WO2018210208A1

WO2018210208A1 - Glycosyltransferase, mutant, and application thereof

Info

Publication number: WO2018210208A1
Application number: PCT/CN2018/086738
Authority: WO
Inventors: 周志华; 严兴; 王平平; 魏维; 李晓东
Original assignee: 中国科学院上海生命科学研究院
Priority date: 2017-05-16
Filing date: 2018-05-14
Publication date: 2018-11-22
Also published as: CN108866020A; JP2020520244A; KR102418138B1; CN110462033A; JP7086107B2; KR20200016268A

Abstract

Provided are a glycosyltransferase, a mutant, and an in vitro glycosylation method. The method comprises the steps of: transferring a glycosyl group of a glycosyl donor to a hydroxyl group at the C-3 position of a tetracyclic triterpenoid compound in the presence of a glycosyltransferase to form a glycosylated tetracyclic triterpenoid compound, wherein the glycosyltransferase is a glycosyltransferase as shown in SEQ ID NO.:4 or a polypeptide derived therefrom, or a glycosyltransferase as shown in SEQ ID NO.:21 or a polypeptide derived therefrom.

Description

Glycosyltransferase, mutant and application thereof

Technical field

The present invention relates to the field of biotechnology and plant biology, and in particular, to a glycosyltransferase, a glycosyltransferase mutant for use in the synthesis of ginsenoside Rh2, and uses thereof.

Background technique

Ginsenoside is the main active substance in the genus Panax ginseng (such as ginseng, notoginseng, American ginseng, etc.). In recent years, some ginsenosides have also been found in the cucurbitaceae plant Panax notoginseng. At present, scientists at home and abroad have isolated at least 100 kinds of saponins from ginseng, Sanqi and other plants. Ginsenoside belongs to triterpenoid saponins. Some of the ginsenosides have been proven to have a wide range of physiological functions and medicinal properties: including anti-tumor, immune regulation, anti-fatigue, heart protection, liver protection and other functions. Many of the saponins have been used in clinical practice. For example, the drug Shenyi Capsule with ginsenoside Rg3 monomer as the main component can improve the symptoms of qi deficiency in patients with cancer and improve the immune function of the body. Jinshen Capsule with ginsenoside Rh2 monomer as the main component is a health care medicine for improving immunity and enhancing disease resistance.

Structurally, ginsenoside is a biologically active small molecule formed by saccharification of sapogenin. There are only a limited number of saponins of ginsenosides, mainly dammarane-type protopanaxadiol and protopanaxatriol, and oleanane-type aroma resins. In addition to the difference in sapogenin, the structural difference between ginsenosides is mainly reflected in the different glycosylation modification of saponins. The sugar chain of ginsenoside is generally bound to the hydroxyl group of C3, C6, or C20 of the sapogenin, which may be glucose, rhamnose, xylose, and arabinose.

Different glycosylation sites, sugar chain composition and length make ginsenosides greatly different in physiological function and medicinal value. For example, ginsenosides Rb1, Rd and Rc are saponins in which protopanaxadiol is a sapogenin. The difference between them is only the difference in glycosylation modification, but there are many differences in the physiological functions between them. Rb1 has the function of a stable central neuron system, while Rc functions to suppress the function of the central neuron system. Rb1 has a wide range of physiological functions, while Rd has only a very limited number of functions.

Rare ginsenoside refers to a saponin with very low content in ginseng. The ginsenoside Rh2(3-O-β-(D-glucopyranosyl)-20(S)-protopanaxadiol) belongs to the ginseng glycol saponin, and a glucosyl group is attached to the C-3 hydroxyl group of the sapogenin. The content of ginsenoside Rh2 is only about one ten thousandth of the dry weight of ginseng. However, ginsenoside Rh2 has good antitumor activity and is one of the most important antitumor active ingredients in ginseng. It can inhibit tumor cell growth and induce tumors. Apoptosis, anti-tumor metastasis. Studies have shown that ginsenoside Rh2 can inhibit the increase of lung cancer cells 3LL (mice), Morris liver cancer cells (rats), B-16 melanoma cells (mice), and HeLa cells (human). Clinically, ginsenoside Rh2 combined with radiotherapy or chemotherapy can enhance the effects of radiotherapy and chemotherapy. In addition, ginsenoside Rh2 also has anti-allergic effects, enhances the body's immunity, and inhibits the inflammation caused by NO and PGE.

The function of a glycosyltransferase is to transfer a glycosyl group on a glycosyl donor (nucleoside diphosphate sugar, such as UDP-glucose) to a different glycosyl acceptor. There are currently 94 families of glycosyltransferases depending on the amino acid sequence. More than one hundred different glycosyltransferases have been discovered in the plant genomes that have been sequenced. The glycosyl acceptors of these glycosyltransferases include sugars, lipids, proteins, nucleic acids, antibiotics, and other small molecules. A glycosyltransferase involved in saponin glycosylation in ginseng, which functions to transfer a glycosyl group on a glycosyl donor to a C3, C6 or C20 hydroxyl group of a saponin or aglycone, thereby forming different medicinal values. Saponin.

At present, there is a lack of an effective method for producing rare ginsenoside Rh2 and ginsenoside F2 in the field, and thus it is urgent to develop a variety of specific and efficient glycosyltransferases.

Summary of the invention

The object of the present invention is to provide a kind of glycosyltransferase and its application for synthesizing rare ginsenoside Rh2 and ginsenoside F2.

In a first aspect of the invention, an isolated polypeptide is provided,

(1) The amino acid sequence of the isolated polypeptide is non-Gln at amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19 and/or corresponding to the amino acid sequence corresponding to SEQ ID NO: 19. The amino acid residue at position 322 is non-Ala;

(2) The amino acid sequence of the isolated polypeptide is non-Asn(N) at amino acid residue corresponding to position 247 of the amino acid sequence shown in SEQ ID NO: 19 and/or corresponding to SEQ ID NO: 19 The amino acid residue at position 280 of the amino acid sequence is non-Lys (K).

In another preferred embodiment, the isolated polypeptide:

i) having an amino acid sequence as shown in SEQ ID NO: 19 and the amino acid residue at position 222 is non-Gln and/or the 322th position is non-Ala, or

Ii). The sequence defined by i) is passed through one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 An isolated polypeptide derived from i) of a sequence formed by substitution, deletion or addition of an amino acid residue, and having substantially the isolated polypeptide function as defined in i).

In another preferred embodiment, the isolated polypeptide:

i) having an amino acid sequence as shown in SEQ ID NO: 19 and the amino acid residue at position 247 is non-Asn (N) and/or the 280th amino acid residue is non-Lys (K), or

In another preferred embodiment, the isolated polypeptide has the sequence defined by i) passing through one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably. An isolated polypeptide derived from i) having a sequence of from 1 to 3, most preferably 1 amino acid residue added, and having substantially the isolated polypeptide function as defined in i).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide at amino acid residue corresponding to position 222 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: His, Asn, Gln, Lys and Arg.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide is His at the amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide at amino acid residue corresponding to position 322 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: Val, Ile, Leu, Met and Phe.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide is Val at amino acid residue corresponding to position 322 of the amino acid sequence set forth in SEQ ID NO: 19.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide is His at the amino acid residue corresponding to position 222 of the amino acid sequence shown in SEQ ID NO: 19, and corresponds to the amino acid sequence shown in SEQ ID NO: 19. The amino acid residue at position 322 is Val.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide at amino acid residue corresponding to position 247 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: Ser(S), Pro (P), Ala (A) or Thr (T).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide is Ser(S) at the amino acid residue corresponding to position 247 of the amino acid sequence shown by SEQ ID NO: 19.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide at amino acid residue corresponding to position 280 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: Ile(I), Asn (N), Ser(S) or Alan (A).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide is Ile(I) at the amino acid residue corresponding to position 280 of the amino acid sequence set forth in SEQ ID NO: 19.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide is Ser(S) at amino acid residue corresponding to position 247 of the amino acid sequence set forth in SEQ ID NO: 19, corresponding to SEQ ID NO: 19 The amino acid residue at position 280 of the amino acid sequence is Ile(I).

In another preferred embodiment, the isolated polypeptide:

Iii) the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at position 222 is non-Gln and/or the amino acid residue at position 322 is non-Ala, or

Iv). The sequence defined by iii) is passed through one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably 1-3, most preferably 1 An isolated polypeptide derived from iii) having a sequence formed by substitution, deletion or addition of an amino acid residue and having substantially the isolated polypeptide function as defined in iii).

In another preferred embodiment, the isolated polypeptide:

Iii) the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at position 247 is non-Asn (N) and/or the amino acid residue at position 280 is non-Lys (K), or

In another preferred embodiment, the isolated polypeptide has a sequence defined by iii) via one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10, more preferably. An isolated polypeptide derived from iii) having a sequence of from 1 to 3, most preferably 1 amino acid residue added, and having substantially the isolated polypeptide function as defined in iii).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide having the amino acid sequence at position 222 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: His, Asn, Gln, Lys, and Arg.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide has the amino acid residue at position 222 of the amino acid sequence set forth in SEQ ID NO: 19 as His.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide having the amino acid sequence at position 322 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: Val, Ile, Leu, Met, and Phe.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide having the amino acid sequence at position 322 of the amino acid sequence set forth in SEQ ID NO: 19 is Val.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide is His at the 222th amino acid sequence of the amino acid sequence shown in SEQ ID NO: 19, and at position 322 of the amino acid sequence shown in SEQ ID NO: 19. The amino acid residue is Val.

In another preferred embodiment, the amino acid sequence of the isolated polypeptide having the amino acid sequence at position 247 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: Ser(S), Pro(P) ), Ala (A) or Thr (T).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide having the amino acid sequence at position 247 of the amino acid sequence set forth in SEQ ID NO: 19 is Ser(S).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide having the amino acid sequence at position 280 of the amino acid sequence set forth in SEQ ID NO: 19 is selected from at least one of the following amino acids: Ile(I), Asn(N) ), Ser(S) or Ala(A).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide having the amino acid sequence at position 280 of the amino acid sequence set forth in SEQ ID NO: 19 is Ile(I).

In another preferred embodiment, the amino acid sequence of the isolated polypeptide has the amino acid residue at position 247 of the amino acid sequence shown in SEQ ID NO: 19 as Ser(S), and the amino acid sequence shown in SEQ ID NO: 19 The amino acid residue at position 280 is Ile(I).

