KR102418138B1 - Glycosyltransferases, mutants and applications thereof - Google Patents

Abstract

The present invention relates to glycosyltransferases, mutants and applications thereof. Specifically, in the presence of a glycosyltransferase, the glycosyl group of the glycosyl group donor is transferred to the hydroxyl group of the C-3 site of the tetracyclic triterpenoid compound; forming a glycosylated tetracyclic triterpenoid-based compound; wherein the glycosyltransferase is a glycosyltransferase represented by SEQ ID NO.: 4 or an inducible polypeptide thereof; or a glycosyltransferase represented by SEQ ID NO.: 21 or an in vitro glycosylation method thereof.

Description

Glycosyltransferases, mutants and applications thereof

FIELD OF THE INVENTION The present invention relates to the fields of biological technology and plant biology, and in particular, the present invention relates to glycosyltransferases, glycosyltransferase mutants and applications thereof for use in the synthesis of the ginsenoside Rh2.

Ginsenosides are major chemical substances in the genus Araliaceae (eg, ginseng, ginseng, western ginseng, etc.). Currently, at least 100 kinds of saponins have been isolated from plants such as ginseng and ginseng, and ginsenosides belong to triterpenoid saponins. Here, it was identified that some ginsenosides have a wide range of physiological functions and medicinal values, including functions such as anti-tumor, immunomodulatory, anti-fatigue, cardioprotective, hepatoprotective, and the like. Here, various saponins have been used clinically, for example, the drug Shenyi Capsule containing ginsenoside Rg3 monomer as a main ingredient can improve the symptoms of giheo of cancer speakers, and improve the immune function of the organism. make it Shenyi capsules (Jinxing capsules) with ginsenoside Rh2 monomer as the main ingredient is a dietary supplement used to enhance the immunity of the organism and improve disease resistance.

Structurally, ginsenosides are small biologically active molecules formed by glycosylation of sapogenin. There are several limited to sapogenin of ginsenoside, mainly dammarane-type protopanoxadiol and protopanoxadiol, and oleanane-type aroma resin. Besides differences in sapogenins, structural differences between ginsenosides are mainly reflected in the different glycosylation modifications of sapogenins. The sugar chain of ginsenoside is generally bonded to a C3, C6, or C20 hydroxyl group of sapogenin, and the glycosyl group is glucose, rhamnose, xylose, and arabinose. ) can be

Different glycosyl group binding sites, sugar chain composition and length allow ginsenosides to have the greatest difference in physiological function and medicinal value. For example, ginsenoside Rb1, ginsenoside Rd and ginsenoside Rc all use protopanoxadiol as a saponin of sapogenin, and the difference between them is only a difference in glycosyl group modification, but the difference between them is There are many differences in physiological function. Rb1 has a function of stabilizing the central neuronal system, but Rc's function is a function of suppressing the central neuronal system.

Rare ginsenosides are saponins with very low ginseng content. Ginsenoside Rh2 (3-O-β-(D-glucopyanosyl)-20(S)-protopanaxadiol) belongs to the saponins of the protopanaxadiol family, and has one A glucosyl group is linked. Although the content of ginsenoside Rh2 is only about 1/10,000 of the dry weight of ginseng, ginsenoside Rh2 has excellent anti-tumor properties, is one of the most important anti-tumor active ingredients in ginseng, and inhibits tumor cell growth It can induce tumor cell death and resist tumor metastasis. According to the study results, ginsenoside Rh2 was shown to be able to inhibit the proliferation of lung cancer cells 3LL (mice), Morris liver cancer cells (rats), B-16 melanoma cells (mice), and HeLa cells (human). . In clinical practice, ginsenoside Rh2 can be used in combination with radiation therapy or chemotherapy to increase the effect of radiation therapy and chemotherapy. In addition, ginsenoside Rh2 also has an anti-allergic effect, improves organism immunity, and inhibits inflammation caused by NO and PGE.

The function of glycosyltransferase is transferred to a glycosyl acceptor different from the glycosyl group of a glycosyl group donor (Nucleoside diphosphate sugar, for example UDP-glucose). Due to their different amino acid sequences, there are currently 94 families of glycosyltransferases. In the currently sequenced plant genome, over 100 different glycosyltransferases have been found. Glycosyl receptors of such glycosyltransferases include sugars, lipids, proteins, nucleic acids, antibiotics and other small molecules. Glycosyltransferase involved in saponin glycosylation in ginseng plays a role in transferring the glycosyl group of the glycosyl group donor to the hydroxyl group of sapogenin or C3, C6 or C20 of aglycone to form saponins with different medicinal value. .

At present, there is a lack of effective methods for generating the rare ginsenoside Rh2 and ginsenoside F2 in the art, so it is urgent to develop various specific and highly efficient glycosyltransferases.

An object of the present invention is to provide a glycosyltransferase for synthesizing rare ginsenoside Rh2 and ginsenoside F2, and uses thereof.

In a first aspect of the invention there is provided an isolated polypeptide,

(1) the amino acid residue at site 222, in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19, is not Gin, and/or the amino acid sequence shown in SEQ ID NO: 19 the amino acid residue at site 322 corresponding to Ala is not;

(2) the amino acid residue at site 247, wherein the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19, is not Asn (N), and/or as shown in SEQ ID NO: 19 The amino acid residue at the 280th site corresponding to the amino acid sequence is not Lys(K).

In another preferred embodiment, the isolated polypeptide comprises:

i). has the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at site 222 is not Gln, and/or the amino acid residue at site 322 is not Ala, or

ii). One or a plurality of amino acid residues in the sequence defined in i), preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most It is an isolated polypeptide derived from i), preferably having a sequence formed by the substitution, deletion or addition of one amino acid residue, generally having the isolated polypeptide function defined in i).

In another preferred embodiment, the isolated polypeptide comprises:

i). has the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at site 247 is not Asn(N), and/or the amino acid residue at site 280 is not Lys(K), or

ii). One or a plurality of amino acid residues in the sequence defined in i), preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most It is an isolated polypeptide derived from i), preferably having a sequence formed by the substitution, deletion or addition of one amino acid residue, generally having the isolated polypeptide function defined in i).

In another preferred embodiment, said isolated polypeptide comprises one or more amino acid residues, preferably 1-20, more preferably 1-15, more preferably 1-10 amino acid residues in the sequence defined in i), even more preferably an isolated polypeptide derived from i) having a sequence formed by substitution, deletion or addition of 1 to 3, most preferably 1 amino acid residue, generally having the isolated polypeptide function defined in i) .

In another preferred embodiment, the amino acid residue at site 222, in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19, is selected from at least one of His, Asn, Gin, Lys and Arg. is chosen

In another preferred embodiment, the amino acid residue at the 222 position in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19 is His.

In another preferred embodiment, the amino acid residue at position 322, in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19, is selected from at least one of Val, Ile, Leu, Met and Phe. is chosen

In another preferred embodiment, the amino acid residue at the 322 position corresponding to the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Val.

In another preferred embodiment, the amino acid residue at position 222 in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19 is His, and corresponds to the amino acid sequence shown in SEQ ID NO: 19 The amino acid residue at site 322 to be used is Val.

In another preferred embodiment, the amino acid residue at site 247, in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19, is Ser(S), Pro(P), Ala(A) or at least one amino acid of Thr(T).

In another preferred embodiment, the amino acid residue at site 247 in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Ser(S).

In another preferred embodiment, the amino acid residue at position 280, in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19, is Ile(I), Asn(N), Ser(S) or at least one amino acid of Alan (A).

In another preferred embodiment, the amino acid residue at position 280 in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Ile(I).

In another preferred embodiment, the amino acid residue at site 247 in which the amino acid sequence of the isolated polypeptide corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Ser (S), and the amino acid shown in SEQ ID NO: 19 The amino acid residue at site 280 corresponding to the sequence is Ile(I).

In another preferred embodiment, the isolated polypeptide comprises:

iii). has the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at site 222 is not Gln, and/or the amino acid residue at site 322 is not Ala, or

iv). One or more amino acid residues in the sequence defined in iii), preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most It is an isolated polypeptide derived from iii), preferably having a sequence formed by the substitution, deletion or addition of one amino acid residue, generally having the isolated polypeptide function defined in iii).

In another preferred embodiment, the isolated polypeptide comprises:

iii). has the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at site 247 is not Asn(N), and/or the amino acid residue at site 280 is not Lys(K), or

iv). One or more amino acid residues in the sequence defined in iii), preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most It is an isolated polypeptide derived from iii), preferably having a sequence formed by the substitution, deletion or addition of one amino acid residue, generally having the isolated polypeptide function defined in iii).

In another preferred embodiment, the isolated polypeptide comprises one or more amino acid residues in the sequence defined in iii), preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably having a sequence formed by the substitution, deletion or addition of 1 to 3 amino acid residues, most preferably 1 amino acid residue, generally having the isolated polypeptide function defined in iii) and is an isolated polypeptide derived from iii) .

In another preferred embodiment, the amino acid residue at position 222 of the amino acid sequence of the amino acid sequence of the isolated polypeptide is represented by SEQ ID NO: 19 is selected from at least one of His, Asn, Gln, Lys and Arg. .

In another preferred embodiment, the amino acid residue at position 222 of the amino acid sequence of the isolated polypeptide is represented by SEQ ID NO: 19 is His.

In another preferred embodiment, the amino acid residue at position 322 of the amino acid sequence of the amino acid sequence of the isolated polypeptide is represented by SEQ ID NO: 19 is selected from at least one of Val, Ile, Leu, Met and Phe. .

In another preferred embodiment, the amino acid residue at position 322 of the amino acid sequence of the isolated polypeptide is shown in SEQ ID NO: 19 is Val.

In another preferred embodiment, the amino acid residue at position 222 of the amino acid sequence of the amino acid sequence shown in SEQ ID NO: 19 of the isolated polypeptide is His, and the amino acid residue at position 322 of the amino acid sequence shown in SEQ ID NO: 19 The amino acid residue in is Val.

