3GT4, have in sequence table shown in SEQ ID NO.:43 aminoacid sequence.Be 51kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.10.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 333-376 position of SEQ ID NO.:43.The sequence homology of the glycosyltransferase that this glycosyltransferase and Wine Grape (Vitis vinifera) are originated is lower than 50%.

Glycosyltransferase gene gGT29-4 encodes one containing 446 amino acid whose protein gGT29-4, have in sequence table shown in SEQ ID NO.:55 aminoacid sequence.Be 50kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.78.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 321-364 position of SEQ ID NO.:55.The sequence similarity of the glycosyltransferase that this glycosyltransferase and Radix Bupleuri (Bupleurum chinense) are originated is lower than 57%.

Glycosyltransferase gene gGT29-5 encodes one containing 446 amino acid whose protein gGT29-5, have in sequence table shown in SEQ ID NO.:57 aminoacid sequence.Be 50kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.93.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 321-364 position of SEQ ID NO.:57.The sequence similarity of the glycosyltransferase that this glycosyltransferase and Radix Bupleuri (Bupleurum chinense) are originated is lower than 58%.

Glycosyltransferase gene gGT29-6 encodes one containing 446 amino acid whose protein gGT29-6, have in sequence table shown in SEQ ID NO.:59 aminoacid sequence.Be 50kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 6.03.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 321-364 position of SEQ ID NO.:59.The sequence similarity of the glycosyltransferase that this glycosyltransferase and Radix Bupleuri (Bupleurum chinense) are originated is lower than 59%.

Glycosyltransferase gene gGT29-7 encodes one containing 446 amino acid whose protein gGT29-7, have in sequence table shown in SEQ ID NO.:61 aminoacid sequence.Be 50kDa, iso-electric point pI with the theoretical molecular of this protein of software prediction be 5.80.Be glycosyltransferase the 1st family's conserved functional domains from the N-terminal 321-364 position of SEQ ID NO.:61.The sequence similarity of the glycosyltransferase that this glycosyltransferase and Radix Bupleuri (Bupleurum chinense) are originated is lower than 57%.

Table 2 shows glycosyltransferase of the present invention and sums up the glycosyl katalysis of substrate different positions, and "+" represents there is activity in this position.

Table 2

Note a: under C-20 glycosylated situation, just can carry out the glycosylation of C-6 position

Embodiment 2

Glycosyltransferase gene gGT25, the structure of the yeast recombinant expression vector of gGT25-1, gGT25-3 and gGT25-5

With the plasmid gGT25-pMD18T containing gGT25, gGT25-1, gGT25-3 and gGT25-5 gene that embodiment 1 builds, gGT25-1-pMD18T, gGT25-3-pMD18T and gGT25-5-pMD18T are template amplification target gene.

Forward primer used is:

5 '-GCCGGAGCTCATGAAGTCAGAATTGATATTC-3 ' (SEQ ID NO.:13), its 5 ' end adds SacI recognition site: GAGCTC;

Reverse primer used is:

5 '-GCCGCTCGAGTTAATGATGATGATGATGATGCATAATTTCCTCAAATAGCTTC-3 ' (SEQ ID NO.:14), its 5 ' end adds XholI recognition site: CTCGAG, and reverse primer introduces 6 × His Tag to carry out Western Blot detecting expression and purification.

Above-mentioned primer and template is utilized to be increased gGT25, gGT25-1, gGT25-3 and gGT25-5 gene by PCR method.Archaeal dna polymerase selects the high-fidelity DNA polymerase kod of Toyobo company, with reference to its specification sheets setting PCR program: 94 DEG C of 2min; 94 DEG C of 15s, 58 DEG C of 30s, 68 DEG C of 1.5min, totally 30 circulations; 68 DEG C of 10min; 10 DEG C of insulations.PCR primer detects through agarose gel electrophoresis, under ultraviolet light, cuts the band of the same size with target dna.Then the AxyPrep DNA Gel Extraction Kit of AXYGEN company is adopted to reclaim DNA fragmentation from sepharose.With Takara company QuickCut restriction enzyme Kpn I and the DNA fragmentation 30min that reclaims of Xba I double digestion, with the AxyPrep PCR Cleanup Kit of AXYGEN company, clean recovery is carried out to digestion products.Utilize the T4DNA ligase enzyme of NEB company that digestion products and Yeast Plasmid pYES2 (same cut with Kpn I and Xba I enzyme and tap rubber reclaim) 25 DEG C is connected 2h.Connect product conversion E.coli TOP10 competent cell, and coat on the LB flat board of interpolation 100 μ g/mL penbritin.Positive transformant is verified by bacterium colony PCR, and order-checking checking further, result shows expression plasmid gt25-pYES2, and gt25-1-pYES2, gt25-3-pYES2 and gt25-5-pYES2 successfully construct.

Embodiment 3

Glycosyltransferase gene gGT25, gGT25-1, gGT25-3 and the gGT25-5 expression in yeast saccharomyces cerevisiae

By electric method for transformation, the expression plasmid gt25-pYES2 built is transformed in yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), coat the dull and stereotyped SC-Ura of screening (0.67% yeast without the basic nitrogenous source of amino acid, 2% glucose).Yeast recon is verified by bacterium colony PCR.Choose yeast recon bacterium colony in 10mL SC-Ura (2% glucose) substratum, 30 DEG C of 200rpm cultivate 20h.4 DEG C of 3500g collected by centrifugation thalline, with aseptic deionized water cleaning thalline twice, with inducing culture SC-Ura (2% semi-lactosi) resuspended thalline, and are inoculated in 50mL inducing culture, make OD ₆₀₀about 0.4,30 DEG C of 200rpm start abduction delivering.The thalline of 4 DEG C of 3500g collected by centrifugation abduction delivering 12h, with aseptic deionized water cleaning thalline twice, is resuspended in yeast lysis buffer, makes OD ₆₀₀between 50-100.With Fastprep cell crushing instrument concussion broken yeast cell, 4 DEG C of centrifugal 10min of 12000g remove cell debris, collecting cell lysate supernatant.Get appropriate lysate supernatant and carry out SDS-PAGE electrophoresis detection, compared with the recon of pYES2 empty carrier, gt25-pYES2, gt25-1-pYES2, gt25-3-pYES2, gt25-5-pYES2 recon does not have obvious band feature, as Fig. 2.Anti-6 × His Tag Western Blot is adopted to detect expression, as shown in Figure 3, express gGT25, gGT25-1, the yeast saccharomyces cerevisiae recon of gGT25-3 and gGT25-5 shows very strong Western Blot signal, shows gGT25, gGT25-1, gGT25-3 and gGT25-5 be soluble-expression in yeast, and the recon turning pYES2 empty carrier does not then have anti-6 × His Tag Western Blot signal.