In another preferred embodiment, the isolated polypeptide is a glycosyltransferase.

In another preferred embodiment, the glycosyltransferase is derived from a plant of the genus Panax.

In another preferred embodiment, the glycosyltransferase is derived from ginseng, American ginseng, and/or notoginseng.

In another preferred embodiment, the polypeptide is selected from the group consisting of:

(a) having the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 Polypeptide

(b) the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 A substitution, deletion or addition of a polypeptide over one or several amino acid residues, preferably from 1 to 20, more preferably from 1 to 15, more preferably from 1 to 10, more preferably from 1 to 3, most preferably 1 amino acid residue. a derivative polypeptide formed or added with a signal peptide sequence and having glycosyltransferase activity;

(c) a derivative polypeptide comprising a polypeptide sequence as described in (a) or (b);

(d) amino acid sequence and amino acid represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 Sequence homology ≥ 85% (preferably ≥ 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) with glycosyltransferase Active derivative polypeptide.

In another preferred embodiment, the sequence (c) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a) or (b).

In another preferred embodiment, the glycosyltransferase activity refers to an activity capable of transferring a glycosyl group of a glycosyl donor to a hydroxyl group at the C-3 position of a tetracyclic triterpenoid.

In another preferred embodiment, the glycosyltransferase increases the yield of ginsenoside Rh2 and/or ginsenoside F2.

In another preferred embodiment, in the artificially constructed strain, the glycosyltransferase can increase the yield of ginsenoside Rh2; preferably, it is increased by 5-150%; more preferably, by 10-100%; more preferably , increase by 20-80%; most preferably, increase by 28-70%.

In another preferred embodiment, the artificially constructed strain is selected from the group consisting of a Saccharomyces cerevisiae strain, an Escherichia coli strain, a Pichia strain, a fission yeast strain, and a Kluyveromyces strain.

In a second aspect of the invention, an isolated polynucleotide is provided, the polynucleotide being a sequence selected from the group consisting of:

(A) a nucleotide sequence encoding the polypeptide of the first aspect of the invention;

(B) a nucleotide sequence encoding the polypeptide of SEQ ID NO.: 4 or SEQ ID NO.: 21 or a polypeptide derived therefrom;

(C) a nucleotide sequence as set forth in SEQ ID NO.: 3 SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 ;

(D) Homology to the sequence set forth in SEQ ID NO.: 3 SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: a nucleotide sequence of ≥90% (preferably ≥91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%);

(E) a nucleotide sequence of SEQ ID NO.: 3 SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 a nucleotide sequence formed by truncating the 5' end and/or the 3' end or adding 1-60 (preferably 1-30, more preferably 1-10) nucleotides;

(F) a nucleotide sequence complementary to the nucleotide sequence of any of (A) to (E).

In a third aspect of the invention, a vector comprising the polynucleotide of the second aspect of the invention is provided.

In another preferred embodiment, the vector comprises an expression vector, a shuttle vector, an integration vector.

In a fourth aspect of the invention, there is provided the use of the isolated polypeptide of the first aspect of the invention, which is used to catalyze the following reaction, or to prepare a catalytic preparation which catalyzes the following reaction:

(i) Transferring a glycosyl group derived from a glycosyl donor to the hydroxyl group at the C-3 position of the tetracyclic triterpenoid.

In another preferred embodiment, the glycosyl donor comprises a nucleoside diphosphate selected from the group consisting of UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetyl Glucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose , UDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose , TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rat Liose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose, or other nucleoside diphosphate hexose or nucleoside pentose pentose, or a combination thereof.

In another preferred embodiment, the glycosyl donor comprises a uridine diphosphate (UDP) sugar selected from the group consisting of UDP-glucose, UDP-xylose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-rhamnose, or other uridine diphosphate hexose or uridine pentose diphosphate, or a combination thereof.

In another preferred embodiment, the isolated polypeptide is used to catalyze the following reactions or to prepare a catalytic preparation that catalyzes the following reactions:

Wherein R1 is H or OH; R2 is H or OH; R3 is H or a glycosyl group; and R4 is a glycosyl group.

The polypeptide is selected from the group consisting of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: A polypeptide or a polypeptide derived therefrom.

In another preferred embodiment, the glycosyl group is selected from the group consisting of: glucosyl, galacturonic acid, xylose, galactosyl, arabinose, rhamnosyl, and other hexose or pentose base.

In another preferred embodiment, the reaction product of the reaction (A) and or (B) includes, but is not limited to, a dammarane type tetracyclic triterpenoid compound of the S configuration or the R configuration, lanolin Type tetracyclic triterpenoids, apotirucallane type tetracyclic triterpenes, ganthanane type tetracyclic triterpenoids, cycloalkane (cycloalthene) type tetracyclic triterpenoids, cucurbitane tetracyclic triterpenes a compound or a decane type tetracyclic triterpenoid.

According to a fifth aspect of the invention, there is provided an in vitro glycosylation method comprising the steps of:

Transferring the glycosyl group of the glycosyl donor to the hydroxyl group C-3 of the tetracyclic triterpenoid in the presence of a glycosyltransferase; thereby forming a glycosylated tetracyclic triterpenoid;

Wherein the glycosyltransferase is the polypeptide of the first aspect of the invention or a polypeptide derived therefrom.

In another preferred embodiment, the derivative polypeptide is selected from the group consisting of:

Passing a polypeptide of the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 Or a derivative polypeptide formed by substitution, deletion or addition of several amino acid residues or formed by adding a signal peptide sequence and having glycosyltransferase activity; or

Homology of the amino acid sequence to the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 ≥85% (preferably ≥90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), and a derivative polypeptide having glycosyltransferase activity;

Here, the glycosyltransferase activity refers to an activity capable of transferring a glycosyl group of a glycosyl donor to a hydroxyl group at the C-3 position of a tetracyclic triterpenoid.

According to a sixth aspect of the invention, there is provided a method of performing a glycosyl-catalyzed reaction comprising the steps of performing a glycosyl-catalyzed reaction in the presence of the polypeptide of the first aspect of the invention or a polypeptide derived therefrom.

In another preferred embodiment, the method further includes the steps of:

The compound of formula (I) is converted to the compound of formula (II) in the presence of a glycosyl donor and a polypeptide of the first aspect of the invention or a polypeptide derived therefrom.

In another preferred embodiment, the compound of formula (I) is protoglycoside diol PPD, and the compound of formula (II) is ginsenoside Rh2;

The compound of formula (I) is Compound K and the compound of formula (II) is ginsenoside F2.

In another preferred embodiment, the method further comprises separately adding the polypeptide and the polypeptide derived therefrom to a catalytic reaction; and/or

The polypeptide and its derived polypeptide are simultaneously added to the catalytic reaction.

In another preferred embodiment, the method further comprises transferring a nucleotide sequence encoding a glycosyltransferase to a key gene and/or other glycosyl transfer in a anabolic pathway of dammar diol and/or protopanaxadiol. The enzyme gene is co-expressed in the host cell to obtain the compound of formula (II).

In another preferred embodiment, the compound of formula (II) is ginsenoside Rh2 or ginsenoside F2.

In another preferred embodiment, the host cell is a yeast or Escherichia coli.

In another preferred embodiment, the method further comprises: providing an additive for regulating enzyme activity to the reaction system.

In another preferred embodiment, the additive for regulating enzyme activity is an additive that increases enzyme activity or inhibits enzyme activity.

In another preferred embodiment, the additive for regulating enzyme activity is selected from the group consisting of Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ^{2+ .} , or Fe ²⁺ .

In another preferred embodiment, the additive for regulating enzyme activity is: Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ , Or a substance of Fe ²⁺ .

In another preferred embodiment, the glycosyl donor is a nucleoside diphosphate sugar selected from the group consisting of UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetyl Glucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose , UDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose , TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rat Liose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose, or other nucleoside diphosphate hexose or nucleoside pentose pentose, or a combination thereof.

In another preferred embodiment, the glycosyl donor is uridine diphosphate, selected from the group consisting of UDP-glucose, UDP-xylose, UDP-galacturonic acid, UDP-galactose, UDP-Arabic Sugar, UDP-rhamnose, or other uridine diphosphate hexose or uridine pentose diphosphate, or a combination thereof.

In another preferred embodiment, the pH of the reaction system is: pH 4.0 to 10.0, preferably pH 5.5 to 9.0.

In another preferred embodiment, the temperature of the reaction system is from 10 ° C to 105 ° C, preferably from 20 ° C to 50 ° C.

In another preferred embodiment, the key genes in the darumadiol anabolic pathway include, but are not limited to, the damasenediol synthase gene.

In another preferred embodiment, the key genes in the proto-ginsengdiol anabolic pathway include, but are not limited to, a dammarenediol synthase gene, a cytochrome P450 gene CYP716A47 synthesized from protopanaxadiol, and Reductase gene, or a combination thereof.

In another preferred embodiment, the substrate of the glycosyl catalyzed reaction is a compound of formula (I), and the product is a compound of formula (II).

According to a seventh aspect of the invention, a genetically engineered host cell comprising the vector of the third aspect of the invention, or a genome thereof, which is integrated with the second aspect of the invention Polynucleotide.

In another preferred embodiment, the glycosyltransferase is the polypeptide of the first aspect of the invention or a polypeptide derived therefrom.

In another preferred embodiment, the nucleotide sequence encoding the glycosyltransferase is as described in the second aspect of the invention.

In another preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell.

In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell or a plant cell.

In another preferred embodiment, the host cell is a Saccharomyces cerevisiae cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as E. coli.

In another preferred embodiment, the host cell is a ginseng cell.

In another preferred embodiment, the host cell is not a cell that naturally produces a compound of formula (II).

In another preferred embodiment, the host cell is not a cell that naturally produces ginsenoside Rh2 or ginsenoside F2.

In another preferred embodiment, the host cell contains a key gene in the proto-glycol diol anabolic pathway including, but not limited to, a dammarene diol synthase gene, a cytochrome P450 gene synthesized from protothecodiol CYP716A47 and its reductase gene, or a combination thereof.

In an eighth aspect of the invention, there is provided the use of the host cell of the seventh aspect of the invention for the preparation of an enzyme catalytic reagent, or for the production of a glycosyltransferase, or as a catalytic cell, or for the production of a glycosylated tetracyclic ring Triterpenoids.

In another preferred embodiment, the tetracyclic triterpenoid is a compound of formula (II).

In another preferred embodiment, the host cell is used to produce a compound of formula (II) by glycosylation of a compound of formula (I).