In another preferred embodiment, the amino acid residue at position 247 of the amino acid sequence, wherein the amino acid sequence of the isolated polypeptide is represented by SEQ ID NO: 19 is Ser(S), Pro(P), Ala(A) or Thr( T) at least one amino acid.

In another preferred embodiment, the amino acid residue at position 247 of the amino acid sequence of the amino acid sequence of the isolated polypeptide is represented by SEQ ID NO: 19 is Ser(S).

In another preferred embodiment, the amino acid residue at position 280 of the amino acid sequence shown in SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ile(I), Asn(N), Ser(S) or Alan(A) ) is selected from at least one amino acid.

In another preferred embodiment, the amino acid residue at position 280 of the amino acid sequence of the isolated polypeptide is shown in SEQ ID NO: 19 is Ile(I).

In another preferred embodiment, the amino acid residue at position 247 of the amino acid sequence represented by SEQ ID NO: 19 in the amino acid sequence of the isolated polypeptide is Ser (S), and the amino acid sequence represented by SEQ ID NO: 19 The amino acid residue at site 280 is Ile(I).

In another preferred embodiment, the isolated polypeptide is a glycosyltransferase.

In another preferred embodiment, the glycosyltransferase is derived from a plant of the genus Ginseng.

In another preferred embodiment, the glycosyltransferase is derived from ginseng, western ginseng and/or ginseng.

In another preferred embodiment, the polypeptide comprises:

(a) the amino acid sequence represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 a polypeptide having;

(b) of the amino acid sequence represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 One or more amino acids in the polypeptide, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most preferably 1 amino acid inducible polypeptides formed by substituting, deleting or adding residues or formed after addition of a signal peptide sequence and having glycosyltransferase activity;

(c) an inducible polypeptide comprising a polypeptide sequence according to (a) or (b) in its sequence;

(d) the amino acid sequence is represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 has ≥85% (preferably ≥90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) homology to the amino acid sequence and contains glycosyl inducing polypeptides having transferase activity.

In another preferred embodiment, the sequence (c) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a) or (b).

In another preferred embodiment, the glycosyltransferase activity refers to an activity capable of transferring the glycosyl group of a glycosyl group donor to the hydroxyl group of the C-3 site of tetracyclic triterpenoids compounds. .

In another preferred embodiment, the glycosyltransferase may improve the acid content of ginsenoside Rh2 and/or ginsenoside F2.

In another preferred example, in the artificially constructed strain, the glycosyltransferase can improve the acid content of the ginsenoside Rh2; preferably 5 to 150%; more preferably, 10 to 100% improvement; more preferably, 20 to 80% improvement; Most preferably, it improves by 28 to 70%.

In another preferred embodiment, the artificially constructed strain is selected from a budding yeast strain, an E. coli strain, a Pichia pastoris strain, a fission yeast strain, and a Kluyveromyces strain.

In the second aspect of the present invention, there is provided an isolated polynucleotide, wherein the polynucleotide comprises:

(A) a nucleotide sequence encoding a polypeptide according to the first aspect of the present invention;

(B) a nucleotide sequence encoding a polypeptide represented by SEQ ID NO.: 4 or SEQ ID NO.: 21 or a derived polypeptide thereof;

(C) a nucleotide sequence represented by SEQ ID NO.: 3 SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42;

(D) SEQ ID NO.: 3 with the sequence represented by SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 and >90 % (preferably ≥ 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 % or 99 %) homology of nucleotide sequences;

(E) 5 of the nucleotide sequence represented by SEQ ID NO.: 3 SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 a nucleotide sequence formed by cutting or adding 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides at the 'end and/or 3' end;

(F) a nucleotide sequence complementary to the nucleotide sequence according to any one of (A) to (E).

In a third aspect of the present invention, there is provided a carrier, wherein the carrier contains the polynucleotide according to the second aspect of the present invention.

In another preferred embodiment, the transporter comprises an expression transporter, a shuttle transporter, and an integrated transporter.

In a fourth aspect of the invention there is provided the use of an isolated polypeptide according to the first aspect of the invention,

(i) catalyzing the reaction of transferring a glycosyl group derived from a glycosyl group donor to the hydroxyl group of the C-3 site of tetracyclic triterpenoids compounds, or catalyzing the following reaction used in the preparation of catalyst formulations for

In another preferred embodiment, the glycosyl group donor is UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP-acetylglucose , GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose, UDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP- Galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP-arabinose , CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rhamnose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose or other nucleoside diphosphate hexose or nucleoside diphosphate a nucleoside diphosphate sugar selected from pentose, or a combination thereof.

In another preferred embodiment, the glycosyl group donor is UDP-glucose, UDP-xylose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-rhamnose, or other pyridinediphosphate hexose or pyridinedi a pyridinediphosphate (UDP) sugar selected from phosphatepentose, or a combination thereof.

In another preferred embodiment, the isolated polypeptide catalyzes the reaction or is used in the preparation of a catalyst formulation for catalyzing the reaction.

Formula (I) compound Formula (II) compound;

wherein R 1 is H or OH; R2 is H or OH; R3 is H or a glycosyl group; R4 is a glycosyl group.

In another preferred embodiment, the isolated polypeptide catalyzes or is used in the preparation of a catalyst formulation for catalyzing a reaction.

The polypeptide is a polypeptide represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 or a polypeptide thereof inducible polypeptides.

In another preferred embodiment, the glycosyl group is a glucosyl group, a galacturonic acid group, a xylose glycosyl group, a galactosyl group, an arabinosyl group. group), a rhamnosyl group, and other hexosyl groups or pentosyl groups.

In another preferred embodiment, the reaction product of the reactions (A) and/or (B) is a dammaran-type tetracyclic triterpenoid compound of S configuration or R configuration, and a tetracyclic tree of Lanolin type. Terpenoid compounds, apotirucallane type tetracyclic triterpenoids, Tirucallanes type tetracyclic triterpenoid compounds, cycloartane type tetracy and a click triterpenoid compound, a Cucurbitane type tetracyclic triterpenoid compound, or a meliacan (Decane) type tetracyclic triterpenoid compound (but not limited thereto).

In a fifth aspect of the present invention, there is provided a method for in vitro glycosylation,

Transferring the glycosyl group of the glycosyl group donor to the hydroxyl group at the C-3 site of the tetracyclic triterpenoid compound in the presence of a glycosyltransferase to form a glycosylated tetracyclic triterpenoid compound do;

Herein, the glycosyltransferase is a polypeptide according to the first aspect of the present invention or a derived polypeptide thereof.

In another preferred embodiment, the inducing polypeptide comprises:

one polypeptide in the amino acid sequence represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41; an inducible polypeptide formed by substituting, deleting or adding a plurality of amino acid residues, or formed after addition of a signal peptide sequence, and having glycosyltransferase activity; or

the amino acid sequence is ≥ 85% with the amino acid sequence of SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 (preferably ≥ 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) of homology and induction with glycosyltransferase activity polypeptides;

Here, the glycosyltransferase activity refers to an activity capable of transferring the glycosyl group of the glycosyl group donor to the hydroxyl group of the C-3 site of the tetracyclic triterpenoid compound.

In a sixth aspect of the present invention, there is provided a method for performing a lycosyl catalyzed reaction comprising performing a glycosyl catalyzed reaction in the presence of a polypeptide according to the first aspect of the present invention or a derived polypeptide thereof.

In another preferred embodiment, the method comprises:

The method further comprises converting the compound of formula (I) into the compound of formula (II) in the presence of a glycosyl group donor and the polypeptide according to the first aspect of the present invention or a derived polypeptide thereof.

In another preferred embodiment, the compound of formula (I) is protophanoxadiol PPD, and the compound of formula (II) is the ginsenoside Rh2; or

The compound of formula (I) is compound K (Compound K), and the compound of formula (II) is ginsenoside F2.

In another preferred embodiment, the method comprises the steps of adding each of the polypeptide and its derivative polypeptide to a catalytic reaction; and/or

The method further comprises the step of simultaneously adding the polypeptide and its derivative polypeptide to the catalytic reaction.

In another preferred embodiment, the method comprises a nucleotide sequence encoding a glycosyltransferase in a host cell with a key gene and/or other glycosyltransferase gene in the damarendiol and/or protopanoxadiol metabolic pathway. It further comprises the step of co-expressing to obtain the compound of formula (II).

In another preferred embodiment, the compound of formula (II) is ginsenoside Rh2 or ginsenoside F2.

In another preferred embodiment, the host cell is yeast or Escherichia coli.

In another preferred embodiment, the method further comprises providing an additive for regulating enzyme activity to the reaction system.

In another preferred embodiment, the additive for regulating enzyme activity is an additive for enhancing enzyme activity or inhibiting enzyme activity.

In another preferred embodiment, the additive for regulating enzyme activity is ^selected from ^{Ca 2+ , Co 2+ , Mn 2+ , Ba 2+ , Al 3+ , Ni 2+ , Zn 2+} or Fe ²⁺ .

In another preferred embodiment, the additive for regulating enzyme activity may ^produce a material of ^{Ca 2+ , Co 2+ , Mn 2+ , Ba 2+ , Al 3+ , Ni 2+ , Zn 2+} or Fe ²⁺ . .

In another preferred embodiment, the glycosyl group donor is a nucleoside diphosphate sugar, UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP -Acetylglucose, CDP-acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, GDP-xylose, UDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP -arabinose, TDP-arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rhamnose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose or other nucleoside diphosphate hexose or nucleoside diphosphate pentose or combinations thereof.

In another preferred embodiment, the glycosyl group donor is a pyridinediphosphate sugar, UDP-glucose, UDP-xylose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose, UDP-rhamnose or other pyridinediphosphate hexose or pyridinediphosphatepentose or combinations thereof.