Embodiment 4

Yeast expression product gGT25, gGT25-1, gGT25-3 and gGT25-5 Transglycosylation and Product Identification

To express gGT25, gGT25-1, the recombination yeast cracking supernatant of gGT25-3 and gGT25-5 carrys out catalytic substrate protopanoxadiol (Protopanoxadiol PPD) as enzyme liquid, Protopanaxatriol (Protopanaxatriol PPT) and dammarenediol (Dammarenediol II, DM) Transglycosylation, expresses the recombination yeast cracking supernatant of empty carrier for contrast.100 μ L reaction systems are as table 3:

Table 3

9% polysorbas20	11.1μL
		50mM UDPG	10μL
1M?Tris-HCl?pH8.5	5μL
		100mM substrate (dissolve with ethanol)	0.5μL
Enzyme liquid	73.4μL

Reaction carries out 12h at 35 DEG C, then adds 100 μ L butanols termination reactions, and extract product.After product vacuum drying, use dissolve with methanol.

Reaction product first uses thin-layer chromatography (TLC) to detect, in the recombination yeast cracking expressing gGT25 or gGT25-1 or gGT25-3, clear enzyme solution in 20 hydroxyl glycosylations of protopanoxadiol and Protopanaxatriol, can be separately converted to rare ginsenoside CK and F1 (Fig. 6 and Fig. 7); 20 hydroxyls under the catalysis of gGT25, gGT25-1 and gGT25-3, can be continued glycosylation, generate F2 and Rd (Fig. 6) respectively by 3 glycosylated protopanaxadiol-type's saponin(es (Rh2 and Rg3) of hydroxyl; 20 of a PPT hydroxyl glycosylation not only can be generated F1 by gGT25, gGT25-1 and gGT25-3, can also continue glycosylation further form Rg1 (Fig. 7) at 6 hydroxyls; GGT25, gGT25-1 and gGT25-3 by 20 hydroxyl glycosylations of the precursor dammarenediol of PPD, can also obtain a kind of saponin(e 20-O-β-(D-glucopyranosyl)-dammarendiolII (Fig. 8) having no report.But glycosylated Protopanaxatriol's type saponin(e (Rh1, Rg2 and Rf) then can not by 20 hydroxyl glycosylations under the catalysis of gGT25, gGT25-1 and gGT25-3 for 6 hydroxyls.Meanwhile, gGT25, gGT25-1 and gGT25-3 can not the extensions of catalysis sugar chain.GGT25-5 and gGT25, there is difference in the catalytic activity of gGT25-1 and gGT25-3, it can not as gGT25, gGT25-1 with gGT25-3 is the same, at PPD, 20 hydroxyl glycosylations of PPT or dammarenediol, it by 6 of a PPT hydroxyl glycosylation, can only be converted into rare ginsenoside Rh1 (Fig. 7).

Further the converted product HPLC of gGT25 is identified (Figure 10 and Figure 11).In Fig. 10, have three peaks to occur, wherein peak 2 is consistent with the retention time of CK in standard specimen sample, and peak 3 is consistent with the peak of protopanoxadiol.Peak 3 is very little, and this illustrates that protopanoxadiol is substantially all converted in order to CK.Peak 1, also occurs in the collection of illustrative plates of negative contrast, so should have nothing to do with the conversion of protopanoxadiol.In fig. 11, also have three peaks to occur, peak 1 is consistent with the retention time of F1 in standard specimen sample, and peak 3 is consistent with the peak of Protopanaxatriol.Peak 3 is very little, and this illustrates that Protopanaxatriol is substantially converted in order to F1.Peak 2, also occurs in the collection of illustrative plates of negative contrast, so should have nothing to do with the conversion of Protopanaxatriol.

Finally of LC/MS, product is made to the qualification (Figure 12 and Figure 13) of a nearlyer step.Figure 12 is the mass spectrum to CK peak in protopanoxadiol converted product (in Figure 10 peak 2), and the mass spectrum of it and standard C K sample is completely the same.Figure 13 is the mass spectrum to F1 peak in Protopanaxatriol's converted product (in Figure 11 peak 1), and the mass spectrum of it and standard model F1 is completely the same.These results further demonstrate that the gGT25 converted product of protopanoxadiol and triol is respectively CK and F1.

Embodiment 5

The Transglycosylation of the clone of glycosyltransferase gene gGT13 and gGT30, expression and expression product thereof

By method similarly to Example 2, obtain the clone of gGT13 and gGT30, construct their yeast recombinant expression vector and proceed to yeast saccharomyces cerevisiae.According to the expression of the identical step abduction delivering glycosyltransferase of embodiment 3, although there is no the band (Fig. 4) of obvious target protein on SDS-PAGE glue, but Western Blot detects obvious hybridization information, this shows that gGT13 and gGT30 expresses (Fig. 5) all in yeast.

By method similarly to Example 4, utilize recombinant yeast cell lysate catalysis protopanoxadiol (PPD) and the Protopanaxatriol (PPT) respectively expressing gGT13 and gGT30.

Found that, the protein expressioning product of gGT13 and gGT30 all cannot transform PPD or PPT (Fig. 9); And gGT13 and gGT30 also cannot transform protopanaxadiol-type's saponin(e Rh2, CK, F2 and Rg3 and Protopanaxatriol type F1, Rh1 and Rg1.

Above result shows, although the consistence very high (99.5%) of the ginsenoside glycosyltransferase aminoacid sequence predicted in gGT13 and ginseng transcript profile, gGT13 and gGT30 does not have transglycosylation to above-mentioned substrate.

Embodiment 6

The expression of glycosyltransferase gene gGT25 in intestinal bacteria and the Transglycosylation of expression product thereof

The plasmid gGT25-pMD18T containing gGT25 gene built with embodiment 1 is for template amplification target gene gGT25, and be cloned in coli expression carrier pet28a (purchased from Merck company), build coli expression carrier gt25-pet28a, be transformed in commercially available E.coli BL21.Inoculate a recon in LB substratum, 30 DEG C of 200rpm are cultured to OD ₆₀₀about 0.6-0.8, makes bacterium liquid be cooled to 4 DEG C, adds the IPTG that final concentration is 50 μMs, 18 DEG C of 200rpm abduction delivering 15h.4 DEG C of collected by centrifugation thalline, sonicated cells, 4 DEG C of 12000g centrifugal collecting cell lysate supernatants, sample thief carries out SDS-PAGE electrophoresis.

Western Blot (Figure 14) shows, under 50 μMs of IPTG inductive conditions, glycosyltransferase gGT25 also can express in intestinal bacteria.With the cell lysate supernatant of this recombination bacillus coli for crude enzyme liquid carries out Transglycosylation, the condition of reaction is in the same manner as in Example 4.

Reaction carries out 12h at 35 DEG C, then adds 100 μ L butanols termination reactions, and extract product.After product vacuum drying, use dissolve with methanol.Reaction product first uses thin-layer chromatography (TLC) to detect, and in Figure 15, PPD can be converted into CK by visible gGT25 crude enzyme liquid.