In another preferred embodiment, the host cell is used to produce ginsenoside Rh2 and/or ginsenoside F2 by glycosylation of protopanaxadiol PPD and/or Compound K.

In a ninth aspect of the invention, a method of producing a transgenic plant, comprising the steps of: regenerating a genetically engineered host cell of the seventh aspect of the invention into a plant, and said genetically engineered host cell For plant cells.

In another preferred embodiment, the genetically engineered host cell is selected from the group consisting of: ginseng cells, American ginseng cells, notoginseng cells, and tobacco cells.

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the various technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

DRAWINGS

Figure 1. Electrophoresis map of glycosyltransferase gene Pn50 agarose gel.

Fig. 2 is a diagram showing the TLC analysis of ginsenosides by the glycosyltransferase gene Pn50.

Figure 3 is a HPLC analysis of the production of recombinant ginseng saponin Rh2 by recombinant S. cerevisiae strain using Pn50.

Figure 4 is a comparative analysis of the fermentation yield of the recombinant Saccharomyces cerevisiae strain R2 produced by the Pn50 protein mutants Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2 and UGT-MUT3.

detailed description

The present inventors have conducted extensive and intensive research to provide, for the first time, a mutant of the heptasaccharide transferase Pn50 (SEQ ID NO.: 4) and a ginseng-derived glycosyltransferase UGTPg45 (SEQ ID NO.: 21), three. Mutants of hexosyltransferase Pn50, Pn50-Q222H-VE (SEQ ID NO.: 41), UGT-MUT1 (SEQ_ID_NO. 35), UGT-MUT2 (SEQ_ID_NO.37), and UGT-MUT3 (SEQ_ID_NO.39) are The application of glycosylation catalysis of steroids and the synthesis of new saponins.

Specifically, the glycosyltransferase of the present invention is capable of specifically and efficiently catalyzing the tetracyclic triterpenoid substrate and/or transferring a glycosyl group derived from a glycosyl donor to the C-3 position of a tetracyclic triterpenoid On the hydroxyl group. In particular, the protopanaxadiol PPD can be efficiently converted into the rare ginsenoside Rh2 having antitumor activity, and the ginsenoside Compound K (having a glycosyl modification at the C20 position of the PPD) can be converted into the product ginsenoside F2. Unexpectedly, the recombinant Saccharomyces cerevisiae strain ZWBY04RS-Pn50 constructed by introducing the Panax notoginseng-derived glycosyltransferase gene Pn50 into the Saccharomyces cerevisiae strain producing protosan diol can synthesize rare ginsenoside Rh2 and is introduced into the wild-type ginseng source. Compared with the strain ZWBY04RS-UGTPg45 of the glycosyltransferase gene UGTPg45, the yield of the strain ZWBY04RS-Pn50 ginsenoside Rh2 was increased by 28% (45.55/35.66-1=28%); the mutant gene 8E7 obtained by genetic modification of UGTPg45 by random mutation The artificially synthesized ginsenoside Rh2 strain ZWBY04RS-8E7 was constructed, and its Rh2 yield was increased by 70% (60.48/35.66-1=70%) compared with the strain ZWBY04RS-UGTPg45 constructed using UGTPg45. The mutant gene Pn50-Q222H-VE obtained by the site-directed mutagenesis of Pn50 was constructed using Pn50-Q222H-VE to synthesize the rare ginsenoside Rh2 strain ZWBY04RS-QE, and the Rh2 yield was compared with the strain ZWBY04RS constructed using UGTPg45. -UGTPg45 production increased by 66% (59.09/35.66-1=66%). Pn50-Q222H-VE was further engineered by site-directed mutagenesis to obtain the mutant UGT-MUT1 gene, and the artificially synthesized ginsenoside Rh2 strain ZWBY04RS-MUT1 constructed by UGT-MUT1 was used. The Rh2 yield was compared with the strain constructed using UGTPg45. ZWBY04RS-UGTPg45 increased production by 90% (67.96/35.66-1=90%). Pn50-Q222H-VE was further engineered by site-directed mutagenesis to obtain the mutant UGT-MUT2 gene, and the artificially synthesized ginsenoside Rh2 strain ZWBY04RS-MUT2 constructed by UGT-MUT2 was used. The Rh2 yield was compared with the strain constructed using UGTPg45. ZWBY04RS-UGTPg45 production increased by 120% (78.29/35.66-1=120%). Pn50-Q222H-VE was further engineered by site-directed mutagenesis to obtain the mutant UGT-MUT3 gene, and the artificially synthesized ginsenoside Rh2 strain ZWBY04RS-MUT3 constructed by UGT-MUT3 was used. The Rh2 yield was compared with the strain constructed using UGTPg45. ZWBY04RS-UGTPg45 production increased by 134% (83.53/35.66-1=134%).

The invention also provides methods of transformation and catalysis. The glycosyltransferase of the present invention may also be a key enzyme in the anabolic pathway of dammarane diol and/or protopanaxadiol (for example, the dammarene diol synthase gene PgDDS, the cytochrome P450 gene synthesized by protopanaxadiol). CYP716A47 and its reductase gene PgCPR1) are co-expressed in host cells or used in the preparation of genetically engineered cells of ginsenoside Rh2, and are used to construct strains for artificial synthesis of rare ginsenoside Rh2.

In addition, the glycosyltransferase of the present invention can also be co-expressed in a host cell with a key enzyme in the metabolic pathway of dammarane diol and/or protopanaxadiol, and is used for constructing a strain for artificially synthesizing rare ginsenoside Rh2. The present invention has been completed on this basis.

definition

As used herein, the terms "active polypeptide", "polypeptide of the invention and derivatives thereof", "enzyme of the invention", "glycosyltransferase" or "glycosyltransferase of the invention" are used interchangeably and There is a meaning that is generally understood by one of ordinary skill in the art. The glycosyltransferase of the present invention has an activity of transferring a glycosyl group of a glycosyl donor to a hydroxyl group at the C-3 position of a tetracyclic triterpenoid.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is non-Gln at amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19 and/or corresponds to SEQ ID NO. The amino acid residue at position 322 of the amino acid sequence shown in 19 is non-Ala.

In a preferred embodiment of the invention, the glycosyltransferase of the invention:

In a preferred embodiment of the invention, the glycosyltransferase of the invention has the sequence defined by i) via one or several amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10 More preferably, the sequence formed by the addition of 1-3, most preferably 1 amino acid residue, and the isolated polypeptide derived from i) having substantially the isolated polypeptide function defined by i).

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is at least one of the following amino acids at amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19: His, Asn , Gln, Lys, and Arg.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is His at the amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is at least one of the following amino acids at amino acid residue corresponding to the amino acid sequence of SEQ ID NO: 19: Val, Ile , Leu, Met and Phe.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is Val at the amino acid residue corresponding to position 322 of the amino acid sequence shown by SEQ ID NO: 19.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is His at the amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19, and corresponds to SEQ ID NO: 19 The amino acid residue at position 322 of the amino acid sequence is Val.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is non-Asn(N) at the amino acid residue corresponding to position 247 of the amino acid sequence shown by SEQ ID NO: 19 and/or corresponds to The amino acid residue at position 280 of the amino acid sequence shown as SEQ ID NO: 19 is non-Lys (K).

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is at least one of the following amino acids at amino acid residue corresponding to the amino acid sequence of SEQ ID NO: 19: Ser (S ), Pro (P), Ala (A) or Thr (T).

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is Ser(S) at the amino acid residue corresponding to position 247 of the amino acid sequence shown by SEQ ID NO: 19.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is at least one of the following amino acids at amino acid residue corresponding to the amino acid sequence of SEQ ID NO: 19: Ile(I) ), Asn (N), Ser (S) or Ala (A).

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is Ile(I) at the amino acid residue corresponding to position 280 of the amino acid sequence shown by SEQ ID NO: 19.

In a preferred embodiment of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is Ser(S) at amino acid residue corresponding to position 247 of the amino acid sequence shown by SEQ ID NO: 19, corresponding to SEQ ID NO The amino acid residue at position 280 of the amino acid sequence shown in 19 is Ile(I).

In a preferred embodiment of the invention, the glycosyltransferase of the invention is selected from the group consisting of:

In a specific embodiment, the glycosyltransferase activity of the present invention refers to an activity capable of transferring a glycosyl group of a glycosyl donor to a hydroxyl group at the C-3 position of a tetracyclic triterpenoid.

In a preferred embodiment of the present invention, a novel glycosyltransferase gene Pn50 cloned from Panax notoginseng utilizes this novel glycosyltransferase to catalyze the glycosylation of various dammarane-type ginsenosides C3.

The full-length glycosyltransferase gene sequence was spliced and analyzed by Pn50 by analyzing the Sanqi transcriptome data. This was cloned into the cloning vector PMDT-18T, and then the expression primer was designed to be constructed on the E. coli expression vector pET28a to induce expression in E. coli. The obtained protein is capable of catalyzing the hydroxyglycosylation of the original human diol and Compound K at the C3 position.

Replacing the ginseng-derived UGTPg45 with the hepta-glycosyltransferase gene Pn50 significantly increased Rh2 production (28% increase).

In another preferred embodiment of the invention, a glycosyltransferase mutant protein 8E7 is provided. The glycosyltransferase mutant protein is a mutant protein of the ginseng-derived wild-type gene UGTPg45, and the replacement of the ginseng-derived wild-type gene UGTPg45 by the mutant glycosyltransferase gene 8E7 can significantly increase Rh2 production (70% increase).

In another preferred embodiment of the invention, a glycosyltransferase mutant protein Pn50-Q222H-VE is provided. The glycosyltransferase mutant protein is a mutant protein of the wild type gene Pn50 derived from Panax notoginseng, and the replacement of the ginseng-derived wild-type gene UGTPg45 by the mutant glycosyltransferase gene Pn50-Q222H-VE can greatly increase the yield of Rh2 ( Increase by 66%).

In another preferred embodiment of the invention, a glycosyltransferase mutant protein UGT-MUT1 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild type gene Pn50 derived from Panax notoginseng. The mutant glycosyltransferase gene UGT-MUT1 replaces the ginseng-derived wild-type gene UGTPg45, which can greatly increase the yield of Rh2 (increased by 90). %).

In another preferred embodiment of the invention, a glycosyltransferase mutant protein UGT-MUT2 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Panax notoginseng, and the wild-type gene UGTPg45 derived from the ginseng-derived wild-type gene UGT-MUT2 can greatly increase the yield of Rh2 (increased by 120). %).