In another preferred embodiment, the pH of the reaction system is pH4.0 to 10.0, preferably, the pH is 5.5 to 9.0.

In another preferred embodiment, the temperature of the reaction regime is between 10 and 105 °C, preferably between 20 and 50 °C.

In another preferred embodiment, the key gene in the damarendiol metabolic pathway includes (but is not limited to) a damarendiol synthase gene.

In another preferred embodiment, the key genes in the protopanoxadiol metabolic pathway include a damarendiol synthase gene, a cytochrome P450 gene CYP716A47 synthesized from protopanoxadiol, and an exchange enzyme gene thereof, or a combination thereof. (but not limited to).

In another preferred embodiment, the substrate of the glycosyl group catalyzed reaction is a compound of formula (I), and the product is a compound of formula (II).

In another preferred embodiment, the compound of formula (I) is protophanoxadiol PPD, and the compound of formula (II) is the ginsenoside Rh2; or

The compound of formula (I) is compound K, and the compound of formula (II) is ginsenoside F2.

In a seventh aspect of the present invention, there is provided a genetically engineered host cell, wherein the host cell contains the carrier according to the third aspect of the present invention, or in its genome the polynucleotide according to the second aspect of the present invention are integrated

In another preferred embodiment, the glycosyltransferase is a polypeptide according to the first aspect of the present invention or a derived polypeptide thereof.

In another preferred embodiment, the nucleotide sequence encoding the glycosyltransferase is as described in the second aspect of the present invention.

In another preferred embodiment, the cell is a prokaryotic cell or a eukaryotic cell.

In another preferred embodiment, the host cell is a eukaryotic cell such as a yeast cell or a plant cell.

In another preferred embodiment, the host cell is a budding yeast cell.

In another preferred embodiment, the host cell is a prokaryotic cell such as E. coli.

In another preferred embodiment, the host cell is a ginseng cell.

In another preferred embodiment, the host cell is a cell that does not naturally produce the compound of formula (II).

In another preferred embodiment, the host cell is a cell that does not naturally produce ginsenoside Rh2 or ginsenoside F2.

In another preferred embodiment, the key gene in the damarendiol metabolic pathway includes (but is not limited to) a damarendiol synthase gene.

In another preferred embodiment, the host cell contains a key gene in the protopanoxadiol metabolic pathway, a damarendiol synthase gene, a cytochrome P450 gene CYP716A47 synthesized from protopanoxadiol, and a reductase gene thereof, or combinations thereof include (but are not limited to).

In an eighth aspect of the present invention there is provided the use of a host cell according to the seventh aspect, for preparing an enzyme catalytic reagent, for producing a glycosyltransferase, for use as a catalyst cell, or for a glycosylated tetracyclic tree It is to produce a terpenoid-based compound.

In another preferred embodiment, the tetracyclic triterpenoid compound is a compound of formula (II).

In another preferred embodiment, the host cell is used to produce a compound of formula (II) by glycosylation of a compound of formula (I).

In another preferred embodiment, the host cell is used to produce ginsenoside Rh2 and/or ginsenoside F2 by glycosylation of protopanoxadiol PPD and/or compound K.

In a ninth aspect of the present invention, there is provided a method for producing a genetically modified plant comprising the step of regenerating a genetically engineered host cell according to the seventh aspect of the present invention into a plant, wherein said genetically engineered host cell is a plant cell. provided.

In another preferred embodiment, the genetically engineered host cell is selected from a ginseng cell, a Korean ginseng cell, a ginseng cell, and a tobacco cell.

Within the scope of the present invention, it should be understood that each of the above technical features and each technical feature specifically described in the following (eg, embodiments) of the present invention can be combined with each other to constitute a new or preferred technical solution. . Due to the limitation of the side width, it will not be described in detail here.

(1) The method for producing ginsenoside Rh2 using the budding yeast of the present invention is cheaper, has a shorter cycle, and has lower quality than the traditional method relying on extraction and glycosyl hydrolysis of phosphate plants. It has advantages such as stable;

(2) The present invention can catalyze the glycosyltransferases Pn50 PPD and Rh2 obtained from Sachil for the first time, and catalyzes CK to synthesize F2, which in ginseng produced PPD than the wild-type glycosyltransferase UGTPg45. Introduction into the producing strain can more efficiently synthesize the rare ginsenoside Rh2;

(3) In the present invention, wild-type glycosyltransferase UGTPg45 is randomly mutated in ginseng to obtain mutant gene 8E7 or Samchil glycosyltransferase gene Pn50, and this is added to a strain that produces PPD than wild-type glycosyltransferase UGTPg45 in ginseng. introduction can significantly improve the rare ginsenoside Rh2 synthesis efficiency;

(4) In the present invention, wild-type glycosyltransferase Pn50 is randomly mutated in Samchil to obtain mutant genes Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3, and wild-type glycosyltransferase in Samchil It is possible to significantly improve the synthesis efficiency of the rare ginsenoside Rh2 by introducing it into a strain producing PPD rather than the Rase Pn50.

1 is a glycosyltransferase gene Pn50 agarose gel electrophoresis diagram.
Figure 2 is a glycosyltransferase gene Pn50 catalyst ginsenoside TLC analysis diagram.
3 is an HPLC analysis diagram of the rare ginsenoside Rh2 produced by constructing a recombinant budding yeast strain constructed using Pn50.
4 is a comparative analysis of the fermentation products of the rare ginsenoside Rh2 produced by recombinant budding yeast strains constructed using the Pn50 protein mutants Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2 and UGT-MUT3. indicates.

The present inventors, through extensive and in-depth research, for the first time, the terpene-based compound glycosylation catalyst and the ginseng-derived glycosyltransferase Pn50 (SEQ ID NO.: 4) and the glycosyltransferase UGTPg45 in novel saponin synthesis. Mutant 8E7 (SEQ ID NO.: 21), mutant Pn50-Q222H-VE (SEQ ID NO.: 41), UGT-MUT1 (SEQ_ID_NO.35), UGT-MUT2 (SEQ_ID_NO. 37) and UGT-MUT3 (SEQ_ID_NO.39).

Specifically, the glycosyltransferase of the present invention catalyzes a tetracyclic triterpenoid compound substrate-specific and efficiently and/or a glycosyl group derived from a glycosyl group donor C-3 of a tetracyclic triterpenoid compound. It can be transferred to the hydroxyl group of the site. In particular, protophanoxadiol PPD can be efficiently converted into a rare ginsenoside Rh2 with anti-tumor activity, and a rare ginsenoside compound K (with one glycosyl group modification at the C20 site of PPD) is produced as a product ginsenoside. Switch to side F2. Surprisingly, the rare ginsenoside Rh2 can be synthesized with the recombinant budding yeast strain ZWBY04RS-Pn50 constructed by introducing the glycosyltransferase gene Pn50 derived from Samchil into the budding yeast strain producing protophanoxadiol, and wild-type Compared to strain ZWBY04RS-UGTPg45 introduced with ginseng-derived glycosyltransferase gene UGTPg45, the acid content of strain ZWBY04RS-Pn50 ginsenoside Rh2 was improved by 28% (45.55/35.66 - 1 = 28%); The Rh2 output of the artificial synthetic rare ginsenoside Rh2 strain ZWBY04RS-8E7 constructed with the mutant gene 8E7 obtained by improving UGTPg45 by random mutation was 70% (60.48/35.66 - 1) than that of the strain ZWBY04RS-UGTPg45 constructed with UGTPg45. = 70%) was improved. In the artificially synthetic rare ginsenoside Rh2 strain ZWBY04RS-QE constructed by Pn50-Q222H-VE by improving Pn50 by site-directed mutagenesis to obtain the mutant gene Pn50-Q222H-VE, and Pn50-Q222H-VE, its Rh2 acid content was determined by UGTPg45 It was improved by 66% (59.09/35.66 - 1 = 66%) than the constructed strain ZWBY04RS-UGTPg45 acid. Pn50-Q222H-VE was further improved by site-directed mutagenesis to obtain a mutant UGT-MUT1 gene, and in the artificial synthetic rare ginsenoside Rh2 strain ZWBY04RS-MUT1 constructed by UGT-MUT1, its Rh2 acid content was in UGTPg45 It was improved by 90% (67.96/35.66 - 1 = 90%) than the acid amount of the strain ZWBY04RS-UGTPg45 constructed by Pn50-Q222H-VE was further improved by site-directed mutagenesis to obtain a mutant UGT-MUT2 gene, and in the artificial synthetic rare ginsenoside Rh2 strain ZWBY04RS-MUT2 constructed by UGT-MUT2, its Rh2 acid content was It was improved by 120% (78.29/35.66-1=120%) than the acid amount of the strain ZWBY04RS-UGTPg45 constructed by Pn50-Q222H-VE was further improved by site-directed mutagenesis to obtain a mutant UGT-MUT3 gene, and in artificial synthetic rare ginsenoside Rh2 strain ZWBY04RS-MUT3 constructed by UGT-MUT3, its Rh2 acid content was It was improved by 134% (83.53/35.66-1=134%) than the acid amount of the strain ZWBY04RS-UGTPg45 constructed by

The present invention further provides transformation and catalytic methods. The glycosyltransferase of the present invention is a key enzyme in the damarendiol and/or protopanoxadiol synthesis metabolic pathway (for example, the damarendiol synthase gene PgDDS, the cytochrome P450 gene CYP716A47 synthesized from protopanoxadiol, and It can be co-expressed in host cells with its reductase gene PgCPR1). Or applied to genetically engineered cells producing ginsenoside Rh2, and applied to strains constructing artificial rare ginsenoside Rh2.

In addition, the glycosyltransferase of the present invention can be co-expressed in host cells with enzymes that are key in the damarendiol and/or protopanoxadiol synthesis metabolic pathway, and can be used to construct the artificial synthetic rare ginsenoside Rh2. applied to strains. Based on this, the present invention was completed.