Embodiment 7

Produce structure and the Product Identification of CK Yeast engineering bacteria

At pESC-HIS plasmid ((Stratagene, Agilent) on, assemble dammarenediol synthetic enzyme (Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promotor simultaneously, ADH1 terminator), Cytochrome P450 CYP716A47 (AEY75213.1) (FBA1 promotor, CYC1 terminator) and glycosyltransferase GT25 (GAL1/GAL10GAL1 side promotor, TDH2 terminator), form episomal plasmids, transformed saccharomyces cerevisiae BY4742, and the cytochrome P450 reductase ATR2-1 (NP_849472.2) that Arabidopis thaliana is originated is integrated in Chromosome t rp1 gene locus (GAL1 promotor in yeast saccharomyces cerevisiae BY4742 karyomit(e), utilize the original terminator of trp1), construct recombination yeast A.Same method, construct recombination yeast B, difference is Arabidopis thaliana to originate on recombinant plasmid that reductase enzyme ATR2-1 is integrated in containing dammarenediol synthetic enzyme, Cytochrome P450 CYP716A47 and glycosyltransferase GT25, ATR2-1 has promotor and terminator TEF2 promotor and TPI1 terminator respectively, and the promotor of other 3 genes is identical with the corresponding gene of recombinant bacterium A with terminator.

Construct recombination microzyme C by the method identical with recombination microzyme B, but again plan promotor and the terminator of each gene, as table 4.

Table 4 Major Enzymes promotor and terminator are formed:

Major Enzymes	Promotor	Terminator
			Dammarenediol synthetic enzyme	GAL1/GAL10GAL10 side	ADH1
CYP716A47	GAL1/GAL10GAL1 side	TDH2
			ATR2-1	TEF2	TPI1
GT25	FBA1	CYC1

Restructuring yeast strains A, B, (0.67% yeast is without the basic nitrogenous source of amino acid at SC-Ura for C, 2% semi-lactosi) ferment in substratum, the amino acid of the extra interpolation of each recombinant bacterium needs or uridylic are in table 5, get the fermented liquid of 50mL recombination yeast, thalline 5mL yeast lysis buffer (50mM Tris-Hcl, 1mM EDTA, 1mM PMSF, 5% glycerine of centrifuged deposit, pH7.5) after resuspended, cracking yeast is shaken with Fastprep, power 6M/S is set, shakes and make the abundant cracking of yeast for 7 ~ 8 times.Transferred to by lysate in 2mL EP pipe, each pipe dress 1mL, the propyl carbinol extracting adding equal-volume (1mL) is about the centrifugal 10min of 12000g after 30min.Draw in the new EP pipe of supernatant to.Propyl carbinol evaporate to dryness is made under 45 DEG C and vacuum condition.Detect for HPLC with after 100 μ L dissolve with methanol.

Analyzed by HPLC, the output containing dammarenediol, protopanoxadiol (PPD) and ginsenoside active metabolite CK (Figure 16), yeast A synthesis CK in the cell pyrolysis liquid of recombination yeast A reaches 0.6mg/L.The cell pyrolysis liquid that HPLC analyzes same discovery recombination yeast B and C contains micro-CK.

The corresponding amino acid that table 5 recombination microzyme need be added or uridylic

Restructuring yeast strains	Add amino acid or uridylic
		A	0.01% tryptophane (tryptophan), leucine (leucine), Methionin (lysine)
B	0.01% uridylic (uracil), leucine (leucine), Methionin (lysine)
		C	0.01% uridylic (uracil), leucine (leucine), Methionin (lysine)

Embodiment 8

Produce structure and the Product Identification of Rh1 Yeast engineering bacteria

At pESC-HIS plasmid ((Stratagene, Agilent) on, assemble dammarenediol synthetic enzyme (Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promotor simultaneously, ADH1 terminator), Cytochrome P450 CYP716A47 (AEY75213.1) (FBA1 promotor, CYC1 terminator), Cytochrome P450 CYP716A53V2 gene (ENO2 promotor, CYC1 terminator) and glycosyltransferase gGT25-5 (GAL1/GAL10GAL1 side promotor, TDH2 terminator), form episomal plasmids, transformed saccharomyces cerevisiae BY4742, and the cytochrome P450 reductase ATR2-1 (NP_849472.2) that Arabidopis thaliana is originated is integrated in Chromosome t rp1 gene locus (GAL1 promotor in yeast saccharomyces cerevisiae BY4742 karyomit(e), utilize the original terminator of trp1), construct recombination yeast A3.The corresponding amino acid that recombination microzyme need be added or uridylic are in table 5.

Transferred to by recombination yeast A3 lysate in 2mL EP pipe, each pipe dress 1mL, the propyl carbinol extracting adding equal-volume (1mL) is about the centrifugal 10min of 12000g after 30min.Draw in the new EP pipe of supernatant to.Propyl carbinol evaporate to dryness is made under 45 DEG C and vacuum condition.Detect for HPLC with after 100 μ L dissolve with methanol.

Analyzed by HPLC, containing Protopanaxatriol (PPT) and ginsenoside active metabolite Rh1 (Figure 41) in the cell pyrolysis liquid of recombination yeast A3.

Embodiment 9

Glycosyltransferase gene 3GT1, the structure of the Recombinant protein expression carrier of 3GT2,3GT3 and 3GT4

With the plasmid 3GT1-pMD18T containing 3GT1 and 3GT2 gene that embodiment 1 builds, 3GT2-pMD18T is template amplification target gene.

3GT1 and 3GT2 forward primer used is SEQ ID NO.:31, and its 5 ' end adds BamH I recognition site: GGATCC; 3GT1 reverse primer used is SEQ ID NO.:32, and its 5 ' end adds Sal I recognition site: CTCGAG; 3GT2 reverse primer used is SEQ ID NO.:33, and its 5 ' end adds Sal I recognition site: CTCGAG.

Utilize above-mentioned primer and template by PCR method amplification 3GT1 and 3GT2 gene.Archaeal dna polymerase selects the high-fidelity DNA polymerase KOD of Toyobo company, with reference to its specification sheets setting PCR program: 94 DEG C of 2min; 94 DEG C of 15s, 58 DEG C of 30s, 68 DEG C of 1.5min, totally 35 circulations; 68 DEG C of 10min; 10 DEG C of insulations.PCR primer detects through agarose gel electrophoresis, under ultraviolet light, cuts the band of the same size with target dna.Then the AxyPrep DNA Gel Extraction Kit of AXYGEN company is adopted to reclaim DNA fragmentation from sepharose.With Takara company QuickCut restriction enzyme Kpn I and the DNA fragmentation 30min that reclaims of Xba I double digestion, with the AxyPrep PCR Cleanup Kit of AXYGEN company, clean recovery is carried out to digestion products.Utilize the T4DNA ligase enzyme of NEB company that digestion products and colibacillus expression plasmid pET28a (same cut with BamH I and Sal I enzyme and tap rubber reclaim) 16 DEG C is connected 4h.Connect product conversion E.coli EPI300 competent cell, and coat on the LB flat board of interpolation 50 μ g/mL kantlex.Verify positive transformant by bacterium colony PCR, and order-checking verifies that expression plasmid 3GT1-pET28a and 3GT2-pET28a successfully constructs further.

