JP7086107B2 - Glycosyltransferases, mutants and their use - Google Patents

Description

The present invention relates to the fields of biotechnology and plant biology, and specifically to glycosyltransferases for synthesizing ginsenoside Rh2, mutants of glycosyltransferases and their use.

Ginsenosides are the main active substances in plants of the genus Panax notoginseng of the Araliaceae family (eg, Panax notoginseng, Panax notoginseng, American ginseng, etc.). Currently, domestic and foreign scientists have already isolated more than 100 types of saponins from plants such as Panax notoginseng and Panax notoginseng, and ginsenosides belong to the triterpene saponins. Among them, some ginsenosides have been demonstrated to have a wide range of physiological functions and medicinal value, including functions such as antitumor, immunomodulatory, antifatigue, cardiac protection and liver protection. Among them, some saponins have already been used clinically. For example, Ginsenoside Rg3 monomer-based drug, Sanichi Capsule, can improve the deficiency symptoms of major patients and improve the immune function of the living body. can. Imayuki Capsule, which contains ginsenoside Rh2 monomer as the main component, is a health drug for improving the immune system of the living body and enhancing the anti-disease power.

In terms of structure, ginsenosides are bioactive small molecules formed by glycosylation of sapogenins. Ginsenoside sapogenins are limited in variety and are predominantly dammarane-type protopanaxadiol and protopanaxatriol, and oleanane-type resinoids. Other than the differences in sapogenins, the structural differences between ginsenosides are primarily manifested in the different glycosylation modifications of sapogenins. The sugar chain of ginsenoside is usually attached to the hydroxyl group of C3, C6, or C20 of sapogenin, and the glycosyl group may be glucose, rhamnose, xylose or arabinose.

Ginsenosides vary greatly in physiology and medicinal value, depending on the binding sites of different glycosyl groups, the composition and length of the sugar chains. For example, ginsenosides Rb1, Rd, and Rc are all saponins with protopanaxadiol as a sapogenin, and the only difference between them is the difference in modification by glycosyl groups, but they differ greatly in physiological function. Rb1 has the function of stabilizing the central nervous system, while the function of Rc is to suppress the central nervous system. Rb1 has a wide range of physiological functions, but Rd has only a limited number of functions.
Rare ginsenoside is a saponin having a very low content in Panax ginseng. Ginsenoside Rh2 (3-O-β- (D-glucopyranosyl) -20 (S) -protopanaxadiol, 3-O-β- (D-glucopyranosyl) -20 (S) -protopanaxadiol) is a protopanaxadiol. It belongs to the system saponin, and one glucosyl group is bonded to the hydroxyl group at the C-3 position of sapogenin. Ginsenoside Rh2 has an excellent antitumor activity, although its content is only about 1 / 10,000 of the dry weight of Panax ginseng, and it is one of the most important antitumor active components in Panax ginseng and promotes tumor cell growth. It can suppress, induce apoptosis of tumor cells, and suppress tumor metastasis. Studies have shown that ginsenoside Rh2 can suppress the proliferation of lung cancer cells 3LL (mouse), Morris liver cancer cells (rats), B-16 melanoma cells (mouse), and HeLa cells (humans). In clinical practice, treatment of ginsenoside Rh2 in combination with radiation therapy or chemotherapy can improve the efficacy of radiation therapy and chemotherapy. In addition, ginsenoside Rh2 has further effects such as anti-allergy, a function of improving the immunity of the living body, and suppressing inflammation caused by NO and PGE.

The function of the glycosyltransferase is to transfer the glycosyl group in the sugar donor (nucleoside diphosphate sugar, eg UDP-glycose) to another sugar acceptor. There are currently 94 families of glycosyltransferases, depending on the amino acid sequence. Over 100 different glycosyltransferases have been discovered in the sequenced plant genome. Glycosyltransferase sugar acceptors include sugars, fats, proteins, nucleic acids, antibiotics and other small molecules. The action of glycosyltransferases involved in the glycosylation of saponins in Panax ginseng is to transfer glycosyl groups in sugar donors to the hydroxyl groups of C3, C6 or C20 of sapogenins or aglycones to form saponins with different medicinal values. be.
Currently, there is no effective method for producing the rare ginsenoside Rh2 and ginsenoside F2 in this field, so the development of many specific and efficient glycosyltransferases is eagerly desired.

It is an object of the present invention to provide glycosyltransferases for synthesizing rare ginsenoside Rh2, ginsenoside F2 and their use.

The first aspect of the invention is an isolated polypeptide, which is an isolated polypeptide.
(1) The amino acid residue corresponding to the 222nd position of the amino acid sequence shown by SEQ ID NO: 19 in the amino acid sequence is other than Gln, and / or the amino acid residue corresponding to the 322nd position of the amino acid sequence shown by SEQ ID NO: 19 is Ala. Polypeptides other than,
(2) The amino acid residue corresponding to position 247 of the amino acid sequence shown by SEQ ID NO: 19 in the amino acid sequence is other than Asn (N), and / or the amino acid residue corresponding to position 280 of the amino acid sequence shown by SEQ ID NO: 19. The group is other than Lys (K),
Provide a polypeptide.

In another preferred example, the isolated polypeptide is
i). A polypeptide having the amino acid sequence shown in SEQ ID NO: 19 and having the 222nd amino acid residue other than Gln and / or the 322nd amino acid residue other than Ala, or
ii). The sequence limited in i) is one or more amino acid residues, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most. Derived from i), preferably having a sequence consisting of substitutions, deletions or additions of one amino acid residue, and having the function of an isolated polypeptide essentially limited in i). It is a polypeptide.

In another preferred example, the isolated polypeptide is
i). A polypeptide having the amino acid sequence shown in SEQ ID NO: 19 and having the 247th amino acid residue other than Asn (N) and / or the 280th amino acid residue other than Lys (K), or
ii). The sequence limited in i) is one or more amino acid residues, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most. Derived from i), preferably having a sequence consisting of substitutions, deletions or additions of one amino acid residue, and having the function of an isolated polypeptide essentially limited in i). It is a polypeptide.

In another preferred example, the isolated polypeptide has one or more amino acid residues, preferably 1-20, more preferably 1-15, sequence limited in i). An isolated poly having a sequence consisting of the addition of 1 to 10 amino acid residues, more preferably 1 to 3 amino acid residues, and most preferably 1 amino acid residue, and basically limited to i). It is a polypeptide derived from i) having the function of a peptide.

In another preferred example, at least the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is selected from His, Asn, Gln, Lys and Arg. It is a kind.
In another preferred example, the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is His.
In another preferred example, at least the amino acid residue corresponding to position 322 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is selected from Val, Ile, Leu, Met and Phe. It is a kind.
In another preferred example, the amino acid residue corresponding to position 322 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Val.
In another preferred example, the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is His, and 322 of the amino acid sequence represented by SEQ ID NO: 19. The second corresponding amino acid residue is Val.

In another preferred example, the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ser (S), Pro (P), Ala (A). ) Or Thr (T).
In another preferred example, the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ser (S).

In another preferred example, the amino acid residue corresponding to position 280 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ile (I), Asn (N), Ser (S). ) Or Ala (A).
In another preferred example, the amino acid residue corresponding to position 280 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ile (I).

In another preferred example, the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ser (S), and the amino acid represented by SEQ ID NO: 19 The amino acid residue corresponding to the 280th position in the sequence is Ile (I).

In another preferred example, the isolated polypeptide is
iii). A polypeptide having the amino acid sequence shown in SEQ ID NO: 19 and having the 222nd amino acid residue other than Gln and / or the 322nd amino acid residue other than Ala, or
iv). The sequence limited in iii) is one or more amino acid residues, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, most preferably. It is preferably derived from iii) having a sequence consisting of substitutions, deletions or additions of one amino acid residue and having the function of an isolated polypeptide basically limited in iii). It is a polypeptide.

In another preferred example, the isolated polypeptide is
iii). A polypeptide having the amino acid sequence shown in SEQ ID NO: 19 and having the 247th amino acid residue other than Asn (N) and / or the 280th amino acid residue other than Lys (K), or
iv). The sequence limited in iii) is one or more amino acid residues, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most. It is preferably derived from iii) having a sequence consisting of substitutions, deletions or additions of one amino acid residue and having the function of an isolated polypeptide basically limited in iii). It is a polypeptide.

In another preferred example, the isolated polypeptide has one or more amino acid residues, preferably 1-20, more preferably 1-15, of the sequence limited in iii). An isolated poly having a sequence consisting of the addition of 1 to 10 amino acid residues, more preferably 1 to 3 amino acid residues, and most preferably 1 amino acid residue, and basically limited to iii). It is a polypeptide derived from iii) having the function of a peptide.

In another preferred example, at least the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is selected from His, Asn, Gln, Lys and Arg. It is a kind.
In another preferred example, the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is His.
In another preferred example, at least the amino acid residue corresponding to position 322 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is selected from Val, Ile, Leu, Met and Phe. It is a kind.
In another preferred example, the amino acid residue corresponding to position 322 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Val.
In another preferred example, the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is His, and 322 of the amino acid sequence represented by SEQ ID NO: 19. The second corresponding amino acid residue is Val.

In another preferred example, the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ser (S), Pro (P), Ala (A). ) Or Thr (T).
In another preferred example, the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ser (S).
In another preferred example, the amino acid residue corresponding to position 280 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ile (I), Asn (N), Ser (S). ) Or Ala (A).
In another preferred example, the amino acid residue corresponding to position 280 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ile (I).
In another preferred example, the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ser (S), and the amino acid represented by SEQ ID NO: 19 The amino acid residue corresponding to the 280th position in the sequence is Ile (I).

In another preferred example, the isolated polypeptide is a glycosyltransferase.
In another preferred example, the glycosyltransferase is from a plant of the genus Panax japonicus.
In another preferred example, the glycosyltransferase is from Panax ginseng, American ginseng and / or Panax notoginseng.
In another preferred example, the polypeptide is selected from the following group:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41;
(B) The polypeptide of the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 is one or more amino acid residues, preferably 1 to 20. Amino acid residues, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most preferably 1 amino acid residue substituted, deleted or added, or a signal peptide. A derivative polypeptide having an added sequence and having glycosyltransferase activity;
(C) Derivative polypeptide containing the polypeptide sequence according to (a) or (b) in the sequence;
(D) The homology of the amino acid sequence with the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 is ≧ 85% (preferably ≧ 90%, 91). %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) and a derivative polypeptide having glycosyltransferase activity.

In another preferred example, said sequence (c) is a fusion protein formed by adding a tag sequence, signal sequence or secretory signal sequence to (a) or (b).
In another preferred example, the activity of the glycosyltransferase is the activity of transferring the glycosyl group of the sugar donor to the hydroxyl group at the C-3 position of the tetracyclotriterpene compound.
In another preferred example, the glycosyltransferase can increase the production of ginsenoside Rh2 and / or ginsenoside F2.
In another preferred example, in an artificially constructed strain, the glycosyltransferase produces ginsenoside Rh2, preferably 5 to 150%, more preferably 10 to 100%, even more preferably 20 to 80. %, Most preferably 28-70%, can be improved.
In another preferred example, the artificially constructed strain is selected from the group consisting of Saccharomyces cerevisiae strains, Escherichia coli strains, Pichia pastoris strains, fission yeast strains, and Kruiwelomyces strains.