Justice

As used herein, the terms “active polypeptide”, “polypeptide of the invention and its derivatives”, “enzyme of the invention”, “glycosyltransferase” or “glycosyltransferase of the invention” are interchangeable are available and have the meanings commonly understood by one of ordinary skill in the art. The glycosyltransferase of the present invention has an activity of transferring the glycosyl group of the glycosyl group donor to the hydroxyl group of the C-3 site of the tetracyclic triterpenoid compound.

In one preferred embodiment of the present invention, the amino acid residue at the 222 position corresponding to the amino acid sequence of the glycosyltransferase of the present invention is not Gln, and/or SEQ ID NO: 19 The amino acid residue at site 322 corresponding to the amino acid sequence represented by ID NO: 19 is not Ala.

In one preferred embodiment of the present invention, the glycosyltransferase of the present invention comprises:

i). has the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at site 222 is not Gln, and/or the amino acid residue at site 322 is not Ala, or

ii). One or a plurality of amino acid residues in the sequence defined in i), preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most It is an isolated polypeptide derived from i), preferably having a sequence formed by the substitution, deletion or addition of one amino acid residue, generally having the isolated polypeptide function defined in i).

In one preferred embodiment of the present invention, the glycosyltransferase of the present invention has one or more amino acid residues in the sequence defined in i), preferably 1 to 20, more preferably 1 to 15, more preferably has a sequence formed by the substitution, deletion or addition of 1 to 10, even more preferably 1 to 3, most preferably 1 amino acid residues, generally having the isolated polypeptide function defined in i) and from i) It is an isolated polypeptide derived.

In one preferred embodiment of the present invention, the amino acid residue at the 222 site, in which the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19, is His, Asn, Gin, Lys and Arg at least one amino acid.

In one preferred embodiment of the present invention, the amino acid residue at the 222 site corresponding to the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19 is His.

In one preferred embodiment of the present invention, the amino acid residue at the 322 site corresponding to the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Val, Ile, Leu, Met and Phe at least one amino acid.

In one preferred embodiment of the present invention, the amino acid residue at the 322 site corresponding to the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Val.

In one preferred example of the present invention, the amino acid residue at the 222 site corresponding to the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19 is His, SEQ ID NO: 19 The amino acid residue at site 322 corresponding to the amino acid sequence is Val.

In one preferred embodiment of the present invention, the amino acid residue at site 247, in which the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19, is not Asn (N) and/or The amino acid residue at position 280 corresponding to the amino acid sequence shown in SEQ ID NO: 19 is not Lys(K).

In one preferred embodiment of the present invention, the glycosyltransferase of the present invention comprises:

i). has the amino acid sequence shown in SEQ ID NO: 19 and the amino acid residue at site 247 is not Asn(N), and/or the amino acid residue at site 280 is not Lys(K), or

ii). One or a plurality of amino acid residues in the sequence defined in i), preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most It is an isolated polypeptide derived from i), preferably having a sequence formed by the substitution, deletion or addition of one amino acid residue, generally having the isolated polypeptide function defined in i).

In one preferred embodiment of the present invention, the glycosyltransferase of the present invention has one or more amino acid residues in the sequence defined in i), preferably 1 to 20, more preferably 1 to 15, more preferably has a sequence formed by the substitution, deletion or addition of 1 to 10, even more preferably 1 to 3, most preferably 1 amino acid residues, generally having the isolated polypeptide function defined in i) and from i) It is an isolated polypeptide derived.

In one preferred embodiment of the present invention, the amino acid residue at site 247, in which the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19, is Ser (S), Pro (P) , at least one amino acid of Ala(A) or Thr(T).

In one preferred embodiment of the present invention, the amino acid residue at site 247, in which the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19, is Ser(S).

In one preferred embodiment of the present invention, the amino acid residue at position 280 corresponding to the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Ile (I), Asn (N) , at least one amino acid of Ser(S) or Ala(A).

In one preferred embodiment of the present invention, the amino acid residue at the 280th position, in which the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19, is Ile(I).

In one preferred embodiment of the present invention, the amino acid residue at site 247 in which the amino acid sequence of the glycosyltransferase of the present invention corresponds to the amino acid sequence shown in SEQ ID NO: 19 is Ser (S), and SEQ ID NO: : The amino acid residue at site 280 corresponding to the amino acid sequence represented by 19 is Ile(I).

In one preferred embodiment of the present invention, the glycosyltransferase of the present invention comprises:

(a) the amino acid sequence represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 a polypeptide having;

(b) of the amino acid sequence represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 One or more amino acids in the polypeptide, preferably 1 to 20, more preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 3, most preferably 1 amino acid inducible polypeptides formed by substituting, deleting or adding residues or formed after addition of a signal peptide sequence and having glycosyltransferase activity;

(c) an inducible polypeptide comprising a polypeptide sequence according to (a) or (b) in its sequence;

(d) the amino acid sequence is represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 has ≥85% (preferably ≥90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) homology to the amino acid sequence and contains glycosyl inducing polypeptides having transferase activity.

In an embodiment of the present invention, the glycosyltransferase activity of the present invention refers to an activity capable of transferring a glycosyl group of a glycosyl group donor to a hydroxyl group at the C-3 site of a tetracyclic triterpenoid compound.

In one preferred example of the present invention, in one novel glycosyltransferase gene Pn50 cloned from Samchil, this novel glycosyltransferase can be used to catalyze the glycosylation of various dammaran-type ginsenoside C3 sites. have.

Through analysis of the three-fold transcriptome data, the full-length glycosyltransferase gene sequence was spliced therefrom and named as Pn50. After cloning this into the cloning delivery system PMDT-18T, the expression primer was designed to be expressed in E. coli and constructed in the E. coli expression delivery system pET28a. The obtained protein can catalyze the hydroxyl glycosylation of the C3 site of compound K with protopanaxadiol.

By replacing UGTPg45 derived from ginseng with the ginseng glycosyltransferase gene Pn50, it is possible to significantly improve the acid content of Rh2 (improved by 28%).

In another preferred embodiment of the present invention, a glycosyltransferase mutant protein 8E7 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene UGTPg45 derived from ginseng, and the mutant glycosyltransferase gene 8E7 can replace UGTPg45 derived from ginseng to greatly improve the production of Rh2 (70). % improvement).

In another preferred embodiment of the present invention, a glycosyltransferase mutant protein Pn50-Q222H-VE is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Samchil, and the wild-type gene UGTPg45 derived from ginseng is replaced with the mutant glycosyltransferase gene Pn50-Q222H-VE to greatly increase the output of Rh2. It can improve (66% improvement).

In another preferred embodiment of the present invention, a glycosyltransferase mutant protein UGT-MUT1 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Samchil, and the mutant glycosyltransferase gene UGT-MUT1 can significantly improve the output of Rh2 with respect to the wild-type gene UGTPg45 derived from ginseng. Yes (90% improvement).

In another preferred embodiment of the present invention, a glycosyltransferase mutant protein UGT-MUT2 is provided. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Samchil, and the mutant glycosyltransferase gene UGT-MUT2 is replaced with the wild-type gene UGTPg45 derived from ginseng to greatly improve the output of Rh2. Can (120% improvement).

In another preferred embodiment of the present invention, the glycosyltransferase mutant protein is provided as UGT-MUT3. The glycosyltransferase mutant protein is a mutant protein of the wild-type gene Pn50 derived from Samchil, and the mutant glycosyltransferase gene UGT-MUT3 is replaced with the wild-type gene UGTPg45 derived from ginseng to greatly improve the output of Rh2. Can (134% improvement).

In some regions of a polypeptide, for example, alterations of a small number of amino acid residues in non-critical regions do not substantially alter the biological activity, e.g., a sequence obtained by appropriately replacing amino acids does not affect its activity It will be apparent to those skilled in the art (see Watson et al., Molecular Biology of The Gene, 4th ed., 1987, The Benjamin/Cummings Pub. Co. P224). Thus, one of ordinary skill in the art can make such substitutions and ensure that the resulting molecule still has the desired biological activity.

Accordingly, in the polypeptide of the present invention, the amino acid residue at the 222 site corresponding to the amino acid sequence represented by SEQ ID NO: 19 is not Gln, and/or the first amino acid residue corresponding to the amino acid sequence represented by SEQ ID NO: 19 Even if the amino acid residue at site 322 is further mutated on a basis other than Ala, the function and activity of the glycosyltransferase of the present invention can be obtained. For example, a glycosyltransferase of the present invention may comprise (a) its amino acid sequence is represented by SEQ ID NO: 21; or (b) one or more amino acid residues in the sequence defined in (a), preferably 1 to 20, more preferably 1 to 15, still more preferably 1 to 10, even more preferably 1 An isolated polypeptide derived from (a) comprising a sequence formed by the substitution, deletion or addition of ˜3, most preferably 1 amino acid residues, usually having the isolated polypeptide function defined in (a).

In the present invention, the glycosyltransferase of the present invention has an amino acid sequence of SEQ ID NO.: 4, SEQ ID NO: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or Compared to the glycosyltransferase represented by SEQ ID NO.: 41, at most 20, preferably at most 10, more preferably at most 3, even more preferably at most 2, most preferably at most 1 amino acid. It includes mutants formed by replacement by amino acids that are similar or similar in this property. Such conservatively mutated mutants can be generated, for example, following amino acid substitutions as shown in Table 1 below.

initial residue Representative substitution residues Preferred substitution residues Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gln; Asn Lys Asn (N) Gln; His; Lys; Arg Gln Asp (D) Glu Glu Cys (C) Ser Ser Gln (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro; Ala Ala His (H) Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe Leu Leu (L) Ile; Val; Met; Ala; Phe Ile Lys (K) Arg; Gln; Asn Arg Met (M) Leu; Phe; Ile Leu Phe (F) Leu; Val; Ile; Ala; Tyr Leu Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe; Ala Leu

The present invention further provides a polynucleotide encoding a polypeptide of the present invention. The term “polynucleotide encoding a polypeptide” may be a polynucleotide comprising encoding the polypeptide, or a polynucleotide further comprising additional coding and/or non-coding sequences.