With the plasmid 3GT3-pMD18T containing 3GT3 and 3GT4 gene that embodiment 1 builds, 3GT4-pMD18T is template amplification target gene.

3GT3 forward primer used is as shown in SEQ ID NO.:48, and its 5 ' end with the addition of the sequence with carrier pET28a homology: ACTTTAAGAAGGAGATATACC; 3GT3 reverse primer used is for such as shown in SEQ ID NO.:49, and its 5 ' end with the addition of the sequence with carrier pET28a homology: CTCGAGTGCGGCCGCAAGCTT.

3GT4 forward primer used is SEQ ID NO.:50, and its 5 ' end with the addition of the sequence with carrier pET28a homology: ACTTTAAGAAGGAGATATACC; 3GT4 reverse primer used is SEQ ID NO.:51, and its 5 ' end with the addition of 18 base fragment: CTCGAGTGCGGCCGCAAGCTT with carrier pET28a homology.

Utilize above-mentioned primer by the gene of PCR method amplification 3GT3 and 3GT4.Amplification gene selects the Q5 high-fidelity DNA polymerase of NEB company, with reference to its specification sheets setting PCR program: 98 DEG C of 30s; 98 DEG C of 15s, 58 DEG C of 30s, 72 DEG C of 1min, totally 35 circulations; 72 DEG C of 2min; 10 DEG C of insulations.

Meanwhile, use SEQ ID NO.:52 and SEQ ID NO.:53 respectively as forward and reverse primer amplification vector pET28a, obtain linearizing carrier pET28a.Amplification pET28a linearized vector also selects the Q5 high-fidelity DNA polymerase of NEB company, with reference to its specification sheets setting PCR program: 98 DEG C of 30s; 98 DEG C of 15s, 58 DEG C of 30s, 72 DEG C of 3min, totally 35 circulations; 72 DEG C of 2min; 10 DEG C of insulations.

Above-mentioned 3GT3 and 3GT4 gene PCR product and linearizing carrier pET28a, after agarose gel electrophoresis detects, cut the band of the same size with target dna under ultraviolet light.Then the AxyPrep DNA Gel Extraction Kit of AXYGEN company is adopted to reclaim DNA fragmentation from sepharose.With reference to the seamless Cloning Kit specification sheets of BGclonart of Nuo Jing bio tech ltd, by the linearizing pET28a carrier segments reclaimed, 3GT3 or the 3GT4 gene fragment reclaimed and the seamless cloning reaction liquid of BGclonart of Nuo Jing bio tech ltd mix with suitable proportion, totally 20 μ l.Hatch 30 points of kinds at 50 DEG C after mixing, then mixed reaction solution is transferred on ice.Use 5 μ l reaction solution Transformed E .coli EPI300 competent cells, and coat on the LB flat board of interpolation 50 μ g/mL kantlex.Verify positive transformant by bacterium colony PCR, and order-checking verifies that expression plasmid 3GT3-pET28a and 3GT4-pET28a successfully constructs further.

Embodiment 10

Glycosyltransferase gene 3GT1,3GT2,3GT3 and the 3GT4 expression in intestinal bacteria

With the coli expression carrier 3GT1-pET28a that embodiment 9 builds, 3GT2-pET28a, 3GT3-pET28a and 3GT4-pET28a, be transformed in commercially available E.coli BL21.Inoculate a recon in LB substratum, 30 DEG C of 200rpm are cultured to OD ₆₀₀about 0.6-0.8, makes bacterium liquid be cooled to 4 DEG C, adds the IPTG that final concentration is 50 μMs, 18 DEG C of 200rpm abduction delivering 15h.4 DEG C of collected by centrifugation thalline, sonicated cells, 4 DEG C of 12000g centrifugal collecting cell lysate supernatants, sample thief carries out SDS-PAGE electrophoresis (Figure 20).Compared with the recon of pet28a empty carrier, 3GT1-pet28a, 3GT2-pet28a, 3GT3-pet28a and 3GT4-pet28a recon has obvious band (about 55KD) to characterize 3GT1,3GT2,3GT3 and 3GT4.From the result (Figure 21) of Western Blot, also prove target protein 3GT1,3GT2,3GT3 and 3GT4 achieve soluble-expression in host.

Embodiment 11

E. coli expression product 3GT1, the qualification of 3GT2,3GT3 and 3GT4 Transglycosylation and product

Be the Transglycosylation that crude enzyme liquid comes catalysis ginsenoside and sapogenin to express the recombination bacillus coli cracking supernatant of 3GT1,3GT2,3GT3 and 3GT4, express the recombination bacillus coli cracking supernatant of empty carrier for contrast.100 μ L reaction systems are as shown in table 3.Reaction carries out 12h at 35 DEG C, then adds 100 μ L butanols termination reactions, and extract product.After product vacuum drying, use dissolve with methanol.

Reaction product first uses thin-layer chromatography (TLC) to carry out detecting (Figure 22-28,48), with 3GT1,3GT2, the crude enzyme liquid of 3GT3 and 3GT4 can by the C3 position hydroxyl glycosylation of protopanoxadiol (PPD), be separately converted to rare ginsenoside Rh2 (Figure 22,27 (a) and 28 (a)); 3 hydroxyls under the catalysis of 3GT1,3GT2 and 3GT4 crude enzyme liquid, can be continued glycosylation, generate F2 (Figure 22 and 28 (b)) respectively by 20 glycosylated protopanaxadiol-type's saponin(es (CK) of hydroxyl; Glycosyltransferase 3GT1 and 3GT2 respectively by the C3 position hydroxyl glycosylation of dammarenediol DM, can also be converted into new compound 3-O-β-(D-glucopyranosyl)-Dammarenediol II (Figure 23); Glycosyltransferase 3GT1,3GT2,3GT3 and 3GT4 by the C3 position hydroxyl glycosylation of 25-OH-PPD, can be converted into new compound 3-O-β-(D-glucopyranosyl)-25-OH-PPD.(Figure 23, Figure 27 (c) and Figure 28 (c)), 3GT1,3GT2 and 3GT3 can also by the C3 position hydroxyl glycosylation of Protopanaxatriol (PPT), the new saponin(e 3-O-β do not reported before being converted into-(D-glucopyranosyl)-PPT (Figure 24 and 27 (b)), 3GT1 and 3GT2 can also by the C3 position hydroxyl glycosylation of F1, new saponin(e 3-O-β-(the D-glucopyranosyl)-F1 (Figure 24) do not reported before being converted into, 3GT1 and 3GT2 can also by lanosterol (lanosterol), Ganoderic acid C2, Agladupol A, Hispidol B and 24 (R)-Cycloartane-3beta, 24, the C3 position hydroxyl glycosylation of 25-triol is converted into new compound 3-O-β-(D-glucopyranosyl)-lanosterol, 3-O-β-(D-glucopyranosyl)-Ganoderic acid C2, 3-O-β-(D-glucopyranosyl)-Agladupol A, 3-O-β-(D-glucopyranosyl)-Hispidol B and 3-O-β-(D-glucopyranosyl)-24 (R)-Cycloartane-3beta, 24, 25-triol (Figure 26 and Figure 48).Simultaneously, the catalytic activity of 3GT1 and 3GT2 is not subject to the impact of 20 hydroxyls or glycosyl sterie configuration, such as both can catalysis 20 (S)-PPD, also can generate rare ginsenoside 20 (R)-ginsenoside Rh2 (Figure 25) by catalysis 20 (R)-PPD.Although 3GT1,3GT2,3GT3 and 3,GT4 tetra-kinds of glycosyltransferases can add glycosyl in 3 of tetracyclic triterpene sapogenin, they can catalysis substrate spectrum have very large difference.As shown in table 6,3GT1 and 3GT2 can the substrate of catalysis maximum, 3GT3 can the substrate of catalysis minimum, but the specificity of 3GT4 is best, it can only catalysis protopanaxadiol-type saponin(e (PPD, CK and 25-OH-PPD etc.), in addition it only has very faint activity (Figure 48 (C), table 6) to Hispidol B.