A second aspect of the invention provides a polynucleotide that is an isolated polynucleotide and has a sequence selected from the following group:
(A) Nucleotide sequence encoding the polypeptide according to the first aspect of the present invention;
(B) Nucleotide sequence encoding the polypeptide or derivative polypeptide set forth in SEQ ID NO: 4 or 21;
(C) Nucleotide sequence represented by SEQ ID NO: 3, SEQ ID NO: 22, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40 or SEQ ID NO: 42;
(D) Homology with the sequence represented by SEQ ID NO: 3, SEQ ID NO: 22, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40 or SEQ ID NO: 42 is ≧ 90% (preferably ≧ 91%, 92%, 93%). , 94%, 95%, 96%, 97%, 98% or 99%) nucleotide sequence;
(E) 1 to 60 (preferably 1 to 30) at the 5'end and / or 3'end of the nucleotide sequence set forth in SEQ ID NO: 3, SEQ ID NO: 22, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40 or 42. , More preferably 1-10) nucleotide sequences deleted or added;
(F) A nucleotide sequence complementary to the nucleotide sequence according to any one of (A) to (E).

A third aspect of the invention provides a vector comprising the polynucleotide according to the second aspect of the invention.
In another preferred example, the vector comprises an expression vector, a shuttle vector, an integration vector.

A fourth aspect of the invention is the use of the isolated polypeptide according to the first aspect of the invention to catalyze the following reactions or to produce a catalytic formulation that catalyzes the following reactions. Provide use for:
(I) A reaction that transfers a glycosyl group from a sugar donor to the hydroxyl group at the C-3 position of a tetracyclotriterpene compound.

In another preferred example, the sugar donors are UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP. -Acetylglucose, GDP-Acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose, UDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP- Galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP- Nucleoside dilinine selected from the group consisting of ramnorth, ADP-ramnorth, TDP-ramnorth, CDP-ramnorth, GDP-ramnose, or other nucleoside diphosphate hexacarbonate or nucleoside diphosphate pentacarbonate, or a combination thereof. Contains acid sugar.

（ただし、R1はHまたはOHで、R2はHまたはOHで、R3はHまたはグリコシル基で、R4はグリコシル基である。） In another preferred example, the sugar donor may be UDP-glucose, UDP-xylose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-ramnose, or other uridine diphosphate hexacarbonate or It contains uridine diphosphate pentacarbonate sugar, or uridine diphosphate (UDP) sugar selected from the group consisting of combinations thereof.
In another preferred example, the isolated polypeptide is used to catalyze the following reactions or to produce a catalytic formulation that catalyzes the following reactions.

(However, R1 is H or OH, R2 is H or OH, R3 is H or glycosyl group, and R4 is glycosyl group.)

前記のポリペプチドは、配列番号4、配列番号21、配列番号35、配列番号37、配列番号39または配列番号41で示されるポリペプチドまたはその誘導体ポリペプチドから選ばれる。 In another preferred example, the isolated polypeptide is used to catalyze the following reactions or to produce a catalytic formulation that catalyzes the following reactions.

The polypeptide is selected from the polypeptides set forth in SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 or derivatives thereof.

In another preferred example, the glycosyl group is selected from a glucosyl group, a galacturonic acid group, a xylosyl group, a galactosyl group, an arabinosyl group, a ramnosyl group, and other hexa or pentacarbon sugars.
In another preferred example, the reaction products of the reactions (A) and / or (B) are Dammarane-type tetracyclotriterpene-based compounds, lanostane-type tetracyclotriterpene-based compounds, apotirukaran (apotirucallane) in the S or R configuration. It includes, but is not limited to, type tetracyclotriterpene compounds, tilkaran type tetracyclotriterpene compounds, cycloaltan type tetracyclotriterpene compounds, cucurbitane type tetracyclotriterpene compounds, or meliacan type tetracyclotriterpene compounds.

The fifth aspect of the present invention is a method of glycosylation in vitro.
It comprises the step of forming a glycosylated tetracyclotriterpene compound by transferring a glycosyl group from a sugar donor to the hydroxyl group at the C-3 position of the tetracyclotriterpene compound in the presence of a glycosyltransferase.
Here, the glycosyltransferase is the polypeptide according to the first aspect of the present invention or a derivative polypeptide thereof.
Provide a method.
In another preferred example, the derivative polypeptide is
The polypeptide of the amino acid sequence set forth in SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 undergoes substitution, deletion or addition of one or more amino acid residues. , Or a derivative polypeptide having a glycosyltransferase activity, or an amino acid sequence SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39. Or the homology with the amino acid sequence set forth in SEQ ID NO: 41 is ≧ 85% (preferably ≧ 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%). ) And selected from derivative polypeptides with glycosyltransferase activity,
Here, the activity of the glycosyltransferase is an activity of transferring the glycosyl group of the sugar donor to the hydroxyl group at the C-3 position of the tetracyclotriterpene compound.

The sixth aspect of the present invention provides a method for carrying out a glycosyl-catalyzed reaction, which is a method for carrying out a glycosyl-catalyzed reaction in the presence of the polypeptide according to the first aspect of the present invention or a derivative polypeptide thereof. ..
In another preferred example, the method further comprises
Including the step of converting a compound of formula (I) into the compound of formula (II) in the presence of a sugar donor and the polypeptide according to the first aspect of the present invention or a derivative thereof.
In another preferred example, the compound of formula (I) is protopanaxadiol PPD and the compound of formula (II) is ginsenoside Rh2, or the compound of formula (I) is Compound K and formula ( II) The compound is ginsenoside F2.
In another preferred example, the method further comprises subjecting the polypeptide or derivative polypeptide thereof to the catalytic reaction, respectively, and / or simultaneously including the polypeptide or derivative polypeptide thereof into the catalytic reaction. Including that.

In another preferred example, the method further comprises the nucleotide sequence encoding the glycosyltransferase as a key gene and / or other glycosyltransferase gene in the synthetic metabolic pathway of dammarene diol and / or protopanaxadiol. The step of co-expressing with and in a host cell to obtain the above-mentioned compound of formula (II) is included.
In another preferred example, the compound of formula (II) is ginsenoside Rh2 or ginsenoside F2.
In another preferred example, the host cell is yeast or E. coli.
In another preferred example, the method further comprises providing the reaction system with an additive that regulates enzyme activity.
In another preferred example, the additive that regulates the enzyme activity is an additive that enhances or suppresses the enzyme activity.

In another preferred example, the additives that regulate the enzyme activity are Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ , or Fe ² . Selected from the group consisting of ⁺ .
In another preferred example, the additives that regulate the enzyme activity are Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ , or Fe ² . A substance that can produce ⁺ .
In another preferred example, the sugar donor is nucleoside diphosphate sugar, UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose, UDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP -Galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, A group consisting of GDP-arabinose, UDP-ramnorth, ADP-ramnorth, TDP-ramnorth, CDP-ramnorth, GDP-ramnorth, or other nucleoside diphosphate hexacarbonate or nucleoside diphosphate pentacarbonate, or a combination thereof. Is selected from.

In another preferred example, the sugar donor is uridine diphosphate sugar, UDP-glucose, UDP-xylose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-ramnose, or other uridine diphosphate. It is selected from the group consisting of hexacarbonic acid phosphate, pentacarbonic acid uridine diphosphate, or a combination thereof.
In another preferred example, the pH of the reaction system is pH 4.0 to 10.0, preferably pH 5.5 to 9.0.
In another preferred example, the temperature of the reaction system is 10 ° C to 105 ° C, preferably 20 ° C to 50 ° C.
In another preferred example, the key gene in the above-mentioned synthetic metabolic pathway of dammarendiol includes, but is not limited to, the dammarendiol synthase gene.

In another preferred example, the key genes in the synthetic metabolic pathway of protopanaxadiol are the dammarene diol synthase gene, the cytochrome P450 gene CYP716A47 for protopanaxadiol synthesis and its reductase gene, or a combination thereof. , But not limited to.
In another preferred example, the substrate for the glycosyl-catalyzed reaction is a compound of formula (I) and the product of which is a compound of formula (II).
In another preferred example, the compound of formula (I) is protopanaxadiol PPD and the compound of formula (II) is ginsenoside Rh2, or the compound of formula (I) is Compound K and formula ( II) The compound is ginsenoside F2.

A seventh aspect of the invention is a genetically engineered host cell that comprises the vector described in the third aspect of the invention or has the polynucleotide described in the second aspect of the invention in its genome. Provides integrated host cells.
In another preferred example, the glycosyltransferase is the polypeptide according to the first aspect of the invention or a derivative polypeptide thereof.
In another preferred example, the nucleotide sequence encoding the glycosyltransferase is described in the second aspect of the invention.
In another preferred example, the cell is a prokaryotic cell or a eukaryotic cell.

In another preferred example, the host cell is a eukaryotic cell, such as a yeast cell or a plant cell.
In another preferred example, the host cell is a budding yeast cell.
In another preferred example, the host cell is a prokaryotic cell, eg E. coli.
In another preferred example, the host cell is Panax ginseng cell.
In another preferred example, the host cell is not a cell that naturally produces compound (II).

In another preferred example, the host cell is not a cell that spontaneously produces ginsenoside Rh2 or ginsenoside F2.
In another preferred example, the key gene in the above-mentioned synthetic metabolic pathway of dammarendiol includes, but is not limited to, the dammarendiol synthase gene.
In another preferred example, the key genes in the synthetic metabolic pathway of protopanaxadiol contained in the host cell are the dammalendiol synthase gene, the cytochrome P450 gene CYP716A47 for protopanaxadiol synthesis and its reductase gene. , Or combinations thereof, but not limited to these.

The eighth aspect of the invention is the use of the host cell according to the seventh aspect of the invention, for the production of enzyme-catalyzed reagents, for the production of glycosylated enzymes, or for catalytic cells. , Or use for producing glycosylated tetracyclotriterpene-based compounds.
In another preferred example, the tetracyclotriterpene compound is a compound of formula (II).
In another preferred example, the host cell is used to produce a compound of formula (II) by a glycosylation reaction to the compound of formula (I).
In another preferred example, the host cell is used to produce ginsenoside Rh2 and / or ginsenoside F2 by a glycosylation reaction to protopanaxadiol PPD and / or Compound K.

The ninth aspect of the present invention is a method for producing a genetically modified plant, wherein the genetically engineered host cell according to the seventh aspect of the present invention is regenerated into a plant, and the genetically engineered host is described above. Provided is a method comprising a step in which the cell is a plant cell.
In another preferred example, the genetically engineered host cell is selected from Panax ginseng cells, American ginseng cells, Panax notoginseng cells, tobacco cells.