In another preferred embodiment of the invention, a glycosyltransferase mutant protein UGT-MUT3 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild type gene Pn50 derived from Panax notoginseng. The mutant glycosyltransferase gene UGT-MUT3 replaces the ginseng-derived wild-type gene UGTPg45, which can greatly increase the yield of Rh2 (increased 134). %).

It will be readily apparent to one of ordinary skill in the art that alteration of a small number of amino acid residues in certain regions of the polypeptide, such as non-significant regions, does not substantially alter biological activity, for example, the sequence obtained by appropriately replacing certain amino acids does not affect its activity ( See Watson et al, Molecular Biology of The Gene, Fourth Edition, 1987, The Benjamin/Cummings Pub. Co. P224). Thus, one of ordinary skill in the art will be able to implement such substitutions and ensure that the resulting molecule still has the desired biological activity.

Therefore, the polypeptide of the present invention may be an amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19, which is non-Gln and/or an amino acid corresponding to position 322 of the amino acid sequence shown by SEQ ID NO: 19. The residue is further mutated on the basis of non-Ala and still has the function and activity of the glycosyltransferase of the present invention. For example, the glycosyltransferase (a) of the present invention has the amino acid sequence shown as SEQ ID NO: 21; or (b) the sequence defined by (a) comprises one or more amino acid residues, preferably 1-20, More preferably, a sequence formed by substitution, deletion or addition of 1 to 15, more preferably 1 to 10, more preferably 1 to 3, most preferably 1 amino acid residue, and having substantially the function of the polypeptide defined in (a) a polypeptide derived from (a).

In the present invention, the glycosyltransferase of the present invention comprises the amino acid sequence such as SEQ ID NO.: 4, SEQ ID NO: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 Or up to 20, preferably up to 10, more preferably up to 3, more preferably up to 2, optimally up to 1 amino acid compared to the glycosyltransferase shown by SEQ ID NO.: 41 A mutant formed by substitution of amino acids of similar or similar nature. Mutants of these conservative variations can be produced according to, for example, amino acid substitutions as shown in the table below.

初始残基Initial residue	代表性的取代残基Representative substituted residues	优选的取代残基Preferred substituted residue
Ala(A)Ala(A)	Val；Leu；IleVal; Leu; Ile	ValVal
Arg(R)Arg(R)	Lys；Gln；AsnLys; Gln; Asn	LysLys
Asn(N)Asn(N)	Gln；His；Lys；ArgGln;His;Lys;Arg	GlnGln
Asp(D)Asp(D)	GluGlu	GluGlu
Cys(C)Cys(C)	SerSer	SerSer
Gln(Q)Gln(Q)	AsnAsn	AsnAsn
Glu(E)Glu(E)	AspAsp	AspAsp
Gly(G)Gly(G)	Pro；AlaPro; Ala	AlaAla
His(H)His(H)	Asn；Gln；Lys；ArgAsn; Gln; Lys; Arg	ArgArg
Ile(I)Ile(I)	Leu；Val；Met；Ala；PheLeu;Val;Met;Ala;Phe	LeuLeu
Leu(L)Leu(L)	Ile；Val；Met；Ala；PheIle;Val;Met;Ala;Phe	IleIle
Lys(K)Lys(K)	Arg；Gln；AsnArg; Gln; Asn	ArgArg
Met(M)Met(M)	Leu；Phe；IleLeu;Phe;Ile	LeuLeu
Phe(F)Phe(F)	Leu；Val；Ile；Ala；TyrLeu;Val;Ile;Ala;Tyr	LeuLeu
Pro(P)Pro(P)	AlaAla	AlaAla
Ser(S)Ser(S)	ThrThr	ThrThr
Thr(T)Thr(T)	SerSer	SerSer
Trp(W)Trp(W)	Tyr；PheTyr;Phe	TyrTyr
Tyr(Y)Tyr(Y)	Trp；Phe；Thr；SerTrp;Phe;Thr;Ser	PhePhe
Val(V)Val(V)	Ile；Leu；Met；Phe；AlaIle; Leu; Met; Phe; Ala	LeuLeu

The invention also provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" can be a polynucleotide comprising the polypeptide, or a polynucleotide further comprising additional coding and/or non-coding sequences.

Therefore, as used herein, "includes", "includes" or "includes" includes "includes", "consisting essentially of", "consisting essentially of", and "consisting of"; "Consisting", "consisting essentially of" and "consisting of" belong to the subordinate concept of "contains," "has," or "includes."

Amino acid residue corresponding to position 222/322/247/280 of the amino acid sequence shown in SEQ ID NO:

It is known to those skilled in the art that various mutations, such as substitutions, additions or deletions, can be made to some amino acid residues in the amino acid sequence of a certain protein, but the resulting mutant can still possess the function or activity of the original protein. Thus, one of ordinary skill in the art can make certain changes to the amino acid sequence specifically disclosed in the present invention to obtain a mutant which still has the desired activity, and thus the mutant has the 222th position of the amino acid sequence shown in SEQ ID NO: 19. The amino acid residues corresponding to the 322/247/280 amino acid residues may not be the 222th/322th/247th/280th position, but the mutant thus obtained should still fall within the scope of the present invention. .

The term "corresponding to" as used herein has the meaning as commonly understood by one of ordinary skill in the art. Specifically, "corresponding to" means a position in which one sequence corresponds to a specified position in another sequence after alignment of homology or sequence identity by two sequences. Therefore, as for "amino acid residue corresponding to position 222/322/247/280 of the amino acid sequence shown in SEQ ID NO: 19", if one end of the amino acid sequence shown by SEQ ID NO: 19 is added With the 6-His tag, the 222th/322th/247th/280th position corresponding to the amino acid sequence shown in SEQ ID NO: 19 in the obtained mutant may be the 228th/328th/253th/286th position. And if a few amino acid residues (for example, 2) in the amino acid sequence shown by SEQ ID NO: 19 are deleted, the obtained mutant corresponds to the 222th/322th position/247 of the amino acid sequence shown by SEQ ID NO: 19. Bit / 280 bits may be the 220th / 320 bit / 245 / 278 bits, and so on. For another example, if a sequence having 400 amino acid residues has higher homology or sequence identity to positions 20-420 of the amino acid sequence set forth in SEQ ID NO: 19, then the resulting mutant corresponds to SEQ ID The 222th/322th/247th/280th position of the amino acid sequence shown by NO: 19 may be the 202th/302th/227th/260th position.

In particular embodiments, the homology or sequence identity may be 80% or more, preferably 90% or more, more preferably 95% to 98%, and most preferably 99% or more.

Methods for determining sequence homology or identity as known to those of ordinary skill in the art include, but are not limited to, Computational Molecular Biology, Lesk, AM, Oxford University Press, New York, 1988; Biocomputing: Information Biocomputing: Informatics and Genome Projects, Smith, DW, Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, AM and Griffin, HG , Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987 and Sequence Analysis Primer, Gribskov, M. and Devereux , J. M. Stockton Press, New York, 1991 and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). The preferred method of determining identity is to obtain the largest match between the sequences tested. The method of determining identity is compiled in a publicly available computer program. Preferred computer program methods for determining identity between two sequences include, but are not limited to, the GCG package (Devereux, J. et al., 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. et al, 1990). The BLASTX program is available to the public from NCBI and other sources (BLAST Handbook, Altschul, S. et al, NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al, 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

Unless otherwise specified, the ginsenosides and sapogenins referred to herein are ginsenosides and sapogenins of the C20 position S and/or R configuration.

As used herein, "isolated polypeptide" means that the polypeptide is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify the polypeptide using standard protein purification techniques. A substantially pure polypeptide produces a single major band on a non-reducing polyacrylamide gel. The purity of the polypeptide can also be further analyzed using amino acid sequences.

The active polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptides of the invention may be naturally purified products, either chemically synthesized or produced recombinantly from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants). The polypeptide of the invention may be glycosylated or may be non-glycosylated, depending on the host used in the recombinant production protocol. Polypeptides of the invention may also or may not include an initial methionine residue.

The invention also includes fragments, derivatives and analogs of the polypeptides. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the polypeptide.

The polypeptide fragment, derivative or analog of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues It may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a mature polypeptide and another compound (such as a compound that extends the half-life of the polypeptide, for example Polyethylene glycol) a polypeptide formed by fusion, or (iv) a polypeptide formed by fused an additional amino acid sequence to the polypeptide sequence (such as a leader or secretion sequence or a sequence or proprotein sequence used to purify the polypeptide, or A fusion protein for the formation of an antigenic IgG fragment). These fragments, derivatives and analogs are within the purview of those skilled in the art in light of the teachings herein.

The active polypeptide of the present invention has glycosyltransferase activity and is capable of catalyzing one or more of the following reactions:

The polypeptide sequence is SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO: 41 or a derivative thereof The term also encompasses SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37 or SEQ ID NO.: 39 or SEQ having the same function as the polypeptide shown. ID NO: variant form of the 41 sequence. These variants include, but are not limited to, one or more (usually 1-50, preferably 1-30, more preferably 1-20, optimally 1-10) amino acid deletions , Insertion and/or Substitution, and the addition of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, when substituted with amino acids of similar or similar properties, the function of the protein is generally not altered. As another example, the addition of one or several amino acids at the C-terminus and/or N-terminus will generally not alter the function of the protein. The term also encompasses active fragments and active derivatives of the proteins of the invention. The invention also provides analogs of the polypeptides. The difference between these analogs and the natural polypeptide may be a difference in amino acid sequence, a difference in the modification form which does not affect the sequence, or a combination thereof. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by a variety of techniques, such as random mutagenesis by irradiation or exposure to a mutagen, or by site-directed mutagenesis or other techniques known to molecular biology. Analogs also include analogs having residues other than the native L-amino acid (such as D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (such as beta, gamma-amino acids). It is to be understood that the polypeptide of the present invention is not limited to the representative polypeptides exemplified above.

Modifications (usually without altering the primary structure) include chemically derived forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those produced by glycosylation modifications in the synthesis and processing of the polypeptide or in further processing steps. Such modification can be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylation enzyme or a deglycosylation enzyme. Modified forms also include sequences having phosphorylated amino acid residues such as phosphotyrosine, phosphoserine, phosphothreonine. Also included are polypeptides that have been modified to enhance their resistance to protease hydrolysis or to optimize solubility properties.