Carry out detecting (Figure 29) with the product of HPLC to 3GT1,3GT3 and 3GT4 catalysis PPD further.In Figure 29, glycosyltransferase 3GT1, peak (the P1 that retention time is identical has all been there is in the product of 3GT3 with 3GT4 catalysis PPD, P2 and P3), they are consistent with the retention time of ginsenoside Rh2 in standard specimen, glycosyltransferase 3GT1 is described, 3GT3 and 3GT4 catalysis PPD generates ginsenoside Rh2.Finally, made Mass Spectrometric Identification (Figure 30) with LC/MS to tri-the sample peaks of P1, P2 and P3 in Figure 29, the mass spectrum of they and standard model ginsenoside Rh2 is completely the same, this further illustrates glycosyltransferase 3GT1, the product that 3GT3 and 3GT4 catalysis PPD generates is Rh2.

Glycosyltransferase 3GT1,3GT2,3GT3 and 3GT4 can catalytic substrate more as shown in table 6:

Table 6

Embodiment 12

Produce structure and the Product Identification of Rh2 Yeast engineering bacteria

12.1 at pESC-HIS plasmid ((Stratagene, Agilent) on, assemble dammarenediol synthetic enzyme (Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promotor simultaneously, ADH1 terminator), Cytochrome P450 CYP716A47 (AEY75213.1) (FBA1 promotor, CYC1 terminator) and glycosyltransferase 3GT4 (GAL1/GAL10GAL1 side promotor, TDH2 terminator), form episomal plasmids, transformed saccharomyces cerevisiae BY4742, and the cytochrome P450 reductase ATR2-1 (NP_849472.2) that Arabidopis thaliana is originated is integrated in Chromosome t rp1 gene locus (GAL1 promotor in yeast saccharomyces cerevisiae BY4742 karyomit(e), utilize the original terminator of trp1), construct recombination yeast A1.The corresponding amino acid that recombination microzyme need be added or uridylic are in table 5.

Transferred to by recombination yeast A1 lysate in 2mL EP pipe, each pipe dress 1mL, the propyl carbinol extracting adding equal-volume (1mL) is about the centrifugal 10min of 12000g after 30min.Draw in the new EP pipe of supernatant to.Propyl carbinol evaporate to dryness is made under 45 DEG C and vacuum condition.Detect for HPLC with after 100 μ L dissolve with methanol.

(Figure 39) is analyzed, containing dammarenediol, protopanoxadiol (PPD) and ginsenoside active metabolite Rh2 in the cell pyrolysis liquid of recombination yeast A1 by HPLC.

12.2 methods are with 12.1, and difference is to replace 3GT4 with glycosyltransferase 3GT1, obtains recombination yeast A5.

The results are shown in Figure 43, analyzed by HPLC, containing dammarenediol, protopanoxadiol (PPD) and ginsenoside active metabolite Rh2 in the cell pyrolysis liquid of recombination yeast A5.

Embodiment 13

The structure of the yeast recombinant expression vector of glycosyltransferase gene gGT29 and gGT29-3

Respectively with embodiment 1 build containing plasmid gGT29-pMD18T and gGT29-3-pMD18T of gGT29 and gGT29-3 gene for template amplification target gene.

GGT29 forward primer used is (SEQ ID NO.:36), and its 5 ' end adds Kpn I recognition site: GGATCC; Reverse primer used is (SEQ ID NO.:37), and its 5 ' end adds XhoI recognition site: CTCGAG, and reverse primer introduces 6-His Tag to carry out Western Blot detecting expression and purification.

GGT29-3 forward primer used is (SEQ ID NO.:38), and its 5 ' end adds Kpn I recognition site: GGATCC; Reverse primer used is (SEQ ID NO.:39), and its 5 ' end adds XhoI recognition site: CTCGAG, and reverse primer introduces 6-His Tag to carry out Western Blot detecting expression and purification.

With plasmid gGT29-pMD18T and gGT29-3-pMD18T for template, utilize above-mentioned primer by the gene of PCR method amplification gGT29 and gGT29-3.Archaeal dna polymerase selects the high-fidelity DNA polymerase kod of Toyobo company, with reference to its specification sheets setting PCR program: 94 DEG C of 2min; 94 DEG C of 15s, 58 DEG C of 30s, 68 DEG C of 1.5min, totally 30 circulations; 68 DEG C of 10min; 10 DEG C of insulations.PCR primer detects through agarose gel electrophoresis, under ultraviolet light, cuts the band of the same size with target dna.Then the AxyPrep DNA Gel Extraction Kit of AXYGEN company is adopted to reclaim DNA fragmentation from sepharose.With Takara company QuickCut restriction enzyme Kpn I and the DNA fragmentation 30min that reclaims of Xba I double digestion, with the AxyPrep PCR Cleanup Kit of AXYGEN company, clean recovery is carried out to digestion products.Utilize the T4DNA ligase enzyme of NEB company that digestion products and Yeast Plasmid pYES2 (same cut with Kpn I and Xba I enzyme and tap rubber reclaim) 25 DEG C is connected 2h.Connect product conversion E.coli TOP10 competent cell, and coat on the LB flat board of interpolation 100 μ g/mL penbritin.Verify positive transformant by bacterium colony PCR, and order-checking verifies that expression plasmid gGT29-pYES2 and gGT29-3-pYES2 successfully constructs further.