Of course, within the scope of the present invention, it is understood that the above technical features of the present invention and the specifically described technical features of the following (eg, Examples) can be combined with each other to form a new or suitable technical plan. Will be done. Since the number of papers is limited, I will not explain it here one by one.

FIG. 1 is an agarose gel electrophoresis pattern of the glycosyltransferase gene Pn50. FIG. 2 is a TLC analysis diagram of a ginsenoside catalyst by the glycosyltransferase gene Pn50. FIG. 3 is an HPLC analysis diagram in the case of constructing a recombinant Saccharomyces cerevisiae strain with Pn50 to produce rare ginsenoside Rh2. Figure 4 shows the fermentation production of rare ginsenoside Rh2 by constructing a recombinant Saccharomyces cerevisiae strain with Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2 and above and UGT-MUT3, which are mutants of the Pn50 protein. It is a comparative analysis.

Specific Embodiments The present inventor has conducted extensive and in-depth research for the first time to catalyze the glucosylation of terpene compounds and to synthesize glucosyltransferases of sancithininjin glycosyltransferase Pn50 (SEQ ID NO: 4) and otaneninjin in the synthesis of new saponins. Enzyme UGTPg45 mutant 8E7 (SEQ ID NO: 21), Sancithinin gin Glucuronosyltransferase mutant Pn50-Q222H-VE (SEQ ID NO: 41), UGT-MUT1 (SEQ ID NO: 35), UGT-MUT2 (SEQ ID NO: 37) ) And UGT-MUT3 (SEQ ID NO: 39) could be provided.

Specifically, the glycosyltransferase of the present invention specifically and efficiently transfers the substrate of the tetracyclotriterpene compound and / or the glycosyl group from the sugar donor to the hydroxyl group at the C-3 position of the tetracyclotriterpene-based compound. Can be catalyzed to cause. Particularly efficiently, protopanaxadiol PPD can be converted to the rare ginsenoside Rh2, which has antitumor activity, and the rare ginsenoside Compound K (modified by one glucosyl group at the C20 position of PPD) to the product ginsenoside F2. can. Surprisingly, the recombinant Saccharomyces cerevisiae strain ZWBY04RS-Pn50, which was constructed by introducing the saccharomyces cerevisiae-derived glycosyltransferase gene Pn50 into a Saccharomyces cerevisiae producing protopanaxadiol, can synthesize rare ginsenoside Rh2. The production of ginsenoside Rh2 in the strain ZWBY04RS-Pn50 was increased by 28% (45.55 / 35.66-1 = 28%) compared to the strain ZWBY04RS-UGTPg45 into which the saccharomyces cerevisiae gene UGTPg45 derived from wild-type Otaneninjin was introduced. The strain ZWBY04RS-8E7 that artificially synthesizes the rare ginsenoside Rh2 structured by the mutant gene 8E7 obtained by modifying UGTPg45 by random mutation is the strain ZWBY04RS-UGTPg45 whose Rh2 production is constructed by UGTPg45. 70% higher than production (60.48 / 35.66-1 = 70%). The strain ZWBY04RS-QE that artificially synthesizes the rare ginsenoside Rh2 constructed by the mutant gene Pn50-Q222H-VE obtained by modifying Pn50 by a site-specific mutation has a Rh2 production of UGTPg45. The production volume of the strain ZWBY04RS-UGTPg45 was improved by 66% (59.09 / 35.66-1 = 66%). The strain ZWBY04RS-MUT1 that artificially synthesizes the rare ginsenoside Rh2 constructed with the mutant UGT-MUT1 gene obtained by further modifying Pn50-Q222H-VE by site-specific mutation has an Rh2 production of UGTPg45. It was 90% higher than the production of the strain ZWBY04RS-UGTPg45 constructed in (67.96 / 35.66-1 = 90%). The strain ZWBY04RS-MUT2 that artificially synthesizes the rare ginsenoside Rh2 constructed with the mutant UGT-MUT2 gene obtained by further modifying Pn50-Q222H-VE by site-specific mutation has an Rh2 production of UGTPg45. It was 120% higher than the production of the strain ZWBY04RS-UGTPg45 constructed in (78.29/35.66-1 = 120%). The strain ZWBY04RS-MUT3 that artificially synthesizes the rare ginsenoside Rh2 constructed with the mutant UGT-MUT3 gene obtained by further remodeling Pn50-Q222H-VE by site-specific mutation has an Rh2 production of UGTPg45. The production volume of the strain ZWBY04RS-UGTPg45 constructed in 1 was improved by 134% (83.53 / 35.66-1 = 134%).

The present invention also provides conversion and catalytic methods. In addition, the glycosyltransferase of the present invention is a key gene in the synthetic metabolic pathway of danmalendiol and / or protopanaxadiol (for example, danmalendiol synthase gene PgDDS, cytochrome P450 gene CYP716A47 for protopanaxadiol synthesis and its reduction). It can be used to construct strains that co-express with the enzyme gene PgCPR1) in host cells or artificially synthesize rare ginsenoside Rh2 in genetically engineered cells that produce ginsenoside Rh2.
In addition, the glycosyltransferase of the present invention is used for constructing a strain that artificially synthesizes rare ginsenoside Rh2 by co-expressing it in a host cell with a key gene in the synthetic metabolic pathway of dammarene diol and / or protopanaxadiol. be able to. Based on this, the present invention has been completed.

Definitions As used herein, the terms "active polypeptide", "polypeptide of the invention and derivatives thereof", "enzyme of the invention", "glycotransferase" or "glycotransferase of the invention". "" Can be used interchangeably and has the usual meaning understood by those skilled in the art. The glycosyltransferase of the present invention has an activity of transferring the glycosyl group of a sugar donor to the hydroxyl group at the C-3 position of a tetracyclotriterpene-based compound.

In one preferred example of the present invention, the amino acid sequence of the glycosyltransferase of the present invention has an amino acid residue corresponding to the 222nd position of the amino acid sequence shown in SEQ ID NO: 19 other than Gln and / or SEQ ID NO: 19. The amino acid residue corresponding to the 322nd position in the shown amino acid sequence is other than Ala.
In one preferred example of the invention, the glycosyltransferase of the invention is:
i). A polypeptide having the amino acid sequence shown in SEQ ID NO: 19 and having the 222nd amino acid residue other than Gln and / or the 322nd amino acid residue other than Ala, or
ii). The sequence limited in i) is one or more amino acid residues, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most. Derived from i), preferably having a sequence consisting of substitutions, deletions or additions of one amino acid residue, and having the function of an isolated polypeptide essentially limited in i). It is a polypeptide.
In one preferred example of the invention, the glycosyltransferase of the invention has one or more amino acid residues, preferably 1-20, more preferably 1-15 sequences limited in i). , More preferably 1 to 10, more preferably 1 to 3, and most preferably 1 amino acid residue, and isolated in i). It is a polypeptide derived from i) having the function of a polypeptide.

In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 222 of the amino acid sequence shown in SEQ ID NO: 19 is selected from His, Asn, Gln, Lys and Arg. Is at least one kind.
In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 222 of the amino acid sequence shown in SEQ ID NO: 19 is His.
In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 19 is selected from Val, Ile, Leu, Met and Phe. Is at least one kind.
In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 322 of the amino acid sequence shown in SEQ ID NO: 19 is Val.
In one preferred example of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is the amino acid sequence represented by SEQ ID NO: 19, in which the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 is His. The amino acid residue corresponding to the 322nd position of is Val.

In one preferred example of the present invention, the amino acid sequence of the glycosyltransferase of the present invention is such that the amino acid residue corresponding to position 247 of the amino acid sequence shown in SEQ ID NO: 19 is other than Asn (N) and / or the sequence. The amino acid residue corresponding to the 280th position of the amino acid sequence shown by No. 19 is other than Lys (K).
In one preferred example of the invention, the glycosyltransferase of the invention is:
i). A polypeptide having the amino acid sequence shown in SEQ ID NO: 19 and having the 247th amino acid residue other than Asn (N) and / or the 280th amino acid residue other than Lys (K), or
ii). The sequence limited in i) is one or more amino acid residues, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most. Derived from i), preferably having a sequence consisting of substitutions, deletions or additions of one amino acid residue, and having the function of an isolated polypeptide essentially limited in i). It is a polypeptide.

In one preferred example of the invention, the glycosyltransferase of the invention has one or more amino acid residues, preferably 1-20, more preferably 1-15 sequences limited in i). , More preferably 1 to 10, more preferably 1 to 3, and most preferably 1 amino acid residue, and isolated in i). It is a polypeptide derived from i) having the function of a polypeptide.
In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 247 of the amino acid sequence shown in SEQ ID NO: 19 is Ser (S), Pro (P), Ala. At least one selected from (A) or Thr (T).
In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 247 of the amino acid sequence shown in SEQ ID NO: 19 is Ser (S).

In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to the 280th position of the amino acid sequence shown in SEQ ID NO: 19 is Ile (I), Asn (N), Ser. At least one selected from (S) or Ala (A).
In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 280 of the amino acid sequence shown in SEQ ID NO: 19 is Ile (I).
In one preferred example of the present invention, in the amino acid sequence of the glycosyltransferase of the present invention, the amino acid residue corresponding to position 247 of the amino acid sequence shown in SEQ ID NO: 19 is Ser (S), which is shown by SEQ ID NO: 19. The amino acid residue corresponding to the 280th position in the amino acid sequence is Ile (I).

In one preferred example of the invention, the glycosyltransferases of the invention are selected from the following group:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41;
(B) The polypeptide of the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 is one or more amino acid residues, preferably 1 to 20. Amino acid residues, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most preferably 1 amino acid residue substituted, deleted or added, or a signal peptide. A derivative polypeptide having an added sequence and having glycosyltransferase activity;
(C) A derivative polypeptide containing the polypeptide sequence according to (a) or (b) in the sequence,
(D) The homology of the amino acid sequence with the amino acid sequence represented by SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 is ≧ 85% (preferably ≧ 90%, 91). %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) and a derivative polypeptide having glycosyltransferase activity.

In a specific embodiment, the activity of the glycosyltransferase of the present invention is an activity of transferring the glycosyl group of a sugar donor to the hydroxyl group at the C-3 position of a tetracyclotriterpene-based compound.
In one preferred example of the invention, a novel glycosyltransferase gene Pn50 cloned from Panax notoginseng can be utilized to catalyze the C-position glucosylation of multiple dammarane-type ginsenosides.
When the data of the Panax notoginseng transcription group was analyzed, the gene sequence of one full-length glycosyltransferase was obtained by linking them and named Pn50. After cloning into the clone vector PMDT-18T, an expression primer was designed, constructed on the E. coli expression vector pET28a, and induced and expressed in E. coli. The resulting protein can catalyze the glucosylation of the hydroxyl group at the C3 position of protopanaxadiol and Compound K.
The Panax notoginseng glycosyltransferase gene Pn50 can significantly improve Rh2 production (28% improvement) in place of UGTPg45 derived from Panax notoginseng.