The amino terminus or carboxy terminus of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derived polypeptides thereof of the present invention may further comprise one or more polypeptide fragments as a protein tag. Any suitable label can be used in the present invention. For example, the tags can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty1. These tags can be used to purify proteins. Table 1 lists some of these tags and their sequences.

Table 1

标签label	残基数Number of residues	序列sequence
Poly-ArgPoly-Arg	5-6个(通常5个)5-6 (usually 5)	RRRRRRRRRR
Poly-HisPoly-His	2-10个(通常6个)2-10 (usually 6)	HHHHHHHHHHHH
FLAGFLAG	8个8	DYKDDDDKDYKDDDDK
Strep-TagIIStrep-TagII	8个8	WSHPQFEKWSHPQFEK
C-mycC-myc	10个10	WQKLISEEDLWQKLISEEDL
GSTGST	220个220	后面6个 LVPRGS The next 6 LVPRGS

In order to secrete the translated protein (eg, secreted extracellularly), the amino acid amino terminus of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a polypeptide derived therefrom may also be used. A signal peptide sequence such as a pelB signal peptide or the like is added. The signal peptide can be cleaved off during secretion of the polypeptide from the cell.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be SEQ ID NO.: 3, SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 The coding regions shown are identical or degenerate variants. As used herein, "degenerate variant" in the present invention means having the coding with SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO .: 39. The polypeptide of the amino acid sequence of SEQ ID NO.: 41, or a polypeptide derived therefrom, but with SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37. The coding sequence of SEQ ID NO.: 39, SEQ ID NO.: 41 or a polypeptide derived therefrom, preferably SEQ ID NO.: 3, SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO. A nucleic acid sequence having a difference in sequence of SEQ ID NO.: 40 or SEQ ID NO.: 42. A polypeptide encoding SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 or a polypeptide derived therefrom Polynucleotides of mature polypeptides include: coding sequences encoding only mature polypeptides; coding sequences for mature polypeptides and various additional coding sequences; coding sequences for mature polypeptides (and optionally additional coding sequences) and non-coding sequences.

The term "polynucleotide encoding a polypeptide" may be a polynucleotide comprising the polypeptide, or a polynucleotide further comprising additional coding and/or non-coding sequences.

The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of polypeptides or polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide encoded thereby. .

The invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The invention particularly relates to polynucleotides that hybridize to the polynucleotides of the invention under stringent conditions (or stringent conditions). In the present invention, "stringent conditions" means: (1) hybridization and elution at a lower ionic strength and higher temperature, such as 0.2 x SSC, 0.1% SDS, 60 ° C; or (2) hybridization a denaturing agent such as 50% (v/v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc.; or (3) at least 90% identity between the two sequences, more It is good that hybridization occurs more than 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide is SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO The mature polypeptide shown by .:41 has the same biological function and activity.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides or more. Nucleic acid fragments can be used in nucleic acid amplification techniques (such as PCR) to identify and/or isolate polynuclei encoding Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derived polypeptides thereof. Glycosylate.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The full-length nucleotide sequence of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or derivative polypeptide thereof of the present invention or a fragment thereof can generally be used by PCR amplification, recombinant method or artificial The synthetic method is obtained. For PCR amplification, primers can be designed in accordance with the disclosed nucleotide sequences, particularly open reading frame sequences, and can be prepared using commercially available cDNA libraries or conventional methods known to those skilled in the art. The library is used as a template to amplify the relevant sequences. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then the amplified fragments are spliced together in the correct order.

Once the relevant sequences are obtained, the recombinant sequence can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it to a cell, and then isolating the relevant sequence from the proliferated host cell by conventional methods.

In addition, synthetic sequences can be used to synthesize related sequences, especially when the fragment length is short. Usually, a long sequence of fragments can be obtained by first synthesizing a plurality of small fragments and then performing the ligation.

At present, it has been possible to obtain a DNA sequence encoding the protein of the present invention (or a fragment thereof, or a derivative thereof) completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

A method of amplifying DNA/RNA using PCR technology is preferably used to obtain the gene of the present invention. Particularly, when it is difficult to obtain a full-length cDNA from a library, RACE method (RACE-cDNA end rapid amplification method) can be preferably used, and primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein. And can be synthesized by conventional methods. The amplified DNA/RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a coding sequence using the vector of the present invention or Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a polypeptide derived therefrom Genetically engineered host cells, and methods of producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequences of the present invention can be used to express or produce recombinant Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivatives thereof by conventional recombinant DNA techniques. Peptide. Generally there are the following steps:

(1) using a polynucleotide (or variant) encoding a Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a polypeptide derived therefrom, or containing the polynucleoside An acid recombinant expression vector transforms or transduces a suitable host cell;

(2) a host cell cultured in a suitable medium;

(3) Separating and purifying the protein from the culture medium or the cells.

In the present invention, a polynucleotide sequence encoding a Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a polypeptide derived therefrom can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, phage, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Any plasmid and vector can be used as long as it can replicate and stabilize in the host. An important feature of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, and a translational control element.

Methods well known to those skilled in the art can be used to construct a coding DNA sequence containing Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a polypeptide derived therefrom and suitable transcription/translation control An expression vector for the signal. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E. coli; lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, anti- Promoters for transcription of viral LTRs and other known controllable genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

Vectors comprising the appropriate DNA sequences described above, as well as appropriate promoters or control sequences, can be used to transform appropriate host cells to enable expression of the protein.

The host cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells of Drosophila S2 or Sf9; CHO, COS, 293 cells, or Bowes melanoma cells Animal cells, etc.

When a polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. An enhancer is a cis-acting factor of DNA, usually about 10 to 300 base pairs, acting on a promoter to enhance transcription of the gene. Usable examples include a 100 to 270 base pair SV40 enhancer on the late side of the replication initiation point, a polyoma enhancer on the late side of the replication initiation site, and an adenovirus enhancer.

It will be apparent to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated by the CaCl ₂ method, and the procedures used are well known in the art. Another method is to use MgCl ₂ . Conversion can also be carried out by electroporation if desired. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, and the like.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The cultivation is carried out under conditions suitable for the growth of the host cell. After the host cell has grown to the appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction) and the cells are cultured for a further period of time.

The recombinant polypeptide in the above method can be expressed intracellularly, or on the cell membrane, or secreted outside the cell. If desired, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting method), centrifugation, osmotic sterilizing, super treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

application

The use of the active polypeptide or glycosyltransferase Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or polypeptide derived therefrom according to the present invention includes, but is not limited to, specific and efficient The glycosyl group from the glycosyl donor is transferred to the hydroxyl group at the C-3 position of the tetracyclic triterpenoid. In particular, it is possible to convert a compound of the formula (I) into the compound of the formula (II), for example, to convert the protopanaxadiol PPD into a rare ginsenoside Rh2 having superior antitumor activity; and to convert Compound K into ginsenoside F2.

The tetracyclic triterpene compound includes, but is not limited to, a dammarane type, a lanolin type, a ganthanane type, a cycloalkane (cycloaltenane) type in the S configuration or the R configuration, a tetracyclic triterpenoid such as apotirucallane type, cucurbitane or decane type.

The present invention provides an industrial catalytic method comprising: using the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide of the present invention or the like under the condition of providing a glycosyl donor The polypeptide is derived to obtain ginsenoside Rh2 and ginsenoside F2. Specifically, the polypeptide used in the (A) reaction is selected from the polypeptide represented by SEQ ID NO.: 4 or SEQ ID NO.: 21 or a polypeptide derived therefrom; and the polypeptide used in the (B) reaction is SEQ ID NO.: A polypeptide represented by 4 or a polypeptide derived therefrom.

In a preferred embodiment of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the aforementioned glycosyltransferase Pn50 and glycosyltransferase mutant protein 8E7.

In a preferred embodiment of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the aforementioned glycosyltransferase Pn50 mutant protein Pn50-Q222H-VE of Panax notoginseng.

In a preferred embodiment of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the aforementioned glycosyltransferase Pn50 mutant protein UGT-MUT1 of Panax notoginseng.

In a preferred embodiment of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the aforementioned glycosyltransferase Pn50 mutant protein UGT-MUT2.

In a preferred embodiment of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the aforementioned glycosyltransferase Pn50 mutant protein UGT-MUT3.

The glycosyl donor is a nucleoside diphosphate sugar selected from the group consisting of UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose , TDP-acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, UDP-xylose, GDP-xylose, UDP -galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP - Galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rhamnose, TDP-rham Sugar, CDP-rhamnose, GDP-rhamnose, or other nucleoside hexose phosphate or nucleoside pentose pentose, or a combination thereof.

The glycosyl donor is preferably uridine diphosphate, selected from the group consisting of UDP-glucose, UDP-xylose, UDP-rhamnose, UDP-galacturonic acid, UDP-galactose, UDP-Arabic Sugar, or other uridine diphosphate hexose or uridine pentose diphosphate, or a combination thereof.

In the method, an enzyme active additive (an additive that increases enzyme activity or inhibits enzyme activity) may also be added. The enzyme activity additive may be selected from the group consisting of Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ , or Fe ²⁺ ; a substance of Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ , or Fe ²⁺ .

The pH conditions of the process are: pH 4.0-10.0, preferably pH 6.0-pH 8.5, more preferably 8.5.

The temperature conditions of the process are from 10 ° C to 105 ° C, preferably from 25 ° C to 35 ° C, more preferably 35 ° C.

The present invention also provides a composition comprising an effective amount of the active polypeptide or glycosyltransferase Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or derivative thereof of the present invention. Polypeptides, as well as food or industrially acceptable carriers or excipients. Such carriers include, but are not limited to, water, buffer, dextrose, water, glycerol, ethanol, and combinations thereof.

Substances which modulate the glycosyltransferase activity of the present invention may also be added to the composition. Any substance having a function of increasing the activity of the enzyme is available. Preferably, the substance which increases the glycosyltransferase activity of the present invention is selected from the group consisting of mercaptoethanol. In addition, many substances can reduce enzyme activity, including but not limited to: Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ^{2+ ,} and Fe ²⁺ ; Substrate can be hydrolyzed to form Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ and Fe ²⁺ .