Embodiment 14

The expression of glycosyltransferase gene gGT29 and gGT29-3 in yeast saccharomyces cerevisiae

By electric method for transformation, expression plasmid gGT29-pYES2 and gGT29-3-pYES2 built is transformed in yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), coat the dull and stereotyped SC-Ura of screening (0.67% yeast without the basic nitrogenous source of amino acid, 2% glucose).Yeast recon is verified by bacterium colony PCR.Choose yeast recon bacterium colony in 10mL SC-Ura (2% glucose) substratum, 30 DEG C of 200rpm cultivate 20h.4 DEG C of 3500g collected by centrifugation thalline, with aseptic deionized water cleaning thalline twice, with inducing culture SC-Ura (2% semi-lactosi) resuspended thalline, and are inoculated in 50mL inducing culture, make OD ₆₀₀about 0.4,30 DEG C of 200rpm start abduction delivering.The thalline of 4 DEG C of 3500g collected by centrifugation abduction delivering 12h, with aseptic deionized water cleaning thalline twice, is resuspended in yeast lysis buffer, makes OD ₆₀₀between 50-100.With Fastprep cell crushing instrument concussion broken yeast cell, 4 DEG C of centrifugal 10min of 12000g remove cell debris, collecting cell lysate supernatant.Get appropriate lysate supernatant and carry out SDS-PAGE electrophoresis detection, compared with the recon of pYES2 empty carrier, gGT29-pYES2 and gGT29-3-pYES2 recon does not have obvious band to characterize (Figure 32).Anti-6-His Tag Western Blot is adopted to detect expression, express the Western Blot signal that the yeast saccharomyces cerevisiae display of gGT29 and gGT29-3 is very strong, show gGT29 and gGT29-3 equal soluble-expression in yeast, the recon turning pYES2 empty carrier does not then have anti-6-His Tag Western Blot signal (Figure 33).

Embodiment 15

Yeast expression product gGT29 and gGT29-3 Transglycosylation and Product Identification

Carry out the Transglycosylation of catalysis ginsenoside Rh2 and F2 with the recombination yeast cracking supernatant of expressing gGT29 and gGT29-3 as enzyme liquid, express the recombination yeast cracking supernatant of empty carrier for contrast.100 μ L reaction systems are as shown in table 3.Reaction carries out 12h at 35 DEG C, then adds 100 μ L butanols termination reactions, and extract product.After product vacuum drying, use dissolve with methanol.

Reaction product first uses thin-layer chromatography (TLC) to detect, in the yeast host cracking of expression gGT29 and gGT29-3, clear enzyme solution can extend a glycosyl again at 3 glycosyls of ginsenoside Rh2 and F2, is converted into ginsenoside Rg3 and Rd (Figure 34).The catalytic activity of gGT29 and gGT29-3 is not subject to the impact of ginsenoside 20 glycosyls or hydroxyl configuration, 20 (R)-Rh2 can be converted into 20 (R)-Rg3 (Figure 36).

Embodiment 16

The associating Transglycosylation of glycosyltransferase 3GT1/3GT4 and gGT29 and Product Identification

Co-catalysis protopanoxadiol (PPD) is carried out with the yeast host cracking supernatant of expressing gGT29 as enzyme liquid with cleer and peaceful in the escherichia coli host cracking expressing 3GT1 or 3GT4.100 μ L reaction systems are as shown in table 3.In the enzyme liquid of 73.4 μ L, 40 μ L are the large intestine host cracking supernatant of 3GT1, and remaining 33.4 μ L is the yeast host cracking supernatant of expressing gGT29.Reaction carries out 12h at 35 DEG C, then adds 100 μ L butanols termination reactions, and extract product.After product vacuum drying, use dissolve with methanol.Reaction product first uses thin-layer chromatography (TLC) to carry out detecting (Figure 35), can see that PPD all can be converted into Rg3 by glycosyltransferase 3GT1 and gGT29 or 3GT4 and gGT29 conbined usage.

Glycosyltransferase 3GT1 and gGT29 or 3GT2 and gGT29 conbined usage can catalysis 20 (R)-PPD, generation 20 (R)-Rg3 (Figure 36).

Embodiment 17

Produce structure and the Product Identification of Rg3 Yeast engineering bacteria

17.1 at pESC-HIS plasmid ((Stratagene, Agilent) on, assemble dammarenediol synthetic enzyme (Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promotor simultaneously, ADH1 terminator), Cytochrome P450 CYP716A47 (AEY75213.1) (FBA1 promotor, CYC1 terminator) and glycosyltransferase 3GT4 and gGT29 (GAL1/GAL10GAL1 side promotor, TDH2 terminator), form episomal plasmids, transformed saccharomyces cerevisiae BY4742, and the cytochrome P450 reductase ATR2-1 (NP_849472.2) that Arabidopis thaliana is originated is integrated in Chromosome t rp1 gene locus (GAL1 promotor in yeast saccharomyces cerevisiae BY4742 karyomit(e), utilize the original terminator of trp1), construct recombination yeast A2.The corresponding amino acid that recombination microzyme need be added or uridylic are in table 5.

Transferred to by recombination yeast A2 lysate in 2mL EP pipe, each pipe dress 1mL, the propyl carbinol extracting adding equal-volume (1mL) is about the centrifugal 10min of 12000g after 30min.Draw in the new EP pipe of supernatant to.Propyl carbinol evaporate to dryness is made under 45 DEG C and vacuum condition.Detect for HPLC with after 100 μ L dissolve with methanol.

Analyzed by HPLC, containing dammarenediol, protopanoxadiol (PPD) and ginsenoside active metabolite Rg3 (Figure 40) in the cell pyrolysis liquid of recombination yeast A2.

17.2 methods are with 17.1, and difference is to replace 3GT4 with glycosyltransferase 3GT1, obtains recombination yeast A6.Analyzed by HPLC, also containing dammarenediol, protopanoxadiol (PPD) and ginsenoside active metabolite Rg3 in the cell pyrolysis liquid of recombination yeast A6.

Embodiment 18

Produce structure and the Product Identification of F1 Yeast engineering bacteria

At pESC-HIS plasmid ((Stratagene, Agilent) on, assemble dammarenediol synthetic enzyme (Dammarenediol synthase) (ACZ71036.1) (GAL1/GAL10GAL10 side promotor simultaneously, ADH1 terminator), glycosyltransferase gGT25 (GAL1/GAL10GAL1 side promotor, TDH2 terminator), Cytochrome P450 CYP716A47 (AEY75213.1) (FBA1 promotor, FBA1 terminator), Cytochrome P450 CYP716A53V2 (ENO2 promotor, CYC1 terminator).Form episomal plasmids, transformed saccharomyces cerevisiae BY4742, and the cytochrome P450 reductase ATR2-1 (NP_849472.2) that Arabidopis thaliana is originated is integrated in Chromosome t rp1 gene locus (GAL1 promotor in yeast saccharomyces cerevisiae BY4742 karyomit(e), utilize the original terminator of trp1), construct recombination yeast A4.The corresponding amino acid that recombination microzyme need be added or uridylic are in table 5.

Transferred to by recombination yeast A4 lysate in 2mL EP pipe, each pipe dress 1mL, the propyl carbinol extracting adding equal-volume (1mL) is about the centrifugal 10min of 12000g after 30min.Draw in the new EP pipe of supernatant to.Propyl carbinol evaporate to dryness is made under 45 DEG C and vacuum condition.Detect for HPLC with after 100 μ L dissolve with methanol.