Accordingly, as used herein, “comprising”, “having” or “including” means “including”, “consisting primarily of”, “consisting mostly of” and “ including “consisting of…”; "Consisting mainly of...", "consisting mostly of..." and "consisting of..." are the meanings of "including", "having" or "including". belong to a sub-concept.

SEQ ID NO: the amino acid residue of the 222 site / 322 site / 247 site / 280 site corresponding to the amino acid sequence shown in 19

It is known to those skilled in the art that various mutations such as substitutions, additions or deletions may be made at some amino acid residues in the amino acid sequence of some proteins, but the resulting mutants may still retain the function or activity of the original protein. Thus, one of ordinary skill in the art can make certain changes to the amino acid sequence specifically disclosed in the present invention to obtain a mutant with still desired activity, and in such a mutant the 222 region/322 of the amino acid sequence represented by SEQ ID NO: 19 The amino acid residue corresponding to the amino acid residue of site/site 247/site 280 may not be site 222/site 322/site 247/site 280, but the resulting mutant should still fall within the scope of the present invention. .

As used herein, the term “corresponding” has the meaning commonly understood by one of ordinary skill in the art. Specifically, "corresponding" refers to a region in which the sequence of one strand corresponds to a specific site in the sequence of the other strand after comparing the sequences of two strands for homology or sequence identity. Therefore, in “amino acid residues corresponding to the 222th region/322nd region/247th region/280th region of the amino acid sequence shown in SEQ ID NO: 19”, at one end of the amino acid sequence shown in SEQ ID NO: 19 When the 6-His tag is added, the 222 site / 322 site / 247 site / 280 site corresponding to the amino acid sequence shown in SEQ ID NO: 19 in the obtained mutant is the 228 site / 328 site / 253 site/286 site; When a few amino acid residues (eg, two) in the amino acid sequence represented by SEQ ID NO: 19 are deleted, the 222 site/322 corresponding to the amino acid sequence represented by SEQ ID NO: 19 in the obtained mutant Site/Site 247/Site 280 may be Site 220/Site 320/Site 245/Site 278, and so on. Also, for example, if the sequence having 400 amino acid residues in one strand has relatively high homology or sequence identity with the 20 to 420 sites of the amino acid sequence represented by SEQ ID NO: 19, then the mutant obtained has SEQ ID NO. : The 222th site/322nd site/247th site/280th site corresponding to the amino acid sequence represented by 19 may be the 202nd site/302nd site/227th site/260th site.

In an embodiment of the present invention, the homology or sequence identity may be 80% or more, preferably 90%, more preferably 95-98%, and most preferably 99% or more.

Methods for determining sequence homology or identity known to those skilled in the art include Computational Molecular Biology, Lesk, A.M. ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, edited by Smith, D.W., Academy Press, New York, 1993; Computer Analysis of Sequence Data, Part 1, Griffin, A.M. and Griffin, edited by H.G., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academy Press, 1987 and Sequence Analysis Primer, Gribskov, M and Devereux, J. ed. M Stockton Press, New York, 1991 and Carillo, H. and Lipman, D., SIAM J. Applied Math., 48:1073 (1988). A preferred method of determining identity is the greatest correspondence between the sequences being tested. Methods for determining identity were compiled into a publicly available computer program. Preferred computer program methods for determining the identity between the sequences of two strands include, but are not limited to, the GCG package (Devereux, J. et al., 1984), BLASTP, BLASTN and FASTA (Altschul, S, F. et al., 1990). . The public may obtain BLASTX programs (BLAST Handbook, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al., 1990) from NCBI and other sources. The known Smith Waterman algorithm can also be applied to the identity measurement.

Unless otherwise specified, the ginsenosides and sapogenins mentioned herein are ginsenosides and sapogenins in the S and/or R configuration of the C20 region.

As used herein, "isolated polypeptide" means that the polypeptide is native and free of other proteins, lipids, sugars or other substances associated therewith. One skilled in the art can purify the polypeptide using standard protein purification techniques. Generally pure polypeptides can produce a single main band in a non-reducing polyacrylamide gel. The purity of the polypeptide may be further analyzed by amino acid sequence.

The active polypeptides of the present invention may be recombinant, native or synthetic polypeptides. The polypeptides of the present invention may be naturally purified products, chemically synthesized products, or produced in prokaryotic or eukaryotic hosts (eg, bacteria, yeast, plants) using recombinant technology. Depending on the host used in the recombinant production means, the polypeptides of the present invention may be glycosylated or aglycosylated. Polypeptides of the invention may or may not contain an initial methionine residue.

The present invention further includes fragments, derivatives and analogs of the above polypeptides. As used herein, the terms “fragment,” “derivative,” and “analog” refer to a polypeptide that retains substantially the same biological function or activity as the polypeptide.

Polypeptide fragments, derivatives or analogs of the present invention include polypeptides in which (i) one or a plurality of conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, wherein the substituted amino acid residues have the rotary code may or may not be encoded by, or (ii) a polypeptide having a substituent at one or multiple amino acid residues, or (iii) a mature polypeptide of another compound (e.g., the half-life of a polypeptide such as polyethylene glycol) a polypeptide formed by fusion with a compound extending , or a fusion protein formed with an antigen IgG fragment). In accordance with the teachings herein, such fragments, derivatives and analogs are within the scope known to those skilled in the art.

The active polypeptide of the present invention has glycosyltransferase activity and can promote one or more reactions as follows.

wherein said polypeptide sequence is SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO: 41 or a derivative thereof; The term refers to SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37 or SEQ ID NO.: 39 or SEQ ID NO: 41 having the same function as the polypeptide It further includes modified forms of the sequence. Such modifications may include deletions, insertions and/or insertions of one or more amino acids (usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10) amino acids. or substitution and addition of one or more (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and/or N-terminus (however, this includes but not limited to). For example, in the art, when substituted by amino acids of comparable or similar performance, the function of a protein generally does not change. Also, for example, the addition of one or more amino acids to the C-terminus and/or the N-terminus generally does not change the function of the protein. The term further includes active fragments and active derivatives of the proteins of the present invention. The present invention further provides analogs of the above polypeptides. The difference between these analogues and the native polypeptide may be a difference in amino acid sequence, a difference in a modified form that does not affect the sequence, or both. Such polypeptides include natural or derived genetic variants. Derived variants may be obtained by a variety of techniques, for example, through random mutations generated by copying or exposure to inducing agents, site-directed mutagenesis or other techniques known in molecular biology. . Analogs further include analogs having residues of natural L-amino acids (eg D-amino acids), and analogs having non-naturally occurring or synthetic amino acids (eg β, γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

includes chemically derived forms such as acetylation or carboxylation of the polypeptide in vivo or ex vivo in a modified (usually not altering the primary structure) form. Modifications further include glycosylation, eg, polypeptides are produced by glycosylation modifications in the synthesis and processing or further processing steps of such polypeptides. Such modifications are accomplished by exposing the polypeptide to an enzyme that performs glycosylation (eg, mammalian glycosylase or deglycosylase). Modified forms further include sequences having phosphorylated amino acid residues (eg, phosphotyrosine, phosphoserine, phosphoreonine). It further comprises a polypeptide modified to improve resistance to proteolytic enzyme hydrolysis or to optimize solubility.

The amino terminus or carboxyl terminus of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or derivative polypeptide thereof of the present invention further comprises one or a plurality of polypeptide fragments as a protein tag. Any suitable tag may be used in the present invention without limitation. For example, the tag may be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7, 4A6, ε, B, gE and Ty1. Such tags can be used for purification of proteins. Table 2 lists some of these tags and their sequences.

tag number of residues order Poly-Arg 5 to 6 (usually 5) RRRRR Poly-His 2 to 10 (usually 6) HHHHHH FLAG 8 pieces DYKDDDDK Strep-TagII 8 pieces WSHPQFEK C-myc 10 things WQKLISEEDL GST 220 pieces The last 6 are LVPRGS

Amino acid amino groups of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivatives thereof to allow the translated protein to be secreted and expressed (eg extracellularly secreted). A signal peptide sequence such as a pelB signal peptide may be added at the end. The signal peptide may be cleaved in the process of being secreted out of the cell from the polypeptide.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or artificially synthesized DNA. DNA can be single-stranded or double-stranded. DNA may be the coding strand or the non-coding strand. The coding region sequence encoding the mature polypeptide is SEQ ID NO.: 3, SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42 It may be the same as the coding region sequence represented by or may be a degenerate variant. As used herein, a “degenerate variant” means in the present invention SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 , which encodes a polypeptide having an amino acid sequence represented by SEQ ID NO.: 41 or a derivative polypeptide thereof, but SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37 , the coding sequence of SEQ ID NO.: 39, SEQ ID NO.: 41 or a derived polypeptide thereof, preferably SEQ ID NO.: 3, SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO. : 38, SEQ ID NO.: 40 or SEQ ID NO.: refers to a nucleic acid sequence that is different from the sequence represented by the sequence. of the polypeptide represented by SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41 or a derived polypeptide thereof A polynucleotide encoding a mature polypeptide comprises a coding sequence encoding only the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence (and any additional coding sequences) of the mature polypeptide and non-coding sequences.

The term “polynucleotide encoding a polypeptide” may be a polynucleotide comprising encoding a polypeptide, or a polynucleotide further comprising additional coding and/or non-coding sequences.

The present invention also relates to variants of the polynucleotides, polypeptides having the same amino acid sequence as the present invention or fragments, analogs and derivatives thereof encoding the polypeptides. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitutional variants, deletional variants and insertional variants. As is known in the art, an allelic variant is an alternative form of one polynucleotide, which may be a substitution, deletion or insertion of one or multiple nucleotides, but does not substantially change the function of its encoded polypeptide.