After obtaining the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derived polypeptides thereof of the present invention, the enzyme can be conveniently applied by the practitioner to exert the effect of transglycosylation. Especially for the transglycosylation of dammar diol and protopanaxadiol. As a preferred mode of the present invention, there are also provided two methods for forming rare ginsenosides, one of the methods comprising: using the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT according to the present invention. The MUT3 polypeptide or a polypeptide derived therefrom, which comprises a substrate to be transglycosylated, said substrate comprising a tetracyclic triterpenoid such as dammar diol, protopanaxadiol and derivatives thereof. Preferably, the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative polypeptide thereof thereof is used to treat the glycosyl group to be transfected under the condition of pH 3.5-10. Substrate. Preferably, the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative polypeptide thereof is used to treat the glycosyl group to be transfected at a temperature of 30-105 °C. Substrate.

The second method comprises the steps of: transferring the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or the derivative polypeptide gene thereof according to the invention into a process for synthesizing the original ginseng diol PPD. In bacteria (for example, yeast or E. coli engineering bacteria), or, Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a polypeptide derived therefrom, and dammar diol, The key gene in the original P. ginseng PPD anabolic pathway and optionally other glycosyltransferase genes are co-expressed in host cells (eg yeast cells or E. coli) to obtain direct production of rare ginsenoside Rh2 and/or ginsenoside F2. Recombinant bacteria. Alternatively, the nucleotide sequence encoding the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a polypeptide derived therefrom is anabolized with dammarene diol and/or protopanaxadiol PPD. The key enzymes in the pathway and optionally other glycosyltransferases as well as key enzymes for the synthesis of UDP-rhamnose are co-expressed in host cells and used to construct recombinant strains of synthetic ginsenoside Rh2 and ginsenoside F2.

The key genes in the dammar diol anabolic pathway include, but are not limited to, the dammarene diol synthase gene.

In another preferred embodiment, the key genes in the proto-ginsengdiol anabolic pathway include, but are not limited to, a dammarene diol synthase gene PgDDS, a ginseng diol-synthesized cytochrome P450 gene CYP716A47, and Its reductase gene, or a combination thereof. Or isozymes of various enzymes and combinations thereof. Among them, dammarene diol synthase converts squalene (Saccharomyces cerevisiae self-synthesis) into dammarene diol, and cytochrome P450CYP716A47 and its reductase convert dammarene diol into proto-ginseng diol PPD. . (Han et.al, plant&cell physiology, 2011, 52.2062-73)

The main advantages of the invention:

(1) The method for producing ginsenoside Rh2 by using the Saccharomyces cerevisiae has the advantages of low cost, short cycle, stable quality, and the like compared with the conventional method relying on ginseng plant extract and glycosyl hydrolysis;

(2) The glycosyltransferase Pn50 obtained by the present invention from Sanqi for the first time can catalyze PPD and Rh2, catalyze the synthesis of F2 by CK, and introduce it into the PPD-producing strain, which can be more than the wild-type glycosyltransferase UGTPg45 in ginseng. Efficient synthesis of rare ginsenoside Rh2;

(3) The present invention obtains the mutant gene 8E7 or the hepta-7-transferase gene Pn50 by randomly mutating the wild type glycosyltransferase UGTPg45 in ginseng, and introduces it into the PPD-producing strain compared to wild-type glycosyltransfer in ginseng. The enzyme UGTPg45 can significantly increase the synthesis efficiency of rare ginsenoside Rh2.

(4) The present invention obtains the mutant genes Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 by random mutation of the wild-type glycosyltransferase Pn50 in Panax notoginseng, and introduces them into the PPD-producing strain. The wild-type glycosyltransferase Pn50 can significantly increase the synthesis efficiency of rare ginsenoside Rh2 in Sanqi.

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are not intended to limit the scope of the invention. Experimental methods in which the specific conditions are not indicated in the following examples are generally carried out according to the conditions described in conventional conditions, for example, Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions. The conditions recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated.

The specific implementation process of the present invention can be further understood by the following specific implementation methods.

Example 1. Cloning of the hepta-7-transferase gene Pn50

Two primers were synthesized, such as the sequence Pn50 clone primer F, SEQ ID NO: 1 (ATGGAGAGAGAAATGTTGAGCA) and Pn50 clone primer R, SEQ ID NO: 2 (TCAGGAGGAAACAAGCTTTGAA). The cDNA obtained by reverse transcription of RNA extracted from Panax notoginseng was used as a template, and PCR was carried out using the above primers. DNA polymerase uses the high-fidelity KOD DNA polymerase from Biotech Engineering Co., Ltd. The PCR amplification procedure was: 94 ° C for 2 min; 94 ° C for 15 s, 58 ° C for 30 s, 68 ° C for 2 min for a total of 35 cycles; 68 ° C for 10 min to 10 ° C. The PCR product was detected by agarose gel electrophoresis and the results are shown in Figure 1.

Irradiate in the ultraviolet and cut off the target DNA band. Then, the DNA fragment of the amplified glycosyltransferase gene was recovered from the agarose gel using an Axygen Gel Extraction Kit (AEYGEN). The recovered PCR product was cloned into the PMDT vector using Takada's PMD18-T cloning kit, and the constructed vector was named PMDT-Pn50. The gene sequence of Pn50 was obtained by sequencing.

The Pn50 gene has the nucleotide sequence of SEQ ID NO: 3. The 1-1368th nucleotide from the 5' end of SEQ ID NO: 3 is the open reading frame (ORF) of Pn50, from nucleotides 1-3 of the 5' end of SEQ ID NO: The start codon ATG of the Pn50 gene, the nucleotides 1366-1368 from the 5' end of SEQ ID NO: 3 are the stop codon TGA of the Pn50 gene. The glycosyltransferase Pn50 gene encodes a protein of 455 amino acids, Pn50, having the amino acid residue sequence of SEQ ID NO: 4, which is predicted by software to have a theoretical molecular weight of 51.1 kDa and an isoelectric point pI of 5.10. The amino acid at positions 332-375 of the amino terminus of SEQ ID NO: 4 is the glycosyltransferase PSPG conserved domain.

Pn50 nucleotide sequence SEQ ID NO: 3

Pn50 amino acid sequence SEQ ID NO: 4

Example 2. Expression of the heptacosyltransferase gene Pn50 in Escherichia coli

Two primers were synthesized, such as the sequence Pn50 expression primer F SEQ ID NO: 5 (GGATCCATGGAGAGAGAAATGTTGAGCA) and Pn50 expression primer R SEQ ID NO: 6 (CTCGAGTCAGGAGGAAACAAGCTTTGAA). Two cleavage sites of BamH I and Xho I were added to the synthesized primer F/R, and PCR was carried out using cDNA extracted from plants as a template. DNA polymerase uses the high-fidelity KOD DNA polymerase from Biotech Engineering Co., Ltd. The PCR amplification procedure was: 94 ° C for 2 min; 94 ° C for 15 s, 58 ° C for 30 s, 68 ° C for 2 min for a total of 35 cycles; 68 ° C for 10 min to 10 ° C. The PCR product was detected by agarose gel electrophoresis. Irradiate in the ultraviolet and cut off the target DNA band. Then, the DNA fragment of the amplified glycosyltransferase gene was recovered from the agarose gel using an Axygen Gel Extraction Kit (AEYGEN). The two PCR products recovered were digested with BamH I and Xho I, ligated with pET28a which was digested with BamH I and Xho I, respectively, and the ligated product was transformed into E. coli EPI300 competent cells, and the transformed Escherichia coli was transformed. The solution was applied to LB plates supplemented with 50 ug/mL kanamycin, and the recombinant clones were further verified by PCR and restriction enzyme digestion. One of the clones was selected and the recombinant plasmid was extracted and verified by sequencing. After sequencing, the recombinant plasmid was transformed into E. coli BL21 (DE3) to induce expression. The induced expression method was: picking a single clone from the plate to contain 50 ug/mL Kana. The LB tube of themycin was used overnight, and 1% was inoculated into a 50 ml flask and shaken at 37 ° C until the OD600 was 0.6-0.7. The final concentration was 0.1 mM of IPTG, and induced at 18 ° C for 16 h. 12000 g, 3 min collection of bacteria per gram of wet weight cells were resuspended in 10 ml of PBS buffer, and the cells were lysed, and the supernatant was centrifuged to obtain a crude enzyme solution.

Example 3. Tris-7-transferase gene Pn50 catalyzes the reaction of different substrates and its product detection

The glycosyltransferase Pn50 catalytic reaction system (100 μL) was configured as follows:

The reaction was carried out in a water bath at 37 ° C for 2 h. After the completion of the reaction, an equal volume of n-butanol was added for extraction, and a n-butanol phase was taken. After concentration in vacuo, the reaction product was dissolved in 10 μL of methanol, and the mixture was subjected to TLC or HPLC. It can be seen from the results in Fig. 2 that the glycosyltransferase Pn50 used in the present invention can catalyze the formation of a new product of the original ginseng diol PPD (reaction see Formula A), its migration position on the TLC plate and the migration of Rh2. The position is consistent, demonstrating that this new product is ginsenoside Rh2. In addition, Pn50 also catalyzes compound K, and the resulting product is presumed to be ginsenoside F2 according to the migration position on the TLC plate and the regional specificity of Pn50 (Fig. 2).

Example 4. Synthesis of rare ginsenoside Rh2 in Saccharomyces cerevisiae using panax notoginseng-derived glycosyltransferase gene Pn50

(1) The glycosyltransferase gene Pn50 derived from Panax notoginseng can catalyze the hydroxyglycosylation of protopanaxadiol at the C3 position to synthesize rare ginsenoside Rh2. In order to realize the synthesis of rare ginsenoside Rh2 in Saccharomyces cerevisiae, the present invention firstly constructed a strain. Saccharomyces cerevisiae chassis cells capable of producing protopanaxadiol. Introducing the dammarene diol synthase gene PgDDS into wild-type Saccharomyces cerevisiae, the cytochrome P450 gene CYP716A47 synthesized by proto-ginsengdiol and its reductase gene PgCPR1, which were synthesized using S. cerevisiae's own mevalonate pathway. - Epoxy squalene can synthesize protopanaxadiol. The S. cerevisiae strain ZWBY04RS with high protogenetic ginseng diol was obtained by optimizing the artificially constructed proto-ginseng diol synthesis pathway, including optimization of the synthesis rate-limiting step and optimization of precursor supply.

(2) synthesizing 12 primers of the sequence SEQ ID NO: 7-18, and obtaining a promoter, a terminator, an ORF, a screening marker, an upstream and downstream homologous arm fragment, and a PCR method by PCR method Example 1. After the above PCR fragment and the ORF of UGTPg45 were each mixed 100 ng, the recombinant S. cerevisiae strain ZWBY04RS was transformed with the conventional LiAc/ssDNA transformation method of Saccharomyces cerevisiae to obtain recombinant Saccharomyces cerevisiae strain ZWBY04RS-UGTPg45. After the above PCR fragment and the ORF of Pn50 were each mixed 100 ng, the recombinant Saccharomyces cerevisiae strain ZWBY04RS was transformed with the conventional LiAc/ssDNA transformation method of Saccharomyces cerevisiae to obtain recombinant Saccharomyces cerevisiae strain ZWBY04RS-Pn50.