Analyzed by HPLC, containing Protopanaxatriol (PPT) and ginsenoside active metabolite F1 (Figure 42) in the cell pyrolysis liquid of recombination yeast A4.

Embodiment 19

Glycosyltransferase gene gGT29-4, the structure of the Recombinant protein expression carrier of gGT29-5, gGT29-6 and gGT29-7

With the plasmid gGT29-4-pMD18T containing gGT29-4, gGT29-5, gGT29-6 and gGT29-7 gene that embodiment 1 builds, gGT29-5-pMD18T, gGT29-6-pMD18T and gGT29-7-pMD18T are template amplification target gene.

GGT29-5 and gGT29-6 gene forward primer used is as shown in SEQ ID NO.:66, and its 5 ' end with the addition of the sequence with carrier pET28a homology: CTGGTGCCGCGCGGCAGC; Reverse primer used is for such as shown in SEQ ID NO.:68, and its 5 ' end with the addition of the sequence with carrier pET28a homology: TGCGGCCGCAAGCTTGTC.

GGT29-4 and gGT29-7 gene forward primer used is SEQ ID NO.:67, and its 5 ' end with the addition of the sequence with carrier pET28a homology: CTGGTGCCGCGCGGCAGC; Reverse primer used is SEQ ID NO.:68, and its 5 ' end with the addition of 18 base fragment: TGCGGCCGCAAGCTTGTC with carrier pET28a homology.

Above-mentioned primer is utilized to be increased gGT29-4, gGT29-5, gGT29-6 and gGT29-7 gene by PCR method.Amplification gene selects the Q5 high-fidelity DNA polymerase of NEB company, with reference to its specification sheets setting PCR program: 98 DEG C of 30s; 98 DEG C of 15s, 58 DEG C of 30s, 72 DEG C of 1min, totally 35 circulations; 72 DEG C of 2min; 10 DEG C of insulations.

Meanwhile, use SEQ ID NO.:69 and SEQ ID NO.:70 respectively as forward and reverse primer amplification vector pET28a, obtain linearizing carrier pET28a.Amplification pET28a linearized vector also selects the Q5 high-fidelity DNA polymerase of NEB company, with reference to its specification sheets setting PCR program: 98 DEG C of 30s; 98 DEG C of 15s, 58 DEG C of 30s, 72 DEG C of 3min, totally 35 circulations; 72 DEG C of 2min; 10 DEG C of insulations.

Above-mentioned gGT29-4, gGT29-5, gGT29-6 and gGT29-7 gene PCR product and linearizing carrier pET28a, after agarose gel electrophoresis detects, cut the band of the same size with target dna under ultraviolet light.Then the AxyPrep DNA Gel Extraction Kit of AXYGEN company is adopted to reclaim DNA fragmentation from sepharose.With reference to the seamless Cloning Kit specification sheets of BGclonart of Nuo Jing bio tech ltd, by the linearizing pET28a carrier segments reclaimed, the gGT29-4 reclaimed, gGT29-5, the seamless cloning reaction liquid of BGclonart of gGT29-6 and gGT29-74 gene fragment and Nuo Jing bio tech ltd mixes with suitable proportion, totally 20 μ l.Hatch 30 points of kinds at 50 DEG C after mixing, then mixed reaction solution is transferred on ice.Use 5 μ l reaction solution Transformed E .coli EPI300 competent cells, and coat on the LB flat board of interpolation 50 μ g/mL kantlex.Positive transformant is verified by bacterium colony PCR, and order-checking checking expression plasmid gGT29-4-pET28a further, gGT29-5-pET28a, gGT29-6-pET28a and gGT29-7-pET28a successfully construct.

Embodiment 20

Glycosyltransferase gene gGT29-4, gGT29-5, gGT29-6 and the gGT29-7 expression in intestinal bacteria

With the coli expression carrier gGT29-4-pET28a that embodiment 19 builds, gGT29-5-pET28a, gGT29-6-pET28a and gGT29-7-pET28a are transformed in commercially available E.coli BL21.Inoculate a recon in LB substratum, 30 DEG C of 200rpm are cultured to OD ₆₀₀about 0.6-0.8, makes bacterium liquid be cooled to 4 DEG C, adds the IPTG that final concentration is 50 μMs, 18 DEG C of 200rpm abduction delivering 15h.4 DEG C of collected by centrifugation thalline, sonicated cells, 4 DEG C of 12000g centrifugal collecting cell lysate supernatants, sample thief carries out SDS-PAGE electrophoresis (Figure 44).GGT29-4-pET28a, gGT29-5-pET28a, obvious target protein band (about 50KD) is had in gGT29-6-pET28a and gGT29-7-pET28a recon lysate and total protein and supernatant, characterize glycosyltransferase gGT29-4 respectively, gGT29-5, gGT29-6 and gGT29-7.From the result (Figure 45) of Western Blot, also prove target protein gGT29-4, gGT29-5, gGT29-6 and gGT29-7 achieve soluble-expression in host.

Embodiment 21

E. coli expression product gGT29-4, the qualification of gGT29-5, gGT29-6 and gGT29-7 Transglycosylation and product

Carry out the Transglycosylation of catalysis ginsenoside Rh2 and F2 as enzyme liquid with the recombination yeast cracking supernatant of expressing gGT29-4, gGT29-5, gGT29-6 and gGT29-7.100 μ L reaction systems are as shown in table 3.Reaction carries out 12h at 35 DEG C, then adds 100 μ L butanols termination reactions, and extract product.After product vacuum drying, use dissolve with methanol.

Reaction product thin-layer chromatography (TLC) detects, and the crude enzyme liquid of gGT29-6 can extend a glycosyl again on 3 glycosyls of ginsenoside Rh2 and F2, is generated as ginsenoside Rg3 and Rd (Figure 46) respectively; The crude enzyme liquid of gGT29-4, gGT29-5 and gGT29-7 can extend a glycosyl again at 3 of a GF2 glycosyl and generate saponin(e Rd, but they can not catalysis saponin(e Rh2 (Figure 46).GGT29-4, gGT29-5, the crude enzyme liquid of gGT29-6 and gGT29-7 can also extend a glycosyl again on the C-6 position glycosyl of Protopanaxatriol's type saponin(e Rh1, form ginsenoside Rf (Figure 47), wherein, the expression activitiy of gGT29-4, gGT29-5 and gGT29-6 is weak, and gGT29-7 then has stronger activity (table 7).

Table 7

The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims

1. an external glycosylation process, is characterized in that, comprises step:

Thus form glycosylated tetracyclic triterpenoid;

Wherein, described glycosyltransferase is selected from:

2. an isolated polypeptide, is characterized in that, described polypeptide is selected from lower group:

Homology >=85% (preferably >=95%) of aminoacid sequence shown in arbitrary in (d) aminoacid sequence and SEQ ID NOs.:2,16,18,20,26,28,41,43,55,57,59 or 61, and there is the derivative polypeptide of glycosyl transferase activity.