In another preferred example of the invention, the glycosyltransferase mutant protein 8E7 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene UGTPg45 derived from Otaneninjin, and the mutant glycosyltransferase gene 8E7 replaces the wild-type gene UGTPg45 derived from Otaneninjin to significantly improve Rh2 production. Can be (70% improvement).
In another preferred example of the present invention, the glycosyltransferase mutant protein Pn50-Q222H-VE is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Sanshitininjin, and the mutant glycosyltransferase gene Pn50-Q222H-VE produces Rh2 in place of the wild-type gene UGTPg45 derived from Otaneninjin. The amount can be significantly improved (66% improvement).

In another preferred example of the invention, the glycosyltransferase mutant protein UGT-MUT1 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Sanshitininjin, and the mutant glycosyltransferase gene UGT-MUT1 replaces the wild-type gene UGTPg45 derived from Otaneninjin to produce Rh2. Can be significantly improved (90% improvement).
In another preferred example of the invention, the glycosyltransferase mutant protein UGT-MUT2 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Sanshitininjin, and the mutant glycosyltransferase gene UGT-MUT2 replaces the wild-type gene UGTPg45 derived from Otaneninjin to produce Rh2. Can be significantly improved (120% improvement).

In another preferred example of the invention, the glycosyltransferase mutant protein UGT-MUT3 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Sanshitininjin, and the mutant glycosyltransferase gene UGT-MUT3 replaces the wild-type gene UGTPg45 derived from Otaneninjin to produce Rh2. Can be significantly improved (134% improvement).
As is well known to those skilled in the art, changing a small number of amino acid residues in some regions of a polypeptide, eg, unimportant regions, does not change the biological activity, for example, in a sequence substituted with a suitable amino acid. Not affected (see Watson et al., Molecular Biology of The Gene, 4th Edition, 1987, The Benjamin / Cummings Pub. Co. P224). As such, one of ordinary skill in the art can make such substitutions while ensuring that the resulting molecule maintains the required biological activity.

Therefore, in the polypeptide of the present invention, the amino acid residue corresponding to the 222nd position of the amino acid sequence shown in SEQ ID NO: 19 is other than Gln, and / or the amino acid residue corresponding to the 322nd position of the amino acid sequence shown by SEQ ID NO: 19. Based on a group other than Ala, the function and activity of the glycosyltransferase of the present invention can be maintained while further mutating. For example, in the glycosyltransferase of the present invention, (a) the amino acid sequence is shown by SEQ ID NO: 21, or (b) the sequence limited by (a) is one or more amino acid residues, preferably. Sequences consisting of 1 to 20, more preferably 1 to 15, more preferably 1 to 10, more preferably 1 to 3, and most preferably 1 amino acid residue substitution, deletion or addition. It is a polypeptide derived from (a) that contains and basically has the function of the polypeptide limited in (a).

In the present invention, the glycosyltransferase of the present invention has 20 amino acid transferases as compared with the glycosyltransferases whose amino acid sequences are represented by SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41. Hereinafter, it comprises a mutant in which 10 or less, more preferably 3 or less, still more preferably 2 or less, and most preferably 1 amino acid is replaced with an amino acid having similar or similar properties. These conservative mutants can be produced, for example, by substituting amino acids as shown in the table below.

さらに、本発明は、本発明のポリペプチドをコードするポリヌクレオチドを提供する。用語「ポリペプチドをコードするポリヌクレオチド」は、このポリペプチドをコードするポリヌクレオチドでもよく、さらに付加のコードおよび/または非コード配列を含むポリヌクレオチドでもよい。
そのため、本発明書で用いられる「含有する」、「有する」または「含む」は、「含める」、「主に…で構成される」、「基本的に…で構成される」および「…で構成される」を含む。「主に…で構成される」、「基本的に…で構成される」および「…で構成される」は、「含有する」、「有する」または「含む」の下位概念に該当する。

In addition, the invention provides polynucleotides encoding the polypeptides of the invention. The term "polynucleotide encoding a polypeptide" may be a polynucleotide encoding this polypeptide, as well as a polynucleotide comprising an additional coding and / or non-coding sequence.
Therefore, "contains", "has" or "includes" used in the present invention includes "includes", "mainly composed of ...", "basically composed of ..." and "...". Includes "composed". "Mainly composed of ...", "basically composed of ..." and "consisting of ..." correspond to the subordinate concepts of "contains", "has" or "contains".

Amino acid residues corresponding to positions 222/322/247/280 of the amino acid sequence shown in SEQ ID NO: 19, as is well known to those skilled in the art, various mutations in the amino acid sequence of a protein for some amino acid residues. , For example, substitutions, additions or deletions can be made to ensure that the resulting mutant maintains the function or activity of the original protein. Therefore, those skilled in the art can obtain a mutant that maintains the required activity by making some changes to the amino acid sequence specifically disclosed in the present invention, and thus such a mutant. The amino acid residue corresponding to the 222/322/247/280th amino acid residue of the amino acid sequence shown in SEQ ID NO: 19 in the above may not be the 222/322/247/280th amino acid residue. Variants are also included in the scope of protection of the invention.

As used herein, the term "applicable" has the usual meaning understood by one of ordinary skill in the art. Specifically, "corresponding" is a position corresponding to a predetermined position in the other sequence of one sequence by aligning the two sequences with homology or sequence identity. Therefore, in the case of "amino acid residue corresponding to the 222/322/247/280th amino acid residue of the amino acid sequence shown in SEQ ID NO: 19, 6-His is located at one end of the amino acid sequence shown in SEQ ID NO: 19." When tagged, the residue corresponding to the 222/322/247/280 position of the amino acid sequence shown by SEQ ID NO: 19 in the obtained mutant can be the 228/328/253/286 position. In addition, if a small number of amino acid residues (for example, 2) in the amino acid sequence shown in SEQ ID NO: 19 are deleted, it corresponds to the 222/322/247/280 position of the amino acid sequence shown in SEQ ID NO: 19 in the obtained mutant. Residues can be 220/320/245/278th and so on. Further, for example, a sequence having 400 amino acid residues has high homology or sequence identity with positions 20-420 of the amino acid sequence set forth in SEQ ID NO: 19, as shown by SEQ ID NO: 19 in the resulting variant. The residue corresponding to position 222/322/247/280 of the amino acid sequence can be position 202/302/227/260.
In a specific embodiment, the homology or sequence identity may be 80% or more, preferably 90% or more, more preferably 95% to 98%, and most preferably 99% or more.

Methods of measuring sequence homology or identity well known to those of skill in the art are Molecular Biology, Lesk, AM Editing, Oxford University Press, New York, 1988, Biocomputing: Information Science and Genome Projects. (Biocomputing: Informatics and Genome Projects), Smith, DW Editing, Academic Press, New York, 1993, Computer Analysis of Sequence Data, Part I, Griffin, AM and Griffin, HG Editing, Humana Press , New Jersey, 1994, Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987 and Sequence Analysis Primer, Gribskov, M. and Devereux, J. M Stockton Press, New York, 1991 and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988), but not limited to these. A preferred method of identity measurement is to obtain the maximum match between the sequences being measured. Identity measurement methods are built into publicly available computer programs. Computer programs suitable for measuring identity between two sequences include the GCG Program Pack (Devereux, J. et al., 1984), BLASTP, BLASTN and FASTA (Altschul, S, F. et al., 1990), although Not limited to these. The public can obtain BLASTX programs from NCBI and other resources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md.20894, Altschul, S. et al., 1990). The well-known Smith Waterman method can also be used to measure identity.

Unless otherwise stated, the ginsenosides and sapogenins described herein are ginsenosides and sapogenins in which the C20 position is the S and / or R configuration.
As used herein, "isolated polypeptide" means that the polypeptide is substantially free of other proteins, lipids, sugars or other substances associated with it. One of ordinary skill in the art can purify the polypeptide by standard protein purification techniques. Substantially pure polypeptides show a single main band on non-reducing polyacrylamide gels. The purity of the polypeptide can also be further analyzed by amino acid sequence.
The active polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptides of the invention may be naturally purified products, chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, plants) by recombinant techniques. Depending on the host used in the recombinant production process, the polypeptides of the invention may be glycosylated or non-glycosylated. In addition, the polypeptide of the present invention may or may not contain an initiating methionine residue.

The present invention further includes fragments, derivatives and analogs of said polypeptides. As used herein, the terms "fragment,""derivative," and "analog" are polypeptides that maintain substantially the same biological function or activity as said polypeptide.
Fragments, derivatives and analogs of the polypeptides of the invention may also be (i) polypeptides substituted with one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues). Often, the substituted amino acid residue may or may not be encoded by a genetic code, or (ii) a polypeptide having a substituent on one or more amino acid residues, or (iii). It may be a polypeptide in which a mature polypeptide is fused with another compound (eg, a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) a polypeptide in which an additional amino acid sequence is fused to this polypeptide (i v). For example, a leader sequence or a secretory sequence or a sequence for purifying this polypeptide or a protein precursor sequence, or a fusion protein formed with an antigen IgG fragment) may be used. Based on the disclosure herein, these fragments, derivatives and analogs are within the range known to those of skill in the art.
The active polypeptide of the present invention has glycosyltransferase activity and can catalyze one or more of the following reactions.

The above-mentioned polypeptide is a polypeptide whose sequence is SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 or a derivative thereof, and the term further indicates the same function as the polypeptide shown. Includes a variant of the sequence of SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41. The mode of these mutations is the deletion of one or more amino acids (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10). Includes insertions and / or substitutions, and the addition of one or more (usually no more than 20, preferably no more than 10, more preferably no more than 5) amino acids to the C-terminus and / or N-terminus. Not limited to. For example, in the art, substitutions with amino acids of similar or similar function usually do not alter the function of the protein. Also, the addition of one or more amino acids to the C-terminus and / or N-terminus usually does not alter the function of the protein. The term further includes active fragments and derivatives of the proteins of the invention. The present invention also provides analogs of the polypeptide. The difference between these analogs and the natural polypeptide may be a difference in amino acid sequence, a difference in modified form that does not affect the sequence, or both. These polypeptides include native or induced variants. Induced variants are obtained by a variety of techniques, such as random mutations by radiation or exposure to mutagens, as well as site-specific mutations or other known molecular biology techniques. Analogs further include analogs with residues different from natural L-amino acids (eg D-amino acids) and analogs with unnatural or synthetic amino acids (eg β, γ-amino acids). Of course, the polypeptides of the invention are not limited to the representative polypeptides listed above.