The present invention also relates to a polynucleotide that hybridizes to the above sequences and has at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides capable of hybridizing with a polynucleotide according to the present invention under stringent conditions (or stringent conditions). In the present invention, “stringent conditions” include (1) hybridization and elution under relatively low ionic strength and relatively high temperature, for example, 0.2×SSC, 0.1% SDS, 60° C.; or (2) addition of a denaturant upon hybridization, for example, 50% (v/v) formamide, 0.1% fetal bovine serum/0.1% Ficoll, 42° C., and the like; or (3) hybridizes only when the identity between the sequences of the two strands is at least 90% or more, preferably 95% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide is SEQ ID NO.: 4, SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO. It has the same biological function and activity as the mature polypeptide represented by .: 41.

The present invention also relates to a nucleic acid fragment hybridized with the above sequence. As used herein, the length of a “nucleic acid fragment” comprises at least 15 nucleotides, preferably at least 30 nucleotides, more preferably 50 nucleotides, and most preferably 100 nucleotides. Nucleic acid fragments are subjected to nucleic acid amplification techniques (eg PCR) to determine polynucleotides encoding Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivatives thereof. or separate.

Polypeptides and polynucleotides in the present invention are preferably provided in an isolated format, and more preferably in a purified or homogenized format.

The Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide of the present invention or the full-length nucleotide sequence of a derived polypeptide nucleotide sequence or a fragment thereof of the present invention is typically used in PCR amplification, recombinant or artificial synthesis. obtained by With respect to the PCR amplification method, primers can be designed according to the relevant nucleotide sequence disclosed in the present invention, in particular, an open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art is amplified as a template. to obtain the relevant sequence. If the sequence is relatively long, it is necessary to perform two or several PCR amplifications, and then each amplified fragment is spliced together in the correct order.

When the related sequence is obtained, a large amount of the related sequence can be obtained by recombination. This is generally a related sequence obtained by isolation from a host cell propagated by a conventional method after being cloned into a carrier and transferred back into a cell.

In addition, especially when the fragment length is short, it is also possible to synthesize sequences related to artificial synthesis methods. In general, a long fragment can be obtained by first synthesizing a plurality of small fragments and then ligating them again.

Currently, the DNA sequence encoding the protein of the present invention (or a fragment thereof, or a derivative thereof) can be completely obtained by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or, for example, carriers) and cells known in the art. In addition, mutations may be introduced into the protein sequence of the present invention by chemical synthesis.

The method of amplifying DNA/RNA by PCR technique is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain full-length cDNA from the library, the RACE method (RACE-cDNA terminal high-speed amplification method) can be preferably used, and the primers used for PCR are appropriately selected according to the sequence information of the present invention disclosed herein. may be, and may be synthesized according to a conventional method. The amplified DNA/RNA can be isolated and purified by conventional methods such as electrophoresis.

In addition, the present invention provides a delivery system comprising the polynucleotide of the present invention, a delivery system of the present invention, or a gene with a coding sequence of a Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide. It relates to host cells produced by the manipulation, and to methods for producing the polypeptides according to the invention by recombinant techniques.

The polynucleotide sequence of the present invention can express or produce a recombinant Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derived polypeptide thereof by conventional recombinant DNA techniques. It generally comprises the following steps.

(1) a polynucleotide (or a variant) encoding a Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide of the present invention or a derived polypeptide thereof, or a recombinant comprising the polynucleotide transforming or transducing the host cell with an expression vehicle;

(2) culturing the host cells in a suitable medium;

(3) isolating and purifying the protein from the medium or cells.

In the present invention, a polynucleotide sequence encoding a Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derived polypeptide thereof may be inserted into a recombinant expression vehicle. The term “recombinant expression vehicle” refers to a mammalian cell virus such as a bacterial plasmid, phage, yeast plasmid, plant cell virus, adenovirus, retrovirus or other carrier known in the art. Any plasmid and delivery system that can be replicated and stabilized in a host body can be used. One important characteristic of an expression vehicle is that it typically contains an origin of replication, a promoter, a marker gene and translational control elements.

Methods known to those skilled in the art include the construction of expression vehicles containing the coding DNA sequence of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide and suitable transcriptional/translational control signals. can be used for Such methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, and the like. The DNA sequence can be effectively linked to a suitable promoter in an expression vehicle to direct mRNA synthesis. Representative examples of such promoters include E. coli lac or trp promoter; λ phage PL promoter; There are eukaryotic promoters, including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the LTRs of reverse transcription viruses, and promoters in which some other known controllable genes are expressed in prokaryotic or eukaryotic cells or viruses thereof. The expression vehicle further comprises a ribosome binding site for initiating translation and a transcription terminator.

In addition to this, preferably the expression vehicle has phenotypic properties for selection of transformed host cells such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture. or contains one or a plurality of selectable marker genes for providing E. coli tetracycline or ampicillin resistance.

The above suitable DNA sequences and suitable promoter or control sequences can be transformed into an appropriate host cell that allows expression of the protein in the carrier.

Host cells include prokaryotic cells such as bacterial cells; or lower eukaryotic cells such as yeast cells; or higher eukaryotic cells such as mammalian cells. Representative examples include Escherichia coli, Streptomyces genus; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells of Drosophila S2 or Sf9; animal cells of CHO, COS, 293 cells, or Bowes melanoma cells.

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, insertion of an enhancer sequence into the transporter enhances transcription. An enhancer is a cis-acting factor of DNA, usually about 10 to 300 base pairs, and acts on a promoter to increase the transcription of a gene. Examples include the SV40 enhancer of 100 to 270 salt pairs at the end of the replication initiation point, the polyma enhancer and the adenovirus enhancer at the end of the replication initiation point.

Methods for selecting appropriate carriers, promoters, enhancers and host cells will be apparent to those skilled in the art.

Transformation of host cells with recombinant DNA can be performed using conventional techniques known to those skilled in the art. When the host is a prokaryotic organism such as E. coli, competent cells capable of taking up DNA can be obtained after the exponential growth phase, treated by the CaCl ₂ method, and the steps used are well known in the art. Another method is to use MgCl ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, a DNA transfection method such as a calcium phosphate co-precipitation method, a micro-injection method, an electroporation method, and a conventional mechanical method such as liposome packaging can be selected and used.

The obtained transformant can be cultured according to a conventional method to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the medium used for culturing can be selected from a variety of conventional media. Cultured under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (eg, temperature-controlled switching or chemical induction), and the cells are further cultured for a period of time.

The recombinant polypeptide in the method may be expressed intracellularly or on a cell membrane or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. Such methods are well known to those skilled in the art. Examples of such methods include conventional regeneration treatment, protein precipitant treatment (salting-out method), centrifugation, permeabilization, ultra treatment, ultra centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of such methods.

Applications

For use in the active polypeptides or glycosyltransferases Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptides or derivatives thereof according to the present invention, the glycosyl group derived from the glycosyl group donor is tetra Specific and efficient transfer to the hydroxyl group of the C-3 site of a cyclic triterpenoid compound includes (but is not limited to). In particular, the compound of formula (I) can be converted into the compound of formula (II), for example, protophanoxadiol PPD is converted to the rare ginsenoside Rh2 with better anti-tumor activity; Compound K is converted to ginsenoside F2.

As the tetracyclic triterpenoid compound, S- or R-configured dammaran-type, lanolin-type, tyrucalanes-type, cycloatan (cycloaltan)-type, apotirucallane-type, cucurbitan-type, meliacan-type, etc. tetracyclic tri terpenoid compounds.

The present invention provides an industrial catalytic method, wherein the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or derivative polypeptide thereof of the present invention can be used under conditions to provide a glycosyl group donor. Senoside Rh2 and ginsenoside F2 were obtained. Specifically, the polypeptide used in the reaction (A) is selected from a polypeptide represented by SEQ ID NO.: 4 or SEQ ID NO.: 21 or a derivative thereof; The polypeptide used in the reaction (B) is a polypeptide represented by SEQ ID NO.:4 or a derivative thereof.

In one preferred example of the present invention, a method for synthesizing ginsenoside Rh2 in budding yeast using the above-mentioned ginseng glycosyltransferase Pn50 and glycosyltransferase mutant protein 8E7 was provided.

In one preferred embodiment of the present invention, a method for synthesizing ginsenoside Rh2 in budding yeast using the above-mentioned ginseng glycosyltransferase Pn50 mutant protein Pn50-Q222H-VE is provided.

In one preferred example of the present invention, a method for synthesizing ginsenoside Rh2 in budding yeast using the above-mentioned ginseng glycosyltransferase Pn50 mutant protein UGT-MUT1 is provided.

In one preferred example of the present invention, a method for synthesizing ginsenoside Rh2 in budding yeast using the above-described ginseng glycosyltransferase Pn50 mutant protein UGT-MUT2 is provided.

In one preferred example of the present invention, a method for synthesizing ginsenoside Rh2 in budding yeast using the above-mentioned ginseng glycosyltransferase Pn50 mutant protein UGT-MUT3 was provided.

The glycosyl group donor is a nucleoside diphosphate sugar, UDP-glucose, ADP-glucose, TDP-glucose, CDP-glucose, GDP-glucose, UDP-acetylglucose, ADP-acetylglucose, TDP-acetylglucose, CDP- Acetylglucose, GDP-acetylglucose, UDP-xylose, ADP-xylose, TDP-xylose, CDP-xylose, UDP-xylose, GDP-xylose, UDP-galacturonic acid, ADP-galacturonic acid, TDP-galacturonic acid, CDP-galacturonic acid, GDP-galacturonic acid, UDP-galactose, ADP-galactose, TDP-galactose, CDP-galactose, GDP-galactose, UDP-arabinose, ADP-arabinose, TDP- arabinose, CDP-arabinose, GDP-arabinose, UDP-rhamnose, ADP-rhamnose, TDP-rhamnose, CDP-rhamnose, GDP-rhamnose or other nucleoside diphosphate hexose or nucleoside diphosphate pentose or a combination thereof.