3. an isolated polypeptide, is characterized in that,

Described polypeptide is selected from lower group:

(a1) there is the polypeptide of arbitrary shown aminoacid sequence in SEQ ID NOs.:22 or 24;

Described polypeptide is selected from lower group:

4. the polynucleotide be separated, is characterized in that, described polynucleotide are be selected from the sequence of lower group:

(A) nucleotide sequence of polypeptide described in coding Claims 2 or 3;

(B) coding is as the nucleotide sequence of arbitrary shown polypeptide in SEQ ID NOs.:2,4,6,16,18,20,22,24,26,28,41,43,55,57,59 or 61;

(C) nucleotide sequence as shown in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60 arbitrary;

(D) with the nucleotide sequence of homology >=95% (preferably >=98%) of arbitrary shown sequence in SEQ ID NOs.:1,3,5,15,17,19,25,27,40,42,54,56,58 or 60;

(E) nucleotide sequence that the 5 ' end and/or 3 ' of arbitrary shown nucleotide sequence holds brachymemma or interpolation 1-60 (preferably 1-30, more preferably 1-10) Nucleotide to be formed in SEQ ID NOs.:1,3,5,15,17,19,21,23,25,27,40,42,54,56,58 or 60;

(F) nucleotide sequence of arbitrary described nucleotide sequence complementary with (A)-(E).

5. a carrier, is characterized in that, described carrier contains polynucleotide according to claim 4.

6. the purposes of isolated polypeptide described in Claims 2 or 3, is characterized in that, it is used to one or more reactions of below catalysis, or is used to the catalyst formulations preparing one or more reactions of below catalysis:

I glycosyl from glycosyl donor is transferred to the hydroxyl of the C-20 position of tetracyclic triterpenoid by ();

(ii) glycosyl from glycosyl donor is transferred to the hydroxyl of the C-6 position of tetracyclic triterpenoid;

(iii) glycosyl from glycosyl donor is transferred to the hydroxyl of the C-3 position of tetracyclic triterpenoid;

(iv) glycosyl from glycosyl donor is transferred on first glycosyl of the C-3 position of tetracyclic triterpenoid, extend sugar chain;

(V) to extend sugar chain on first glycosyl glycosyl from glycosyl donor being transferred to the C-6 position of tetracyclic triterpenoid.

7. purposes as claimed in claim 6, is characterized in that, described isolated polypeptide is used for catalysis one or more reactions following or is used to prepare the catalyst formulations of catalysis one or more reactions following:

Formula (I) Formula (II) compound;

Wherein, R1 is H, monose glycosyl or polysaccharide glycosyl; R2 and R3 is H or OH; R4 is glycosyl; Described polypeptide is selected from SEQ ID NOs:2,16 or 18 or its derivative polypeptide;

Formula (III) Formula (IV) compound;

Wherein, R1 is H or glycosyl, and R2 is glycosyl, and R3 is glycosyl, and described polypeptide is selected from SEQ ID NOs.:2,16,18 or 20;

Or R1 is H or glycosyl; R2 is H or glycosyl; R3 is glycosyl, and described polypeptide is selected from SEQ ID NO.:20 or its derivative polypeptide;

Formula (V) Formula (VI) compound;

Wherein, R1 is H or OH; R2 is H or OH; R3 is H or glycosyl; R4 is glycosyl, and described polypeptide is selected from SEQ ID NOs.:22,24,41 or 43 or its derivative polypeptide;

Formula (VII) Formula (VIII) compound;

Wherein, R1 is OH or OCH ₃; R2 is glycosyl, and described polypeptide is selected from SEQ ID NOs.:22,24,41 or 43 or its derivative polypeptide;

Formula (IX) Formula (X) compound;

Wherein, R1 is glycosyl; R2 and R3 is OH or H; R4 is glycosyl or H; R5 is glycosyl, and R5-R1-O is the derivative glycosyl of C3 first glycosyl, and described polypeptide is selected from SEQ ID NOs.:26,28,55,57,59 or 61 or its derivative polypeptide;

Formula (XI) Formula (XII) compound;

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or its derivative polypeptide;

Formula (XIII) Formula (XIV) compound;

Wherein, R1 and R2 is H or glycosyl, R3 and R4 is glycosyl.Described polypeptide is selected from SEQ ID NOs.:55, and 57,59 or 61 or its derivative polypeptide;

Formula (XV) Formula (XVI) compound;

Formula (XVII) Formula (XVIII) compound;

Formula (XIX) Formula (XX) compound;

Described polypeptide is selected from SEQ ID NOs.:22 or 24 or 41 or 43 or its derivative polypeptide;

Formula (XXI) Formula (XXII) compound;

8. carry out a method for glycosyl catalyzed reaction, it is characterized in that, comprise step: under the polypeptide described in Claims 2 or 3 or its derivative polypeptide existent condition, carry out glycosyl catalyzed reaction.

9. method as claimed in claim 8, it is characterized in that, the substrate of described glycosyl catalyzed reaction is formula (I), (III), (V), (VII), (IX), (XI), (XIII), (XV), (XVII), (XIX) or (XXI) compound, and described product is (II), (IV), (VI), (VIII), (X), (XII), (XIV), (XVI), (XVIII), (XX) or (XXII) compound; Preferably, described formula (I) compound is protopanoxadiol PPD (Protopanaxadiol), and formula (II) compound is Ginsenoside compound K (20-O-β-(D-glucopyranosyl)-protopanoxadiol) (20-O-β-(D-glucopyranosyl)-protopanaxadiol));

Or, described formula (XI) compound is lanosterol (lanosterol), and formula (XII) compound is 3-O-β-(D-glucopyranosyl)-lanosterol (3-O-β-(D-glucopyranosyl)-lanosterol);

Or described formula (XV) compound is ganoderic acid C 2 (Ganoderic acid C2), and formula (XVI) compound is 3-O-β-(D-glucopyranosyl)-ganoderic acid C 2;

Or described formula (XVII) compound is Agladupol A, and formula (XVIII) compound is 3-O-β-(D-glucopyranosyl)-Agladupol A;

Or described formula (XIX) compound is Hispidol B, and formula (XX) compound is 3-O-β-(D-glucopyranosyl)-Hispidol B;

Or described formula (XXI) compound is 24 (R)-cycloartane-3 β, 24,25-triol, and formula (XXII) compound is 3-O-β-(D-glucopyranosyl)-24 (R)-cycloartane-3 β, 24,25-triol.

10. a genetically engineered host cell, is characterized in that, described host cell contains carrier according to claim 5, or is integrated with polynucleotide according to claim 4 in its genome.

The purposes of 11. host cells according to claim 10, is characterized in that, for the preparation of enzyme catalysis reagent, or produces glycosyltransferase or as activated cell or produce glycosylated tetracyclic triterpenoid.

12. 1 kinds of methods producing transgenic plant, it is characterized in that, comprise step: genetically engineered host cell according to claim 11 is regenerated as plant, and described genetically engineered host cell are vegetable cell.