Modified (usually unchanged primary structure) forms include chemically induced forms of the polypeptide inside or outside the body, such as acetylation or carboxylation. Modifications also include glycosylation modifications, such as polypeptides that have undergone glycosylation modification in the synthesis and processing of the polypeptide or in the process of further processing. Such modifications are completed by exposing the polypeptide to an enzyme that glucosylates (eg, a mammalian glycosylation or deglycosylation enzyme). The modified form further comprises a sequence having a phosphorylated amino acid residue (eg, tyrosine phosphate, serine phosphate, threonine phosphate). Further, it contains a polypeptide having improved antiprotease hydrolyzability or a polypeptide having improved solubility by modification.
One or more polypeptide fragments at the amino-terminus or carboxy-terminus of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or derivatives of the present invention It may be included as a protein tag. Any suitable tag can be used in the present invention. For example, the tags may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE, and Ty1. These tags can be used for purification of proteins. Table 1 shows some of the tags and their sequences.

table 1

Of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide so that the translated protein is secreted (eg, extracellularly secreted). A signal peptide sequence, such as a pelB signal peptide, may be added to the amino end of the amino acid. The signal peptide may be excised during the process of secreting the polypeptide from the cell.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA morphology includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The sequence of the coding region encoding the mature polypeptide may be similar to or reduced from the sequence of the coding region set forth in SEQ ID NO: 3, SEQ ID NO: 22, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40 or SEQ ID NO: 42. It may be a variant. As used herein, the "degenerate variant" in the present invention refers to the amino acid sequences set forth in SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41. It encodes a polypeptide having, or a derivative thereof, the coding sequence of SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41 or a derivative polypeptide thereof, preferably SEQ ID NO: 3. The nucleic acid sequence is different from the sequence shown in SEQ ID NO: 22, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40 or SEQ ID NO: 42. The polynucleotide encoding the mature polypeptide of the polypeptide set forth in SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 or a derivative thereof, encodes only the mature polypeptide. Contains coding sequences to be used, coding sequences of mature polypeptides and various additional coding sequences, coding sequences of mature polypeptides (and any additional coding sequences) and non-coding sequences.

The term "polynucleotide encoding a polypeptide" may be a polynucleotide encoding this polypeptide, as well as a polynucleotide comprising an additional coding and / or non-coding sequence.
The present invention further relates to a polypeptide having the same amino acid sequence as the present invention or a variant of the above polynucleotide encoding a fragment, analog or derivative of the polypeptide. The variant of this polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but is a substantially encoding polypeptide. It does not change the function.

The invention further relates to polynucleotides that hybridize to the above sequences and have at least 50%, preferably at least 70%, more preferably at least 80% homology between the two sequences. The present invention particularly relates to a polynucleotide that can hybridize with a polynucleotide according to the present invention under strict conditions. In the present invention, "strict conditions" refer to (1) low ionic strength and high temperature, for example, 0.2 × SSC, 0.1% SDS, hybridization and elution at 60 ° C, or (2) denaturing agent during hybridization. For example, 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, etc. at 42 ° C can be added, or (3) homology between the two sequences is at least 90%, preferably 95% or more. It is to hybridize only at the time of. And the polypeptide encoded by the hybridizable polynucleotide has the same biological function and the same biological function as the mature polypeptide set forth in SEQ ID NO: 4, SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41. Has activity.

The present invention further relates to nucleic acid fragments that hybridize to the above sequences. As used herein, the length of a "nucleic acid fragment" is at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides or more. including. Nucleic acid fragments are used in nucleic acid amplification techniques (eg, PCR) to contain polynucleotides encoding Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivatives thereof. Can be identified and / or isolated.
The polypeptides and polynucleotides in the present invention are preferably provided in isolated form and more preferably homogeneously purified.

The nucleotide full-length sequence or fragment of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or derivative thereof of the present invention is usually used by PCR amplification, recombination or Obtained by an artificial synthesis method. For the PCR amplification method, primers are designed according to the related nucleotide sequences published in the present invention, particularly the reading frame, and a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art is used as a template. Amplify to obtain the relevant sequence. If the sequence is long, it is usually necessary to perform two or more PCR amplifications and then connect the fragments obtained from each amplification in the correct order.
If the related sequence is obtained, a large amount of the related sequence can be obtained by the recombination method. In this case, usually, the sequence is cloned into a vector, introduced into cells, and the related sequence is isolated and obtained from a host cell grown by a usual method.
Further, especially when the length of the fragment is short, the related sequence may be synthesized by an artificial synthesis method. Usually, by first synthesizing a large number of small fragments and then concatenating them, a long fragment of the sequence can be obtained.

Currently, all DNA sequences encoding the proteins of the invention (or fragments thereof, or derivatives thereof) can already be obtained by chemical synthesis. Furthermore, this DNA sequence may be introduced into various known DNA molecules (or vectors, etc.) and cells well known in the art. Mutations can also be introduced into the protein sequences of the invention by chemical synthesis.
In order to obtain the gene of the present invention, a method of amplifying DNA / RNA by PCR technique is preferably used. Especially when it is difficult to obtain the full-length cDNA from the library, the RACE method (RACE-cDNA terminal rapid amplification method) is preferably used, and the primers used for PCR are based on the sequence information of the present invention published here. It can be properly selected and synthesized in the usual way. DNA / RNA fragments amplified by conventional methods, such as gel electrophoresis, can be isolated and purified.

The present invention relates to a vector containing the polynucleotide of the present invention, and a coding sequence of the vector of the present invention or a Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative polypeptide thereof. It also relates to a host cell produced by genetic engineering and a method of producing a polypeptide according to the present invention by a recombinant technique.
Recombinant Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivative polypeptides thereof can be obtained using the polynucleotide sequences of the present invention by conventional recombinant DNA techniques. Can be expressed or produced. In general, it involves the following steps:
(1) The polynucleotide (or variant) encoding the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide of the present invention is used or this. Recombinant expression vectors containing polynucleotides are used to transform or transduce appropriate host cells;
(2) Cultivate the host cells in an appropriate medium;
(3) Isolate and purify the protein from the medium or cells.
In the present invention, the polynucleotide sequence encoding the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative polypeptide thereof may be inserted into a recombinant expression vector. The term "recombinant expression vector" is a well-known bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian virus such as adenovirus, retrovirus or other vector in the art. Any plasmid or vector can be used as long as it can be stably replicated in the host body. One of the key features of an expression vector is usually that it contains an origin of replication, a promoter, a marker gene and a translational control element.

For those skilled in the art to construct expression vectors containing the coding DNA sequences of Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivatives thereof and appropriate transcription / translation control signals. Well-known methods can be used. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology and the like. The DNA sequence can be effectively linked to the appropriate promoter in the expression vector to direct mRNA synthesis. Typical examples of these promoters are the lac or trp promoter of Escherichia coli, the PL promoter of λ phage, the pre-CMV early promoter, the HSV thymidin kinase promoter, the eukaryotic promoter including the early and late SV40 promoters, the retrovirus LTRs and others. A promoter expressed in a prokaryotic or eukaryotic cell of a known controllable gene or its virus. The expression vector further comprises a translation initiation ribosome binding site and a transcription terminator.

The expression vector also preferably contains one or more selectable marker genes and traits for selecting transformed host cells such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance and green. Provides resistance to fluorescent protein (GFP), or tetracycline or ampicillin for E. coli.
A vector containing the appropriate DNA sequence and the appropriate promoter or control sequence described above can transform the appropriate host cell to express the protein.
The host cell may be a prokaryotic cell, such as a bacterial cell, or a lower eukaryotic cell, such as a yeast cell, or a higher eukaryotic cell, such as a mammalian cell. Typical examples are Escherichia coli, Streptomyces, bacterial cells such as bacterium Streptomyces, fungal cells such as yeast, plant cells, insect cells such as Mibae S2 or Sf9, CHO, COS, 293 cells or Bowes melanoma cells. There are such animal cells.

When the polynucleotide of the invention is expressed in higher eukaryotic cells, insertion of the enhancer sequence into the vector enhances transcription. Enhancers are cis-elements of DNA that act on promoters to enhance gene transcription, typically at about 10-300 bp. Examples include 100-270 bp SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.
Those of skill in the art will be well aware of how to select the appropriate vector, promoter, enhancer and host cell.

Transformation of host cells by DNA recombination may be performed by ordinary techniques familiar to those skilled in the art. If the host is a prokaryotic cell, such as E. coli, competent cells capable of absorbing DNA can be collected after the exponential growth phase, treated with the CaCl ₂ method, and the steps used are well known in the art. Another method is to use MgCl ₂ . If necessary, the transformation may be an electroporation method. If the host is a eukaryote, calcium phosphate precipitation, microinjection, conventional mechanical methods such as electroporation, and DNA transfection methods such as lipofection are used.
The resulting transformant can be cultured in a conventional manner to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, a normal medium may be selected as the medium used for culturing. Incubate under conditions suitable for the growth of host cells. Once the host cells have grown to the appropriate cell density, the promoter of choice is induced by the appropriate method (eg, temperature conversion or chemical induction) and the cells are further cultured.

The recombinant polypeptide in the above method can be expressed intracellularly or at the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various isolation methods by utilizing its physical / chemical properties and other properties. These methods are familiar to engineers in this field. Examples of these methods are conventional regeneration treatment, treatment with protein precipitant (salting method), centrifugation, osmotic shock, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange. Includes, but is not limited to, chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques, as well as combinations of these methods.

Applications The active polypeptide or glycosyltransferase Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptides according to the present invention are specifically and efficiently used. Includes, but is not limited to, catalyzing the transfer of glycosyl groups from sugar donors to the hydroxyl group at the C-3 position of tetracyclotriterpene compounds. In particular, the compound of formula (I) can be converted to the compound of formula (II), for example, protopanaxadiol PPD can be converted to rare ginsenoside Rh2 having better antitumor activity, and Compound K can be converted to ginsenoside F2.

The above-mentioned tetracyclotriterpene compounds include, but are limited to, S- or R-arranged dammarane-type, lanostane-type, tilcalan-type, cycloaltan-type, apotylcalan-type, cucurbitane-type, and meliacan-type tetracyclotriterpene-based compounds. Not done.
The present invention is an industrial catalytic method that uses Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivative polypeptides thereof under conditions that provide a sugar donor. , Ginsenoside Rh2 and Ginsenoside F2 are provided. Specifically, the polypeptide used in the above reaction (A) is the polypeptide represented by SEQ ID NO: 4 or SEQ ID NO: 21 or a derivative polypeptide thereof, and the polypeptide used in the above reaction (B) is. , The polypeptide set forth in SEQ ID NO: 4 or a derivative thereof.

In one preferred example of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the glycosyltransferase Pn50 of Panax notoginseng and the glycosyltransferase mutant protein 8E7.
In one preferred example of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the mutant protein Pn50-Q222H-VE of the glycosyltransferase Pn50 of Panax notoginseng.
In one preferred example of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the mutant protein UGT-MUT1 of the glycosyltransferase Pn50 of Panax notoginseng.
In one preferred example of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the mutant protein UGT-MUT2 of the glycosyltransferase Pn50 of Panax notoginseng.
In one preferred example of the present invention, there is provided a method for synthesizing ginsenoside Rh2 in Saccharomyces cerevisiae using the mutant protein UGT-MUT3 of the glycosyltransferase Pn50 of Panax notoginseng.

The sugar donor is nucleoside diphosphate sugar, UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetyl. Glucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, UDP-xylose, GDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid , GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-lammonose, It is selected from the group consisting of ADP-ramnorth, TDP-ramnorth, CDP-ramnorth, GDP-ramnorth, or other nucleoside diphosphate hexacarbonate or nucleoside diphosphate pentacarbonate, or a combination thereof.