Preferably, the glycosyl group donor is a pyridinediphosphate sugar, UDP-glucose, UDP-xylose, UDP-rhamnose, UDP-galacturonic acid, UDP-galactose, UDP-arabinose or other pyridinediphosphatehexose or pyridine diphosphate pentose or a combination thereof.

In the above method, an enzyme activity additive (additive for enhancing enzyme activity or inhibiting enzyme activity) may be further added. ^The enzyme active additive is Ca ²⁺ , Co ²⁺ , Mn ^{2+ ,} Ba ²⁺ , Al ^{3+ ,} Ni ^{2+ , Zn 2+ or Fe 2+ ;} or ^{Ca 2+} , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ^{3+ , Ni 2+ , Zn 2+} or ^{Fe 2+ .}

The pH conditions of the method are pH4.0 to 10.0, preferably pH6.0 to 8.5, and more preferably pH8.5.

The temperature condition of the method is 10 to 105 °C, preferably 25 to 35 °C, more preferably 35 °C.

Further provided is a composition of the present invention, comprising an effective amount of an active polypeptide of the present invention or glycosyltransferase Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or a derivative thereof; and food or industrially acceptable carriers or excipients. Such carriers include, but are not limited to, water, buffers, glucose, water, glycerin, ethanol, and combinations thereof.

A substance that modulates the activity of the glycosyltransferase of the present invention may be further added to the composition. Any substance that enhances the enzyme activity function can be used. Preferably, the substance for enhancing the glycosyltransferase activity of the present invention is selected from mercaptoethanol. Besides this, many substances can reduce enzyme activity, Ca ²⁺ , Co ²⁺ , Mn ²⁺ , Ba ^{2+ ,} Al ^{3+ , Ni 2+ , Zn 2+ and Fe 2+ ;} or which may be hydrolyzed after addition of ^a substrate to form materials ^{of Ca 2+} , Co ²⁺ , Mn ²⁺ , Ba ²⁺ , Al ³⁺ , ^{Ni 2+ , Zn 2+ and Fe 2+} doesn't happen

After obtaining the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide of the present invention, those skilled in the art can conveniently apply the enzyme to a glycosyl transfer reaction, especially damarene It can exert a glycosyl transfer reaction with respect to diol and protophanoxadiol. In a preferred embodiment of the present invention, two methods for forming rare ginsenosides are further provided, one of the methods according to the present invention is Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, and treating a substrate to be glycosyl-transferred with the UGT-MUT3 polypeptide or its derivative polypeptide, wherein the substrate includes a tetracyclic triterpenoid compound such as damarendol, protopanoxadiol and derivatives thereof. Preferably, under the conditions of pH 3.5-10, the substrate to be glycosyl-transferred to the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide was enzymatically treated. Preferably, the substrate to be glycosyl transferred to the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide under a temperature of 30 to 105° C. was enzymatically treated. .

Another one of the above methods, Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide gene according to the present invention is an engineering capable of synthesizing protopanoxadiol PPD Bacteria (eg, yeast or E. coli engineered bacteria), or Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derived polypeptide gene is damarendiol, protopa Rare ginsenoside Rh2 and/or ginsenoside F2 by co-expression in host cells (eg yeast cells or E. coli) with genes key in the noxadiol PPD synthesis metabolic pathway and any other glycosyltransferase genes It includes the step of obtaining a recombinant bacterium that directly produces Alternatively, the coding nucleotide sequence of the Pn50, 8E7, Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3 polypeptide or its derivative polypeptide is key in the damarendiol and/or protopanoxadiol PPD synthesis metabolic pathway. of a recombinant strain for artificial synthesis of artificially synthesized rare ginsenosides Rh2 and ginsenoside F2 by co-expression in host cells with enzymes and other glycosyltransferases and a key enzyme for synthesizing UDP-rhamnose. applied to the construction.

Key genes in the damarendiol synthesis metabolic pathway include, but are not limited to, a damarendiol synthase gene.

In another preferred embodiment, the key genes in the protopanoxadiol synthesis metabolic pathway include damarendiol synthase gene PgDDS, cytochrome P450 gene CYP716A47 synthesized from protopanoxadiol, and a reductase gene thereof, or a combination thereof. (but not limited to). or isoenzymes of the various enzymes and combinations thereof. Here, the damarendiol synthetase converts epoxy squalene (synthesized by budding yeast itself) into damarenediol and cytochrome P450 CYP716A47, and its reductase again converts damarenediol into protopanoxadiol PPD ( Han et.al, plant & cell physiology, 2011, 52.2062-73).

Advantages of the present invention:

(1) The method for producing ginsenoside Rh2 using the budding yeast of the present invention is cheaper, has a shorter cycle, and has lower quality than the traditional method relying on extraction and glycosyl hydrolysis of phosphate plants. It has advantages such as stable;

(2) The present invention can catalyze the glycosyltransferases Pn50 PPD and Rh2 obtained from Sachil for the first time, and catalyzes CK to synthesize F2, which in ginseng produced PPD than the wild-type glycosyltransferase UGTPg45. introduction into the producing strain can more efficiently synthesize the rare ginsenoside Rh2;

(3) In the present invention, wild-type glycosyltransferase UGTPg45 is randomly mutated in ginseng to obtain mutant gene 8E7 or Samchil glycosyltransferase gene Pn50, and this is added to a strain that produces PPD than wild-type glycosyltransferase UGTPg45 in ginseng. introduction can significantly improve the rare ginsenoside Rh2 synthesis efficiency;

(4) In the present invention, wild-type glycosyltransferase Pn50 is randomly mutated in Samchil to obtain mutant genes Pn50-Q222H-VE, UGT-MUT1, UGT-MUT2, UGT-MUT3, and wild-type glycosyltransferase in Samchil It is possible to significantly improve the synthesis efficiency of the rare ginsenoside Rh2 by introducing it into a strain producing PPD rather than the Rase Pn50.

Hereinafter, in conjunction with specific examples, the present invention will be further described. These examples are merely for illustrating the present invention, and the scope of the present invention is not limited thereto. Experimental methods that do not specify specific conditions in the following examples are conventional conditions, for example, Sambrook et al., Molecular Clone: The conditions described in the laboratory handbook (New York: Cold Spring Harbor Laboratory Press, 1989), or as suggested by the manufacturer. subject to conditions Unless otherwise stated, percentages are calculated by weight.

The specific process of the present invention can be further understood through the following specific implementation methods.

Example 1. Cloning of Samchil glycosyltransferase gene Pn50

Two-stranded primers were synthesized with the sequence Pn50 cloning primer F, SEQ ID NO: 1 (ATGGAGAGAGAAATGTTGAGCA) and Pn5 cloning primer R, SEQ ID NO: 2 (TCAGGAGGAAACAAGCTTTGAA). PCR was performed using the cDNA obtained by reverse transcription of RNA extracted from Samchil as a template and the same primers as above. DNA polymerase is a high-fidelity KOD DNA polymerase from TaKaRa Bio Group Co., Ltd. The PCR amplification procedure is as follows. 2 min at a temperature of 94 °C; A total of 35 cycles were performed for 15 seconds at a temperature of 94°C, 30 seconds at a temperature of 58°C, and 2 minutes at a temperature of 68°C; The temperature of 68 °C was reduced to 10 °C in 10 minutes. The PCR product was detected by agarose gel electrophoresis and the results are as shown in FIG. 1 .

Under ultraviolet irradiation, the target DNA band was cleaved. Then, using the Axygen Gel Extraction Kit (AEYGEN Co.), agarose gelatinized DNA, that is, the DNA fragment of the amplified glycosyltransferase gene was recovered. Using the PMD18-T cloning kit of TaKaRa Bio Group (Taarien) Co., Ltd. (Takara), the recovered PCR product was cloned into a PMDT delivery system, and the constructed delivery system was named PMDT-Pn50. By sequencing, the gene sequence of Pn50 was obtained.

The Pn50 gene has the nucleotide sequence of SEQ ID NO: 3. The first to 1368 site nucleotides at the 5' end of SEQ ID NO: 3 are the Open Reading Frame (ORF) of Pn50, and the first to third site nucleotides at the 5' end of SEQ ID NO: 3 are of the Pn50 gene. The start codon is ATG, and the nucleotides 1366 to 1368 at the 5' end of SEQ ID NO: 3 are the stop codon TGA of the Pn50 gene. The glycosyltransferase Pn50 gene encodes a protein Pn50 containing 455 amino acids, and the amino acid residue sequence with SEQ ID NO: 4 was predicted by software to have a theoretical molecular weight of 51.1 kDa and an isoelectric point pI of 5.10. The amino acids at the 332 to 375 sites of the amino acid terminus of SEQ ID NO: 4 are glycosyltransferase PSPG conservative functional regions.