Promoter Primer F SEQ_ID_NO.7

Promoter Primer R SEQ_ID_NO.8

ORF Primer F SEQ_ID_NO.9

ORF Primer R SEQ_ID_NO.10

Terminator Primer F SEQ_ID_NO.11

Terminator Primer R SEQ_ID_NO.12

Filter Marker Primer F SEQ_ID_NO.13

Filter marker primer R SEQ_ID_NO.14

Upstream homology arm primer F SEQ_ID_NO.15

Upstream homology arm primer R SEQ_ID_NO.16

Downstream homology arm primer F SEQ_ID_NO.17

Downstream homology arm primer R SEQ_ID_NO.18

(3) Configuration of solid medium: Disposition medium: 1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose), 2% agar powder.

Configure liquid medium: Configure medium: 1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose).

The recombinant S. cerevisiae ZWBY04RS-UGTPg45 and ZWBY04RS-Pn50 streaked on the solid medium plate were picked and shaken overnight in a test tube containing 5 mL of liquid medium (30 ° C, 250 rpm, 16 h); the cells were collected by centrifugation and transferred. In a 50 mL flask of 10 mL liquid medium, the fermentation product was obtained by adjusting the OD 600 to 0.05, 30 ° C, and shaking culture at 250 rpm for 4 days. This method simultaneously sets up a parallel experiment for each recombinant yeast.

Extraction and detection of protopanaxadiol and rare ginsenoside Rh2: 100 μL of fermentation broth was taken from 10 mL of fermentation broth, and yeast was lysed with Fastprep, and an equal volume of n-butanol was added for extraction, followed by n-butanol under vacuum. Evaporate dry. The yield of the objective product was measured by HPLC after dissolving in 100 μL of methanol. The HPLC results are shown in Figure 3.

The recombinant Saccharomyces cerevisiae strain ZWBY04RS-UGTPg45 constructed by introducing the ginseng-derived glycosyltransferase gene UGTPg45 into the Saccharomyces cerevisiae strain producing ginseng diol can synthesize rare ginsenoside Rh2, and its yield is 35.66 mg/L. The recombinant Saccharomyces cerevisiae strain ZWBY04RS-Pn50 constructed by introducing the Panax notoginseng-derived glycosyltransferase gene Pn50 into the Saccharomyces cerevisiae strain producing protosan diol can synthesize rare ginsenoside Rh2 with a yield of 45.55 mg/L.

Example 5. Construction of a random mutation library of ginseng-derived glycosyltransferase UGTPg45

Using the plasmid UGTPg45-pMD18T as a template, using the GeneMorph II Random Mutagenesis Kit (Agilent Technology), UGTPg45 random mutagenic primer F SEQ ID NO: 23 (Gcatagcaatctaatctaagttttaattacaaaatggagagagaaatgttgagcaaaac) and UGTPg45 random mutation primer R SEQ ID NO: 24 (Gaaaagaagataatatttttatataattatattaatctcaggaggaaacaagctttgaa) as primers Wrong PCR, the procedure is as follows: 95 ° C 2 min pre-denaturation; 95 ° C denaturation 30 s, 58 ° C annealing 30 s, 72 ° C extension 3 min 15 s, 30 cycles; 72 ° C final extension 10 min. According to the kit instructions, 1ug, 1.5ug, 2ug template was used to explore the mutation rate. The PCR product was recovered by tapping, and Ta was added to the vector pMD18T with Taq enzyme to transform E. coli TOP10. Ten positive clones were randomly picked and sequenced, and the mutation rate was determined to be 1-2 bases/gene corresponding template amount of 1.5 ug. Subsequent experiments using this condition for error-prone PCR constructed a random mutation library of UGTPg45.

Using the primers SEQ ID NO: 25 (fragment 7 primer F) (Acactggggcaataggctgtcgccattcaagagcagatagcttcaaaatgtttctactc) and SEQ ID NO: 26 (fragment 7 primer R) (Cataatgtgagttttgctcaacatttctctctctccattttgtaattaaaacttagattag), the fragment 7 was obtained by PCR using S. cerevisiae genomic DNA as a template, using primer SEQ ID NO: 27 (fragment 8 primer F) (Ttgatgagttcatttcaaagcttgtttcctcctgagattaatataattatataaaaata) and SEQ ID NO: 28 (fragment 8 primer R) (Actgtcaaggagggtattctgggcctccatgtcgctgctatataacagttgaaatttgg) were obtained by PCR using S. cerevisiae genomic DNA as a template, using primer SEQ ID NO: 29 (fragment 9 primer F) (Cccaaagctaagagtcccattttattc) and SEQ ID NO: 30 (fragment 9 primer R) (Gaagagtaaaaaaggagtagaaacattttgaagctatctgctcttgaatggcgacagcc), SEQ ID NO: 31 (fragment 10 primer F) (Tgtcgattcgatactaacgccgccatccagtgtcgagaattacaatagtatgtctgatg) and SEQ ID NO: 32 (fragment 10 primer R) (Tctggtgaggatttacggtatg) Fragments 9 and 10 were obtained by S. cerevisiae genomic DNA as template PCR. Fragment 11 was obtained by PCR using plasmid SEQ ID NO: 33 (fragment 11 primer F) (Aagatgttcttatccaaatttcaactgttatatagcagcgacatggaggcccagaatac) and SEQ ID NO: 34 (fragment 11 primer R) (tacttcttgcagacatcagacatactattgtaattctcgacactggatggcggcgttag) using plasmid PLKAN as a template. The above fragments 7-11 were mixed in an equimolar ratio, transformed into a PPD high-yield strain ZWBY04RS, coated with a YPD plate (100 ug/ml G418), cultured at 30 ° C for 2 days, and yeast transformants to be expressed with the UGTPg45 mutant gene were grown. Similarly, wild type UGTPg45 was transformed to construct yeast transformants as controls.

600 μl of YPD medium per well (100 ug/ml G418) was added to a 96-well plate, yeast monoclonal was picked into the medium, and cultured at 30 ° C for 280 rpm for 1 day. 6 ul of the culture was transferred to a new 96-well plate containing 600 ul of YPD medium and incubated at 30 ° C for 3 days with shaking at 280 rpm. Add 600 ul of n-butanol to each well, cover the rubber cap and seal with tape, and spin for 3 h. After centrifugation at 4000 rpm for 10 min, 150 ul of n-butanol phase was pipetted into a new 96-well plate and the product was determined by HPLC.

The yield of Rh2 in the rare ginsenoside Rh2 strain ZWBY04RS-8E7 constructed using the mutant gene 8E7 was 70% higher than that of the strain ZWBY04RS-UGTPg45 constructed using UGTPg45, reaching 60.48 mg/L.

The wild type gene UGTPg45 has the nucleotide sequence of SEQ ID NO: 20. The nucleotide from position 1-1374 at the 5' end of SEQ ID NO: 20 is the open reading frame of UGTPg45, and the nucleotide from positions 1-3 at the 5' end of SEQ ID NO: 20 is the initiation code of the UGTPg45 gene. The sub-ATG, nucleotides 1371-1374 from the 5' end of SEQ ID NO: 20 are the stop codon TGA of the UGTPg45 gene. The glycosyltransferase UGTPg45 gene encodes a 457 amino acid protein UGTPg45 having the amino acid residue sequence of SEQ ID NO: 19, which was predicted by software to have a theoretical molecular weight of 51.1 kDa and an isoelectric point pI of 5.10. The amino acid at positions 332-375 of the amino terminus of SEQ ID NO: 19 is the glycosyltransferase PSPG conserved domain.

UGTPg45 amino acid sequence SEQ_ID_NO.19

UGTPg45 nucleotide sequence SEQ_ID_NO.20

The mutant gene 8E7 has the nucleotide sequence of SEQ ID NO: 22. From the 5' end of SEQ ID NO: 22, nucleotides 1-1374 are the open reading frame of 8E7, and the nucleotides 1-3 from the 5' end of SEQ ID NO: 22 are the starting code of the 8E7 gene. The sub-ATG, from nucleotides 1371 to 1374 of the 5' end of SEQ ID NO: 22, is the stop codon TGA of the 8E7 gene. The glycosyltransferase 8E7 gene encodes a protein of 457 amino acids, 8E7, having the amino acid residue sequence of SEQ ID NO:21.

8E7 amino acid sequence SEQ_ID_NO.21

8E7 nucleotide sequence SEQ_ID_NO.22

The above results indicate that the replacement of the ginseng-derived glycosyltransferase gene UGTPg45 by the G7-derived glycosyltransferase gene Pn50 or the mutant gene 8E7 obtained by genetic modification of the wild-type glycosyltransferase can greatly enhance the rare ginsenosides. The synthesis efficiency and yield of Rh2 have significant beneficial effects.

Example 6. Synthesis of Rh2 in Saccharomyces cerevisiae using the glycosyltransferase mutant gene Pn50-Q222H-VE of Panax notoginseng Pn50

The inventors mutated the amino acid residue Q at position 222 of Pn50 to H, while the amino acid residues at positions 322 and 323 of Pn50 were deleted, and the inventors inserted two amino acids VE after the 321 position to obtain a Pn50 mutant Pn50- Q222H-VE.

(1) synthesizing 12 primers such as SEQ ID NO: 7-18, and obtaining a promoter, a terminator, an ORF, a screening marker, an upstream and downstream homologous arm fragment, and a PCR method by PCR method Example 1. After the above PCR fragment and 100 ng of each of the ORFs of Pn50-Q222H-VE were mixed, the recombinant S. cerevisiae strain ZWBY04RS was transformed with the conventional LiAc/ssDNA transformation method of Saccharomyces cerevisiae to obtain recombinant Saccharomyces cerevisiae strain ZWBY04RS-QE.

(2) Pick the recombinant S. cerevisiae ZWBY04RS-QE streaked on the solid medium plate, and incubate overnight in a test tube containing 5 mL of liquid medium (30 ° C, 250 rpm, 16 h); collect the cells by centrifugation and transfer to In a 50 mL flask of 10 mL liquid medium, the fermentation product was obtained by adjusting the OD 600 to 0.05, 30 ° C, and shaking culture at 250 rpm for 4 days. This method simultaneously sets up a parallel experiment for each recombinant yeast.