The sugar donor is preferably uridine diphosphate sugar, UDP-glucose, UDP-xylose, UDP-rhamnose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, or other uridine diphosphate hexacarbonate or It is selected from the group consisting of uridine diphosphate pentacarbonate sugar or a combination thereof.
In the above method, an enzyme activity additive (an additive that improves the enzyme activity or suppresses the enzyme activity) may be further added. The enzyme-active additive may be selected from the group consisting of Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ , or Fe ²⁺ , or It is a substance capable of producing Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ , or Fe ²⁺ .
The pH condition of the method is pH 4.0 to 10.0, preferably pH 6.0 to pH 8.5, and more preferably 8.5.
The temperature condition of the method is 10 ° C to 105 ° C, preferably 25 ° C to 35 ° C, and more preferably 35 ° C.

The present invention also relates to an effective amount of the active polypeptide or glycosyltransferase Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide of the present invention, and foods. The composition comprises a carrier or excipient that is scientifically or industrially acceptable. Such carriers include, but are not limited to, water, buffers, glucose, water, glycerin, ethanol, and combinations thereof.
A substance that regulates the activity of the glycosyltransferase of the present invention may be further added to the above composition. Any substance can be used as long as it has the function of improving the enzyme activity. Preferably, the substance that enhances the activity of the glycosyltransferase of the present invention is selected from mercaptoethanol. In addition, many substances reduce enzyme activity, and when added to Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ and Fe ²⁺ , or substrates, they are hydrolyzed. It includes, but is not limited to, substances capable of forming Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , Ni ²⁺ , Zn ²⁺ and Fe ²⁺ .

After obtaining the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide of the present invention, those skilled in the art can easily use this enzyme for gluconosylation. In particular, it can exert a gluconosyllation effect on dammarene diol and protopanaxadiol. As a preferred embodiment of the present invention, two methods for forming a rare ginsenoside are provided, one of which is Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT- according to the present invention. It comprises treating a substrate that is glycosylated with a MUT3 polypeptide or a derivative polypeptide thereof, wherein the substrate comprises a tetracyclotriterpene compound such as dammalendiol, protopanaxadiol and its derivatives. Preferably, the substrate to be glycosylated with the above-mentioned Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative polypeptide thereof is treated under the condition of pH 3.5 to 10. do. Preferably, the substrate to be glycosylated with the above-mentioned Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative polypeptide thereof is treated at a temperature of 30 to 105 ° C. do.

The other is to synthesize protopanaxadiol PPD from the genes of Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide according to the present invention. Genes of Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivatives thereof Is co-expressed in host cells (eg, yeast cells or E. coli) with key genes in the synthetic metabolic pathways of dammarene diol, protopanaxadiol and any other glycosyltransferase gene, and is directly rare ginsenoside Rh2 and / or F2. Includes obtaining recombinant bacteria to produce. Alternatively, the coding nucleotide sequence of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative polypeptide thereof can be sequenced into a synthetic metabolic pathway for dammarene diol and / or protopanaxadiol PPD. It is co-expressed in host cells with the key enzyme in and with any other gluconosylase and key enzyme that synthesizes UDP-ramnose, and is used to construct recombinant strains that artificially synthesize rare ginsenoside Rh2 and ginsenoside F2.

The key genes in the above-mentioned synthetic metabolic pathway of danmalendiol include, but are not limited to, the danmalendiol synthase gene.
In another preferred example, the key genes in the synthetic metabolic pathway of protopanaxadiol are the dammarene diol synthase gene PgDDS, the cytochrome P450 gene CYP716A47 for protopanaxadiol synthesis and their reductase genes, or their reductase genes. Including, but not limited to, combinations. Alternatively, it is an isotope of each of the above enzymes and a combination thereof. Here, the dammarene diol synthase converts oxidosqualene (synthesized by Saccharomyces cerevisiae itself) to dammaren diol, and cytochrome P450 CYP716A47 and its reductase further convert dammaren diol to protopanaxadiol PPD. (Han et al., Plant & cell physiology, 2011, 52.2062-73)

The main advantages of the present invention are as follows.
(1) The method for producing ginsenoside Rh2 using the budding yeast of the present invention has advantages such as low cost, short cycle, and stable quality as compared with the conventional method of extracting Panax japonicus and hydrolyzing glycosyl groups. be.
(2) In the present invention, the glycosyltransferase Pn50 obtained from Panax notoginseng for the first time can catalyze the synthesis of Rh2 from PPD and the synthesis of F2 from CK, and when it is introduced into a PPD-producing strain, Panax notoginseng Rare ginsenoside Rh2 can be synthesized more efficiently than the wild-type glycosyltransferase UGTPg45 in.
(3) In the present invention, when the mutant gene 8E7 obtained by randomly mutating the wild-type glycosyltransferase UGTPg45 in Otaneninjin or the Sancitininjin glycosyltransferase Pn50 is introduced into a PPD-producing strain, the wild-type in Otaneninjin is introduced. Compared with the glycosyltransferase UGTPg45, the synthesis efficiency of the rare ginsenoside Rh2 can be significantly improved.
(4) The present invention uses PPD for mutant genes Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, and UGT-MUT3 obtained by randomly mutating the wild-type gluconosylase Pn50 in sancithininjin. When introduced into a production strain, the synthesis efficiency of rare ginsenoside Rh2 can be significantly improved as compared with the wild-type gluconosylase Pn50 in sancithininjin.

Hereinafter, the present invention will be further described with reference to specific examples. It is understood that these examples are used only to illustrate the invention and do not limit the scope of the invention. Experimental methods for which specific conditions are not shown in the following examples are usually described, for example, in Sambrook et al., "Molecular Cloning: Laboratory Manual" (New York, Cold Spring Harbor Laboratory Publishing Co., Ltd., 1989). Follow the normal conditions, such as the conditions of, or the conditions recommended by the manufacturer. Unless otherwise noted,% and parts were calculated by weight.

The specific implementation process of the present invention is further understood by the following specific implementation methods.

Example 1. Cloning of Panax notoginseng glycotransferase gene Pn50 For example, two primers were synthesized: sequence Pn50 cloning primer F, SEQ ID NO: 1 (ATGGAGAGAGAAATGTTGAGCA) and Pn50 cloning primer R, SEQ ID NO: 2 (TCAGGAGGAAACAAGCTTTGAA). PCR was performed using the cDNA obtained by reverse transcription of RNA extracted from Panax notoginseng as a template and the above-mentioned primers. As the DNA polymerase, Takara Bio Inc.'s highly accurate KOD DNA polymerase was used. The PCR amplification program was a total of 35 cycles of 94 ° C for 2 min, 94 ° C for 15s, 58 ° C for 30s, and 68 ° C for 2 min, and the temperature was lowered to 10 ° C at 68 ° C for 10 min. The PCR product was detected by agarose gel electrophoresis and the results are shown in Figure 1.

The target DNA band was cut off by irradiation with ultraviolet rays. Furthermore, DNA, that is, a DNA fragment of the amplified glycosyltransferase gene, was recovered from the agarose gel using the Axygen Gel Extraction Kit (AEYGEN). The recovered PCR product was cloned into a PMDT vector using the PMD18-T cloning kit from Bao Biology Engineering Co., Ltd. (Takara), and the constructed vector was named PMDT-Pn50. Sequencing gave the Pn50 gene sequence.
The Pn50 gene has the nucleotide sequence of SEQ ID NO: 3. The 1st to 1368th nucleotides from the 5'end of SEQ ID NO: 3 are the Pn50 reading frame (ORF), and the 1st to 3rd nucleotides from the 5'end of SEQ ID NO: 3 are the start codon ATG of the Pn50 gene. , The 1366 to 1368th nucleotide from the 5'end of SEQ ID NO: 3 is the stop codon TGA of the Pn50 gene. The glycosyltransferase Pn50 gene encodes a protein Pn50 containing 455 amino acids, has an amino acid residue sequence of SEQ ID NO: 4, and when the theoretical molecular weight of this protein was predicted by software, the isoelectric point pI was 51.1 kDa. Is 5.10. Positions 332 to 375 from the amino terminus of SEQ ID NO: 4 are conservative functional regions of the glycosyltransferase PSPG.

Nucleotide sequence of Pn50 SEQ ID NO: 3

Amino acid sequence of Pn50 SEQ ID NO: 4

Example 2. Expression of the Panax notoginseng glycosyltransferase gene Pn50 in E. coli For example, two primers were synthesized: sequence Pn50 expression primer F, SEQ ID NO: 5 (GGATCCATGGAGAGAGAAATGTTGAGCA) and Pn50 expression primer R, and SEQ ID NO: 6 (CTCGAGTCAGGAGGAAACAAGCTTTGAA). PCR was performed using cDNA extracted from plants as a template by inserting two enzyme cleavage sites, BamH I and Xho I, into the synthesized primer F / R, respectively. As the DNA polymerase, Takara Bio Inc.'s highly accurate KOD DNA polymerase was used. The PCR amplification program was a total of 35 cycles of 94 ° C for 2 min, 94 ° C for 15s, 58 ° C for 30s, and 68 ° C for 2 min, and the temperature was lowered to 10 ° C at 68 ° C for 10 min. PCR products were detected by agarose gel electrophoresis. The target DNA band was cut off by irradiation with ultraviolet rays. Furthermore, DNA, that is, a DNA fragment of the amplified glycosyltransferase gene, was recovered from the agarose gel using the Axygen Gel Extraction Kit (AEYGEN). The two recovered PCR products were enzymatically cleaved with BamH I and Xho I, then ligated to pET28a, which was also enzymatically cleaved with BamH I and Xho I, and E. coli EPI300-sensitive cells were transformed and transformed with the ligation product. The Escherichia coli solution was applied to an LB plate containing 50 μg / mL of canamycin, and the recombinant clone was further verified by PCR and enzymatic cleavage. After selecting one clone from each clone and extracting the recombinant plasmid, it is verified by sequencing, and when it is confirmed to be accurate, Escherichia coli BL21 (DE3) is transformed with the recombinant plasmid to induce expression and expression. To induce E. coli, select a single clone from a plate, inoculate it into an LB test tube containing 50 μg / mL of canamycin, incubate overnight, take 1%, inoculate it into a 50 mL plasmid, and inject it into a 50 mL plasmid flask with 0.6 OD600 at 37 ° C. The cells were cultured until the temperature reached ~ 0.7, and IPTG having a final concentration of 0.1 mM was added to induce the cells, and the cells were induced at 18 ° C. for 16 hours. Collect the cells at 12000 g, 3 min, add 10 mL of PBS buffer per 1 g of wet weight of the cells and resuspend, then decompose the cells, remove the supernatant by centrifugation, and use the crude enzyme solution. did.

Example 3. Detection of catalysts and products of reactions of different substrates by Panax notoginseng glycosyltransferase gene Pn50 A glycosyltransferase Pn50 catalytic reaction system (100 μL) was prepared as follows.

The reaction was carried out in a water bath at 37 ° C for 2 hours. After completion of the reaction, an equal volume of n-butanol was added and extracted, the n-butanol phase was taken, and after vacuum concentration, the reaction product was dissolved in 10 μL of methanol, and the result was detected by TLC or HPLC. From the results in FIG. 2, the glycosyltransferase Pn50 used in the present invention can catalyze the protopanaxadiol PPD to form a new product (see formula A for the reaction), and the position of movement on the TLC plate is It was found to be consistent with the movement position of Rh2, proving that this new product is ginsenoside Rh2. In addition, Pn50 can catalyze Compound K, and the product produced was speculated to be ginsenoside F2 based on the position of migration on the TLC plate and the region specificity of Pn50 (Fig. 2).

Example 4. Synthesis of rare ginsenoside Rh2 in Saccharomyces cerevisiae by the glycosyltransferase gene Pn50 derived from Sancithininjin (1) The glycosyltransferase gene Pn50 derived from Sancithininjin is rare by catalyzing the glucosylation of the hydroxyl group at the C3 position of protopanaxadiol. In order to be able to synthesize ginsenoside Rh2 and realize the synthesis of rare ginsenoside Rh2 in Saccharomyces cerevisiae, the present invention first constructed a budding yeast basal cell that produces protopanaxadiol. 2,3-Epoxysqualene synthesized by the mevalonic acid pathway of Saccharomyces cerevisiae itself by introducing the dammalendiol synthase gene PgDDS, the cytochrome P450 gene CYP716A47 for protopanaxadiol synthesis and its reductase gene PgCPR1 into wild-type budding yeast. Can synthesize danmalendiol at. Saccharomyces cerevisiae ZWBY04RS produces high yields of protopanaxadiol by optimizing artificially constructed protopanaxadiol synthetic pathways, including optimization of rate-determining steps in synthesis, optimization of precursor supply, etc. Got

(2) For example, 12 primers of SEQ ID NOs: 7 to 18 were synthesized, and a promoter for glycosyltransferase expression, a terminator, an ORF, a screening marker, and an upstream / downstream homology arm fragment were obtained by the PCR method, and the PCR method was an example. Same as 1. After uniformly mixing 100 ng each of the above PCR fragment and ORF of UGTPg45, recombinant Saccharomyces cerevisiae strain ZWBY04RS was transformed by the usual method of transforming Saccharomyces cerevisiae ZWBY04RS-UGTPg45. rice field. Similarly, 100 ng of each of the above PCR fragment and Pn50 ORF was uniformly mixed, and then the recombinant Saccharomyces cerevisiae strain ZWBY04RS was transformed by the usual method of transforming Saccharomyces cerevisiae ZWBY04RS-. Obtained Pn50.

(3) Preparation of solid medium: Medium: 1% Yeast Extract (yeast extract), 2% Peptone (peptone), 2% Dextrose (dextrose) (glucose), 2% agar powder were prepared.
Preparation of liquid medium: Medium: 1% Yeast Extract, 2% Peptone, and 2% Dextrose (glucose) were prepared.
Take the recombinant budding yeasts ZWBY04RS-UGTPg45 and ZWBY04RS-Pn50 drawn on a solid medium plate, place them in a test tube containing 5 mL of liquid medium, and incubate them with shaking overnight (30 ° C, 250 rpm, 16 h) and centrifuge. The cells were collected in 1 and transferred to a 50 mL Erlenmeyer flask containing a 10 mL liquid medium, adjusted to an OD600 of 0.05, and cultured at 30 ° C. and 250 rpm for 4 days with shaking to obtain a fermented product. This method provided one parallel experiment for each recombinant yeast at the same time.

Extraction and detection of protopanaxadiol and rare ginsenoside Rh2: Absorb 100 μL of fermented liquid from 10 mL of fermented liquid, shake with Fastprep to decompose yeast, add equal volume of n-butanol for extraction, and then vacuum. The n-butanol was evaporated under the conditions of. After dissolving in 100 μL of methanol, the production amount of the target product was detected by HPLC. The HPLC results are shown in Figure 3.
Rare ginsenoside Rh2 can be synthesized by introducing the recombinant Saccharomyces cerevisiae strain ZWBY04RS-UGTPg45 constructed by the glycosyltransferase gene UGTPg45 derived from Otaneninjin into the Saccharomyces cerevisiae producing protopanaxadiol, and the production amount is 35.66. It was mg / L. Rare ginsenoside Rh2 can be synthesized by introducing the recombinant Saccharomyces cerevisiae strain ZWBY04RS-Pn50 constructed by the glycosyltransferase gene Pn50 derived from Sansitininjin into the Saccharomyces cerevisiae producing protopanaxadiol, and its production amount. Was 45.55 mg / L.

Example 5. Construction of random mutation library of glycosyltransferase UGTPg45 derived from Otaneninjin Using the plasmid UGTPg45-pMD18T as a template, UGTPg45 random mutation primer F SEQ ID NO: 23 (Gcatagcaatctaatctaagttttaattacaaaatggagagagaaatgtg) Error prone PCR was performed using the mutation SEQ ID NO: 24 (Gaaaagaagataatatttttatataattataatctcaggaggaaacaagctttgaa) as a primer, and the program was pre-denatured at 95 ° C for 2 min, denatured for 30 s at 95 ° C, annealed at 58 ° C for 30 s, and extended for 3 min at 72 ° C for 30 cycles. The final elongation was performed at 72 ° C for 10 min. According to the instructions of the kit, 1ug, 1.5 μg, and 2 μg templates were put in and the mutation rate was sought. The gel was cut out to recover the PCR product, A was added with Taq enzyme, and the gel was ligated to the vector pMD18T to transform Escherichia coli TOP10. Ten positive clones were randomly selected and sequenced, and the mutation rate was 1 to 2 bases, and the amount of the template corresponding to the gene was 1.5 μg. In subsequent experiments, the conditions were subjected to error-prone PCR, i.e., a random mutation library of UGTPg45 was constructed.

Primer SEQ ID NO: 25 (Fragment 7 Primer F) (Acactggggcaataggctgtcgccattcaagagcagatagcttcaaaatgtttctactc) and SEQ ID NO: 26 (Fragment 7 Primer R) (Cataatgtgagttttgctcaacatttctctctccattttgtaattaaaacttagattag) Fragment 8 Primer F) (Ttgatgagttcatttcaaagcttgtttcctcctgagattaatataattatataaaaata) and SEQ ID NO: 28 (Fragment 8 Primer R) (Actgtcaaggagggtattctgggcctccatgtcgctgctatataacagttgaaatttgg) Cccaaagctaagagtcccattttattc) and SEQ ID NO: 30 (Fragment 9 Primer R) (Gaagagtaaaaaaggagtagaaacattttgaagctatctgctcttgaatggcgacagcc), SEQ ID NO: 31 (Fragment 10 Primer F) (Tgtcgattcgatactaacgccgccatccagtgtcgagaattacaatagttgg) Fragments 9 and 10 were obtained. Primer SEQ ID NO: 33 (Fragment 11 Primer F) (Aagatgttcttatccaaatttcaactgttatatagcagcgacatggaggcccagaatac) and SEQ ID NO: 34 (Fragment 11 Primer R) (tacttcttgcagacatcagacatactattgtaattctcgacactggatggcggcgttag) were used to obtain the plasmid PLKAN. The above fragments 7 to 11 are mixed at an equimolar ratio, PPD high-producing strain ZWBY04RS is transformed, and applied to a YPD plate (containing 100 μg / ml G418) to obtain a yeast transformant expressing the UGTPg45 mutant gene. The cells were cultured at 30 ° C. for 2 days. Similarly, wild-type UGTPg45 was transformed to construct a yeast transformant and used as a control.

600 μL / well of YPD medium (containing 100 μg / mL G418) was placed in a 96-well plate, a single clone of yeast was selected, inoculated into the medium, and cultured with shaking at 30 ° C. and 280 rpm for 1 day. 6 μL of culture was transferred to a new 96-well plate containing 600 μL of YPD medium and cultured with shaking at 30 ° C. and 280 rpm for 3 days. 600 μL of n-butanol was added to each well, the mixture was sealed with a rubber stopper, and the mixture was rotated to extract for 3 hours. Centrifugation was performed at 4000 rpm for 10 min, 150 μL of n-butanol phase was aspirated and placed in a new 96-well plate, and the product was measured by HPLC.
The Rh2 production of the rare ginsenoside Rh2 strain ZWBY04RS-8E7 constructed with the mutant gene 8E7 increased by 70% from the production of the strain ZWBY04RS-UGTPg45 constructed with UGTPg45, reaching 60.48 mg / L.

The wild-type gene UGTPg45 has the nucleotide sequence of SEQ ID NO: 20. The 5'-1374th nucleotide from the 5'end of SEQ ID NO: 20 is the reading frame of UGTPg45, and the 1st to 3rd nucleotide from the 5'end of SEQ ID NO: 20 is the start codon ATG of the UGTPg45 gene, 5'of SEQ ID NO: 20. The 1371 to 1374th nucleotide from the end is the stop codon TGA of the UGTPg45 gene. The glycosyltransferase UGTPg45 gene encodes a protein UGTPg45 containing 457 amino acids, has an amino acid residue sequence of SEQ ID NO: 19, and when the theoretical molecular weight of this protein was predicted by software, the isoelectric point pI was 51.1 kDa. Is 5.10. Positions 332 to 375 from the amino terminus of SEQ ID NO: 19 are conservative functional regions of the glycosyltransferase PSPG.
Amino acid sequence of UGTPg45 SEQ ID NO: 19

Nucleotide sequence of UGTPg45 SEQ ID NO: 20

The mutant gene 8E7 has the nucleotide sequence of SEQ ID NO: 22. The 5'-1374th nucleotide from the 5'end of SEQ ID NO: 22 is the reading frame of 8E7, and the 1st to 3rd nucleotide from the 5'end of SEQ ID NO: 22 is the start codon ATG of the 8E7 gene, 5'of SEQ ID NO: 22. The 1371 to 1374th nucleotide from the end is the stop codon TGA of the 8E7 gene. The glycosyltransferase gene 8E7 encodes a protein 8E7 containing 457 amino acids and has the amino acid residue sequence of SEQ ID NO: 21.
Amino acid sequence of 8E7 SEQ ID NO: 21

8E7 Nucleotide Sequence SEQ ID NO: 22

From the above results, in the present invention, instead of the glycosyltransferase gene UGTPg45 derived from Otaneninjin, a mutant gene obtained by modifying the glycosyltransferase gene Pn50 derived from Sancithininjin or the wild-type glycosyltransferase gene is used. Then, it was shown that all of them significantly improved the synthesis efficiency and the production amount of the rare ginsenoside Rh2, and had a remarkable beneficial effect.