Extraction and detection of protopanaxadiol and rare ginsenoside Rh2: 100 μL of fermentation broth was taken from 10 mL of fermentation broth, and yeast was lysed with Fastprep, and an equal volume of n-butanol was added for extraction, followed by steaming n-butanol under vacuum. dry. The yield of the objective product was measured by HPLC after dissolving in 100 μL of methanol.

The recombinant Saccharomyces cerevisiae strain ZWBY04RS-QE constructed by introducing the Panax notoginseng-derived glycosyltransferase gene Pn50-Q222H-VE into the Saccharomyces cerevisiae strain producing protosan diol can synthesize rare ginsenoside Rh2 with a yield of 59.09 mg/L. (Figure 4).

Amino acid sequence of Pn50-Q222H-VE, SEQ_ID_NO.41

Nucleic acid sequence of Pn50-Q222H-VE, SEQ_ID_NO.42

Example 7. Synthesis of Rh2 in Saccharomyces cerevisiae using the glycosyltransferase mutant genes UGT-MUT1, UGT-MUT2 and UGT-MUT3

The inventors obtained three mutants with improved catalytic efficiency, UGT-MUT2 and UGT-, by saturating the amino acid residue K at position 280 and/or amino acid residue N at position 247 of Pn50-Q222H-VE. MUT3. UGT-MUT1 mutates amino acid residue K at position 280 of Pn50-Q222H-VE to amino acid residue I, and UGT-MUT2 mutates amino acid residue N at position 247 of Pn50-Q222H-VE to amino acid residue S, UGT-MUT3 mutates the amino acid residue K at position 280 of Pn50-Q222H-VE to amino acid residue I, and mutates 247 to amino acid residue N to amino acid residue S.

(1) synthesizing 12 primers such as SEQ ID NO: 7-18, and obtaining a promoter, a terminator, an ORF, a screening marker, an upstream and downstream homologous arm fragment, and a PCR method by PCR method Example 1. Mixing the above PCR fragments with the ORFs of UGT-MUT1 (Pn50-Q222H-VE-K280I), UGT-MUT2 (Pn50-Q222H-VE-N247S) and UGT-MUT3 (Pn50-Q222H-VE-K280I-N247S) After homogenization, the recombinant S. cerevisiae strain ZWBY04RS was transformed by the conventional LiAc/ssDNA transformation method of Saccharomyces cerevisiae to obtain recombinant Saccharomyces cerevisiae strains ZWBY04RS-MUT1, ZWBY04RS-MUT2 and ZWBY04RS-MUT3.

(2) Picking recombinant S. cerevisiae ZWBY04RS-MUT1, ZWBY04RS-MUT2 and ZWBY04RS-MUT3 streaked on solid medium plates, respectively, shaking culture in a test tube containing 5 mL of liquid medium overnight (30 ° C, 250 rpm, 16 h) The cells were collected by centrifugation, transferred to a 50 mL flask of 10 mL of liquid medium, adjusted to an OD 600 to 0.05, 30 ° C, and shaken at 250 rpm for 4 days to obtain a fermentation product. This method simultaneously sets up a parallel experiment for each recombinant yeast.

Extraction and detection of protopanaxadiol and rare ginsenoside Rh2: 100 μL of fermentation broth was taken from 10 mL of fermentation broth, and yeast was lysed with Fastprep, and an equal volume of n-butanol was added for extraction, followed by steaming n-butanol under vacuum. dry. The yield of the objective product was measured by HPLC after dissolving in 100 μL of methanol. The HPLC results are shown in Figure 4.

The recombinant Saccharomyces cerevisiae strain ZWBY04RS-MUT1 constructed by introducing the G7-derived glycosyltransferase gene UGT-MUT1 into the Saccharomyces cerevisiae strain producing protosan diol can synthesize rare ginsenoside Rh2 with a yield of 67.96 mg/L. The recombinant Saccharomyces cerevisiae strain ZWBY04RS-MUT2 constructed by introducing the G7-derived glycosyltransferase gene UGT-MUT2 into the Saccharomyces cerevisiae strain producing protosan diol can synthesize rare ginsenoside Rh2 with a yield of 78.29 mg/L. The recombinant Saccharomyces cerevisiae strain ZWBY04RS-MUT3 constructed by introducing the G7-derived glycosyltransferase gene UGT-MUT3 into the Saccharomyces cerevisiae strain producing ginseng diol can synthesize rare ginsenoside Rh2 with a yield of 83.53 mg/L.

Glycosyltransferase mutant gene UGT-MUT1 amino acid sequence SEQ_ID_NO.35

Glycosyltransferase mutant gene UGT-MUT1 nucleotide sequence SEQ_ID_NO.36

Glycosyltransferase mutant gene UGT-MUT2 amino acid sequence SEQ_ID_NO.37

Glycosyltransferase mutant gene UGT-MUT2 nucleotide sequence SEQ_ID_NO.38

Glycosyltransferase mutant gene UGT-MUT3 amino acid sequence SEQ_ID_NO.39

Glycosyltransferase mutant gene UGT-MUT3 nucleotide sequence SEQ_ID_NO.40

discuss

At present, researchers have discovered a large number of glycosyltransferase candidate genes through transcriptome analysis of ginseng, American ginseng and notoginseng, but only a very small number of glycosyltransferases have been verified to be involved in the synthesis of ginsenosides. Glycosyltransferases involved in the synthesis of ginsenosides in Panax notoginseng have not been reported so far. Since Panax notoginseng also synthesizes the same ginsenosides, the discovery of Panax notoginseng-derived glycosyltransferases allows us to better understand the synthetic pathways of these two types of plants for synthesizing ginsenosides, and on the other hand, for the synthesis of ginsenosides. More abundant components are of great significance.

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims

An isolated polypeptide characterized in that

(1) The amino acid sequence of the isolated polypeptide is non-Gln at amino acid residue corresponding to position 222 of the amino acid sequence shown by SEQ ID NO: 19 and/or corresponding to the amino acid sequence corresponding to SEQ ID NO: 19. The amino acid residue at position 322 is non-Ala; or

(2) The amino acid sequence of the isolated polypeptide is non-Asn(N) at amino acid residue corresponding to position 247 of the amino acid sequence shown in SEQ ID NO: 19 and/or corresponding to SEQ ID NO: 19 The amino acid residue at position 280 of the amino acid sequence is non-Lys (K).
An isolated polypeptide characterized in that said polypeptide is selected from the group consisting of:

(a) having the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 Polypeptide

(b) the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 A substitution, deletion or addition of a polypeptide over one or several amino acid residues, preferably from 1 to 20, more preferably from 1 to 15, more preferably from 1 to 10, more preferably from 1 to 3, most preferably 1 amino acid residue. a derivative polypeptide formed or added with a signal peptide sequence and having glycosyltransferase activity;

(c) a derivative polypeptide comprising a polypeptide sequence as described in (a) or (b);

(d) amino acid sequence and amino acid represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 Sequence homology ≥ 85% (preferably ≥ 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) with glycosyltransferase Active derivative polypeptide.
An isolated polynucleotide, characterized in that said polynucleotide is a sequence selected from the group consisting of:

(A) a nucleotide sequence encoding the polypeptide of claim 1 or 2;

(B) a nucleotide sequence encoding the polypeptide of SEQ ID NO.: 4 or SEQ ID NO.: 21 or a polypeptide derived therefrom;

(C) a nucleoside as shown in SEQ ID NO.: 3, SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 Acid sequence

(D) the same as the sequence shown in SEQ ID NO.: 3, SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: a nucleotide sequence of ≥90% (preferably ≥91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%);

(E) nucleotides set forth in SEQ ID NO.: 3, SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 a nucleotide sequence formed by truncating the 5' end and/or the 3' end of the sequence or adding 1-60 (preferably 1-30, more preferably 1-10) nucleotides;

(F) a nucleotide sequence complementary to the nucleotide sequence of any of (A) to (E).
A vector comprising the polynucleotide of claim 3.
Use of the isolated polypeptide of claim 1 or 2, characterized in that it is used to catalyze the following reaction or to prepare a catalytic preparation which catalyzes the following reaction:

(i) Transferring a glycosyl group derived from a glycosyl donor to the hydroxyl group at the C-3 position of the tetracyclic triterpenoid.
The use according to claim 5, characterized in that the isolated polypeptide is used to catalyze the following reaction or to prepare a catalytic preparation which catalyzes the following reaction:

Wherein R1 is H or OH; R2 is H or OH; R3 is H or a glycosyl group; and R4 is a glycosyl group.
An in vitro glycosylation method, comprising the steps of:

Transferring the glycosyl group of the glycosyl donor to the hydroxyl group C-3 of the tetracyclic triterpenoid in the presence of a glycosyltransferase; thereby forming a glycosylated tetracyclic triterpenoid;

Wherein the glycosyltransferase is the polypeptide of claim 1 or 2 or a polypeptide derived therefrom.
The method of claim 7 wherein said derived polypeptide is selected from the group consisting of:

Passing a polypeptide of the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 Or a derivative polypeptide formed by substitution, deletion or addition of several amino acid residues or formed by adding a signal peptide sequence and having glycosyltransferase activity; or

Homology of the amino acid sequence to the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 ≥85% (preferably ≥90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), and a derivative polypeptide having glycosyltransferase activity;

Here, the glycosyltransferase activity refers to an activity capable of transferring a glycosyl group of a glycosyl donor to a hydroxyl group at the C-3 position of a tetracyclic triterpenoid.
A method for performing a glycosyl-catalyzed reaction, which comprises the steps of performing a glycosyl-catalyzed reaction in the presence of the polypeptide of claim 1 or 2 or a polypeptide derived therefrom.
The method of claim 9 wherein the substrate for the glycosyl catalyzed reaction is a compound of formula (I) and said product is a compound of formula (II).
A genetically engineered host cell, comprising the vector of claim 4, or a polynucleotide of claim 3 integrated in the genome thereof.
Use of the host cell according to claim 11, characterized in that it is used for the preparation of an enzyme catalytic reagent, or for the production of a glycosyltransferase, or as a catalytic cell, or a glycosylated tetracyclic triterpenoid.
A method of producing a transgenic plant, comprising the steps of: regenerating the genetically engineered host cell of claim 11 into a plant, and said genetically engineered host cell is a plant cell.