Example 6. Synthesis of Rh2 in sprouting yeast by glycosyltransferase mutant gene Pn50-Q222H-VE of Sanshitininjin Pn50 The inventor mutated amino acid residue Q at position 222 of Pn50 to H, and at the same time at positions 322 and 323 of Pn50. The amino acid residue of Pn50 was deleted and the VE of two amino acids was inserted after the 321st to obtain the mutant Pn50-Q222H-VE of Pn50.
(1) For example, 12 primers of SEQ ID NOs: 7 to 18 were synthesized, and a promoter for glycosyltransferase expression, a terminator, an ORF, a screening marker, and an upstream / downstream homology arm fragment were obtained by a PCR method, and the PCR method was an example. Same as 1. After uniformly mixing 100 ng each of the above PCR fragment and ORF of Pn50-Q222H-VE uniformly, the recombinant Saccharomyces cerevisiae strain ZWBY04RS was transformed by the usual method of transforming Saccharomyces cerevisiae ZWBY04RS. -I got a QE.

(2) Take the recombinant budding yeast ZWBY04RS-QE drawn on a solid medium plate, place it in a test tube containing 5 mL of liquid medium, shake and culture overnight (30 ° C, 250 rpm, 16 h), and centrifuge. The cells were collected, transferred to a 50 mL Erlenmeyer flask containing 10 mL of liquid medium, adjusted to an OD600 of 0.05, and cultured with shaking at 30 ° C. and 250 rpm for 4 days to obtain a fermented product. This method provided one parallel experiment for each recombinant yeast at the same time.
Extraction and detection of protopanaxadiol and rare ginsenoside Rh2: Absorb 100 μL of fermented liquid from 10 mL of fermented liquid, shake with Fastprep to decompose yeast, add equal volume of n-butanol for extraction, and then vacuum. The n-butanol was evaporated under the conditions of. After dissolving in 100 μL of methanol, the production amount of the target product was detected by HPLC.
Rare ginsenoside Rh2 can be synthesized by introducing the recombinant Saccharomyces cerevisiae strain ZWBY04RS-QE constructed by the glycosyltransferase gene Pn50-Q222H-VE derived from Sanshitininjin into the Saccharomyces cerevisiae producing protopanaxadiol. The production volume was 59.09 mg / L (Fig. 4).

Amino acid sequence of Pn50-Q222H-VE SEQ ID NO: 41

Nucleic acid sequence of Pn50-Q222H-VE SEQ ID NO: 42

Example 7. Synthesis of Rh2 in sprouting yeast by the glucotransferase mutant genes UGT-MUT1, UGT-MUT2 and UGT-MUT3 Saturation mutation of N resulted in three catalytically efficient mutants, UGT-MUT1, UGT-MUT2 and UGT-MUT3. UGT-MUT1 has the 280th amino acid residue K of Pn50-Q222H-VE as the amino acid residue I, and UGT-MUT2 has the 247th amino acid residue N of Pn50-Q222H-VE as the amino acid residue S, UGT- MUT3 mutated the 280th amino acid residue K of Pn50-Q222H-VE to the amino acid residue I and the 247th amino acid residue N to the amino acid residue S.

(1) For example, 12 primers of SEQ ID NOs: 7 to 18 were synthesized, and a promoter for glycosyltransferase expression, a terminator, an ORF, a screening marker, and an upstream / downstream homology arm fragment were obtained by a PCR method, and the PCR method was an example. Same as 1. Uniform 100 ng each of the above PCR fragments and ORF of UGT-MUT1 (Pn50-Q222H-VE-K280I), UGT-MUT2 (Pn50-Q222H-VE-N247S) and UGT-MUT3 (Pn50-Q222H-VE-K280I-N247S). After mixing with Saccharomyces cerevisiae, the recombinant Saccharomyces cerevisiae strain ZWBY04RS was transformed by the usual method of transforming Saccharomyces cerevisiae to obtain ZWBY04RS-MUT1, ZWBY04RS-MUT2 and ZWBY04RS-MUT3.

(2) Take the recombinant budding yeasts ZWBY04RS-MUT1, ZWBY04RS-MUT2 and ZWBY04RS-MUT3 drawn on a solid medium plate, place them in a test tube containing 5 mL of liquid medium, and incubate them overnight with shaking (30 ° C). , 250 rpm, 16 h), centrifuge, collect cells, transfer to a 50 mL Erlenmeyer flask containing 10 mL liquid medium, adjust to an OD600 of 0.05, shake and culture at 30 ° C, 250 rpm for 4 days to fermented product. Got This method provided one parallel experiment for each recombinant yeast at the same time.
Extraction and detection of protopanaxadiol and rare ginsenoside Rh2: Absorb 100 μL of fermented liquid from 10 mL of fermented liquid, shake with Fastprep to decompose yeast, add equal volume of n-butanol for extraction, and then vacuum. The n-butanol was evaporated under the conditions of. After dissolving in 100 μL of methanol, the production amount of the target product was detected by HPLC. The HPLC results are shown in Figure 4.

Rare ginsenoside Rh2 can be synthesized by introducing the recombinant Saccharomyces cerevisiae strain ZWBY04RS-MUT1 constructed by the glycosyltransferase gene UGT-MUT1 derived from Sansitininjin into the Saccharomyces cerevisiae producing protopanaxadiol. The production was 67.96 mg / L. Rare ginsenoside Rh2 can be synthesized by introducing the recombinant Saccharomyces cerevisiae strain ZWBY04RS-MUT2 constructed by the glycosyltransferase gene UGT-MUT2 derived from Sansitininjin into the Saccharomyces cerevisiae producing protopanaxadiol. The production was 78.29 mg / L. Rare ginsenoside Rh2 can be synthesized by introducing the recombinant Saccharomyces cerevisiae strain ZWBY04RS-MUT3 constructed by the glycosyltransferase gene UGT-MUT3 derived from Sansitininjin into the Saccharomyces cerevisiae producing protopanaxadiol. The production was 83.53 mg / L.

Amino acid sequence of glycosyltransferase mutant gene UGT-MUT1 SEQ ID NO: 35

Nucleotide sequence of glycosyltransferase mutant gene UGT-MUT1 SEQ ID NO: 36

Amino acid sequence of glycosyltransferase mutant gene UGT-MUT2 SEQ ID NO: 37

Nucleotide sequence of glycosyltransferase mutant gene UGT-MUT2 SEQ ID NO: 38

Amino acid sequence of glycosyltransferase mutant gene UGT-MUT3 SEQ ID NO: 39

Nucleotide sequence of glycosyltransferase mutant gene UGT-MUT3 SEQ ID NO: 40

Study Currently, by transcriptome analysis of Panax notoginseng, Panax notoginseng and American ginseng, researchers have already found a large number of candidate genes for glycosyltransferases, but only a very small number of glycosyltransferases participate in the synthesis of ginsenosides. Was not demonstrated. Glycosyltransferases involved in the synthesis of ginsenosides in Panax notoginseng have not yet been reported. Since similar ginsenosides are synthesized in Panax notoginseng, searching for glycosyltransferases derived from Panax notoginseng will help us to better understand the synthetic pathways of ginsenosides in these two plants, and at the same time, the synthetic biology of ginsenosides. It is very meaningful to be able to provide a full range of tools through this research.

All documents relating to the present invention are cited as references in this application, just as each document is cited independently. Further, after reading the above contents of the present invention, those skilled in the art may make various variations and modifications to the present invention, but those equivalent forms thereof are included in the claims of the present invention. Should be understood.

Claims (13)

An isolated polypeptide
(1) The 222nd amino acid residue of the amino acid sequence shown by SEQ ID NO: 19 is other than Gln, and the 322nd amino acid residue of the amino acid sequence shown by SEQ ID NO: 19 is other than Ala. Or (2) the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 41 in the amino acid sequence is other than Asn (N), and / or 280 of the amino acid sequence represented by SEQ ID NO: 41. The second corresponding amino acid residue is other than Lys (K),
here,
His is the amino acid residue corresponding to position 222 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide;
The amino acid residue corresponding to position 322 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Val.
Ser (S ) is the amino acid residue corresponding to position 247 of the amino acid sequence represented by SEQ ID NO: 41 in the amino acid sequence of the isolated polypeptide;
The 280th amino acid residue of the amino acid sequence represented by SEQ ID NO: 41 in the amino acid sequence of the isolated polypeptide is Ile (I ) .
The polypeptide. An isolated polypeptide, the following:
(A) A polypeptide having the amino acid sequence set forth in SEQ ID NO: 21, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39 or SEQ ID NO: 41 ; and
(C) A polypeptide containing the polypeptide sequence according to (a).
The polypeptide selected from the group consisting of . An isolated polynucleotide, which is:
(A) Nucleotide sequence encoding the polypeptide according to claim 1 or 2;
(B) Nucleotide sequence encoding the polypeptide set forth in SEQ ID NO: 21;
(C) Nucleotide sequence represented by SEQ ID NO: 22, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40 or SEQ ID NO: 42 ; and complementary to the nucleotide sequence set forth in any of (F) (A) to (C) . The polynucleotide selected from the group consisting of various nucleotide sequences. A vector comprising the polynucleotide according to claim 3. The use of the isolated polypeptide according to claim 1 or 2, wherein the use is used to catalyze the following reaction or to produce a catalytic formulation that catalyzes the following reaction:
(I) A reaction that transfers a glycosyl group from a sugar donor to the hydroxyl group at the C-3 position of a tetracyclotriterpene compound. The use according to claim 5, wherein the isolated polypeptide is used to catalyze the following reaction or to produce a catalytic formulation that catalyzes the following reaction.

In the formula, R1 is H or OH, R2 is H or OH, R3 is an H or glycosyl group, and R4 is a glycosyl group. A method of glycosylation in vitro
In the presence of a glycosyltransferase, the glycosylation group from a sugar donor is transferred to the hydroxyl group at the C-3 position of the tetracyclotriterpene compound to form a glycosylated tetracyclotriterpene compound.
Here, the method, wherein the glycosyltransferase is the polypeptide according to claim 1 or 2. The method according to claim 7, wherein the activity of the glycosyltransferase is an activity of transferring the glycosyl group of a sugar donor to the hydroxyl group at the C-3 position of a tetracyclotriterpene-based compound. A method for carrying out a glycosyl-catalyzed reaction, which comprises a step of carrying out a glycosyl-catalyzed reaction in the presence of the polypeptide according to claim 1 or 2. The method of claim 9, wherein the substrate for the glycosyl-catalyzed reaction is a compound of formula (I) and the product of the reaction is a compound of formula (II).

In the formula, R1 is H or OH, R2 is H or OH, R3 is an H or glycosyl group, and R4 is a glycosyl group. A genetically engineered host cell comprising the vector according to claim 4 or having the polynucleotide according to claim 3 integrated into the genome. The use of the host cell according to claim 11, which is used for the production of an enzyme-catalyzed reagent, the production of a glycosyltransferase, or the production of a catalytic cell or a glycosylated tetracyclotriterpene-based compound. The method for producing a genetically modified plant, which comprises the step of regenerating the genetically engineered host cell according to claim 11 to a plant, wherein the genetically engineered host cell is a plant cell.

Images