Pn50 nucleotide sequence SEQ ID NO:3

ATGGAGAGAGAAATGTTGAGCAAAACTCACATTATGTTCATCCCATTCCCAGCTCAAGGCCACATGAGCCCAATGATGCAATTCGTCAAGCGTTTAGCCTGGAAAGGCGTGCGAATCACGATAGTTCTTCCGGCTGAGATTCGAGATTCTATGCAAATAAACAACTCATTGATCAACACTGAGTGCATCTCCTTTGATTTTGATAAAGATGATGAGATGCCATACAGCATGCGGGCTTATATGGGAGTTGTAAAGCTCAAGGTCACAAATAAACTGAGTGACCTACTCGAGAAGCAAAAAACAAATGGCTACCCTGTTAATTTGCTAGTGGTCGATTCATTATATCCATCTCGGGTAGAAATGTGCCACCAACTTGGGGTAAAAGGAGCTCCATTTTTCACTCACTCTTGTGCTGTTGGTGCCATTTATTATAATGCTCGCTTAGGGAAATTGAAGATACCTCCTGAGGAAGGGTTGACTTCTGTTTCATTGCCTTCAATTCCATTGTTGGGGAGAAATGATTTGCCAATTATTAGGACTGGCACCTTTCCTGATCTCTTTGAGCATTTGGGGAATCAGTTTTCAGATCTTGATAAAGCGGATTGGATCTTTTTCAATACTTTTGATAAGCTTGAAAATGAGGAAGCAAAATGGCTATCTAGCCAATGGCCAATTACATCCATCGGACCATTAATCCCTTCAATGTACTTAGACAAACAATTACCAAATGACAAAGACAATGACATTAATTTCTACAAGGCAGACGTCGGATCGTGCATCAAGTGGCTAGACGCCAAAGACCCTGGCTCGGTAGTCTACGCCTCATTCGGGAGCGTGAAGCACAACCTCGGCGATGACTACATGGACGAAGTAGCATGGGGCTTGTTACACAGCAAATATCACTTCATATGGGTTGTTATAGAATCCGAACGTACAAAGCTCTCTAGCGATTTCTTGGCAGAGGCAGAGGAAAAAGGCCTAATAGTGAGTTGGTGCCCTC AACTCGAAGTTTTGTCACATAAATCTATAGGTAGTTTTATGACTCATTGTGGTTGGAACTCGACGGTTGAGGCATTGAGTTTGGGCGTGCCAATGGTGGCAGTGCCACAACAGTTTGATCAGCCTGTTAATGCCAAGTATATCGTGGATGTATGGCGAATTGGGGTTCAGGTTCCGATTGGTGAAAATGGGGTTCTTTTGAGGGGAGAAGTTGCTAACTGTATAAAGGATGTTATGGAGGGGGAAATAGGGGATGAGCTTAGAGGGAATGCTTTGAAATGGAAGGGGTTGGCTGTGGAGGCAATGGAGAAAGGGGGTAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTGA

Pn50 amino acid sequence SEQ ID NO: 4

MEREMLSKTHIMFIPFPAQGHMSPMMQFVKRLAWKGVRITIVLPAEIRDSMQINNSLINTECISFDFDKDDEMPYSMRAYMGVVKLKVTNKLSDLLEKQKTNGYPVNLLVVDSLYPSRVEMCHQLGVKGAPFFTHSCAVGAIYYNARLGKLKIPPEEGLTSVSLPSIPLLGRNDLPIIRTGTFPDLFEHLGNQFSDLDKADWIFFNTFDKLENEEAKWLSSQWPITSIGPLIPSMYLDKQLPNDKDNDINFYKADVGSCIKWLDAKDPGSVVYASFGSVKHNLGDDYMDEVAWGLLHSKYHFIWVVIESERTKLSSDFLAEAEEKGLIVSWCPQLEVLSHKSIGSFMTHCGWNSTVEALSLGVPMVAVPQQFDQPVNAKYIVDVWRIGVQVPIGENGVLLRGEVANCIKDVMEGEIGDELRGNALKWKGLAVEAMEKGGSSDKNIDEFISKLVSS

Example 2. Expression of Samchil glycosyltransferase gene Pn50 in Escherichia coli

Two-stranded primers were synthesized with the sequence Pn50 expression primer F SEQ ID NO: 5 (GGATCCATGGAGAGAGAAATGTTGAGCA) and Pn50 expression primer R SEQ ID NO: 6 (CTCGAGTCAGGAGGAAACAAGCTTTGAA). Two enzyme cleavage sites were added to the synthesized primer F/R, respectively, BamHI and Xho I, and PCR was performed using the cDNA extracted from the plant as a template. As the DNA polymerase, a high-fidelity KOD DNA polymerase from TaKaRa Bio Group Co., Ltd. was selected and used. The PCR amplification procedure is as follows. 2 min at a temperature of 94 °C; A total of 35 cycles were performed for 15 seconds at a temperature of 94°C, 30 seconds at a temperature of 58°C, and 2 minutes at a temperature of 68°C; The temperature of 68 °C was reduced to 10 °C in 10 minutes. PCR products were detected by agarose gel electrophoresis. Under ultraviolet irradiation, the target DNA band was cleaved. The DNA fragment of the amplified glycosyltransferase gene was recovered from the agarose gel using the following Axygen Gel Extraction Kit (AEYGEN). After digesting the two recovered PCR products with BamHI and Xho I enzymes, they were ligated with pET28a similarly digested with BamHI and Xho I enzymes, respectively, and E. coli EPI300 competent cells were transformed with the ligation product, and the transformed E. coli The bacterial solution was coated on an LB plate to which 50 ug/mL of kanamycin was added, and recombinant clones were verified by PCR and restriction enzyme digestion verification. After selecting one clone from each and extracting the recombinant plasmid, sequencing verification was performed. If the sequencing verification result is correct, expression is induced in E. coli BL21(DE3) transformed with the recombinant plasmid, and the method of inducing expression is as follows. same. A single clone is selected from the plate and inoculated into an LB test tube containing 50 ug/mL of kanamycin, and overnight, 1% is taken and inoculated into a 50 ml Erlenmeyer flask, and when the OD600 becomes 0.6 to 0.7 under a temperature of 37 ℃ Incubated with shaking until induced by adding IPTG having a concentration of 0.1 mM, and induced at a temperature of 18 °C for 16 hours. 12000 g, the wet-weight cells per 1 g of the cells collected for 3 minutes were resuspended in 10 ml of PBS buffer, then the cells were decomposed, centrifuged, and the supernatant was used as a crude enzyme solution.

Example 3. Catalysis of different substrate reactions and detection of their products by the triglycosyltransferase gene Pn50

A glycosyltransferase Pn50 catalyzed reaction scheme (100 μL) is formulated as follows.

10% Tween 20:10 µl

50 mM UDPG: 10 μL

1M Tris-Hcl PH 8.5: 5 μL

100 mM substrate (dissolved in ethanol): 0.5 μL

Crude enzyme solution: 75.5 μL

The reaction was carried out for 2 hours under a water bath at a temperature of 37 °C. After completion of the reaction, the same volume of n-butanol was added for extraction, and the n-butanol phase was taken, concentrated in vacuo, the reaction product was dissolved in 10 μL of methanol, and the result was detected by TLC or HPLC. As can be seen from the results of Figure 2, the glycosyltransferase Pn50 used in the present invention can catalyze protopanoxadiol PPD to form a new product (refer to formula A for the reaction), Its migration site coincides with that of Rh2, and it was proved that this novel product is the ginsenoside Rh2. In addition, Pn50 may catalyze compound K, and the resulting product was estimated to be ginsenoside F2 according to the migratory site on the TLC plate and the region conformation of Pn50 (FIG. 2).

Example 4. Synthesis of rare ginsenoside Rh2 in budding yeast using glycosyltransferase gene Pn50 derived from Samchil

(1) Glycosyltransferase gene Pn50 derived from Samchil can synthesize rare ginsenoside Rh2 by catalyzing hydroxyl glycosylation at C3 site of protophanoxadiol, and rare ginsenoside Rh2 in budding yeast In order to synthesize, in the present invention, first, a budding yeast chassis cell capable of producing protopanoxadiol was constructed. Damarendiol synthase gene PgDDS was introduced into wild-type budding yeast, cytochrome P450 gene CYP716A47 synthesized from protophanoxadiol and its reductase gene PgCPR1, 2,3 synthesized by the mevalonic acid pathway of budding yeast itself -Protophanoxadiol can be synthesized with epoxysqualene. The budding yeast strain ZWBY04RS that produces a lot of protopanoxadiol was obtained by optimizing through the artificially constructed protopanoxadiol synthesis route, including the optimization of the synthesis restriction step, and the optimization of the precursor supply.

(2) synthesizing a 12-stranded primer as shown in sequence SEQ ID NO: 7-18, and promoter, terminator, ORF, selectable marker, upstream and downstream homology arms by glycosyltransferase expression by the method of PCR ( homologous arm) fragment was obtained, and the PCR method was the same as in Example 1. After mixing the PCR fragment and the ORF of UGTPg45 at 100 ng each, the recombinant budding yeast strain ZWBY04RS was transformed using a conventional LiAc/ssDNA transformation method for budding yeast, and the recombinant budding yeast strain ZWBY04RS-UGTPg45 got Similarly, after mixing 100 ng of each of the PCR fragment and the ORF of Pn50, the recombinant budding yeast strain ZWBY04RS was transformed using a conventional LiAc/ssDNA transformation method of budding yeast, and the recombinant budding yeast strain ZWBY04RS -Pn50 was obtained.

Promoter Primer F SEQ_ID_NO.7

TAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTGAGATT

promoter primer R SEQ_ID_NO.8

ACTGTCAAGGAGGGTATTCTGGGCCTCCATGTCGCTGCTATATAACAGTTGAAATTTGGATAAGAACAT

ORF Primer F SEQ_ID_NO.9

GCTATACTGCTGTCGATTCGATACTAACGCCGCCATCCAGTGTCGAGAATTACAATAGT

ORF Primer R SEQ_ID_NO.10

TCTGGTGAGGATTTACGGTATGATCATGCTGGTAAGCTTCGTTA

Terminator Primer F SEQ_ID_NO.11

GAAAAGAAGATAATATTTTTATATAATTATATTAATCTCAGGAGGAAACAAGCTTTGAA

Terminator Primer R SEQ_ID_NO.12

GCATAGCAATCTAATCTAAGTTTTAATTACAAAATGGAGAGAGAAATGTTGAGCAAAAC

Selectable marker primer F SEQ_ID_NO.13

CGCGTTGAGAAGATGTTCTTATCCAAATTTCAACTGTTATATAGCAGGCGA

Selectable marker primer R SEQ_ID_NO.14

TTACTTCTTGCAGACATCAGACATACTATTGTAATTCTCGACACTGGATGGCGGCGTTA

Upstream homology arm primer F SEQ_ID_NO.15

GGCTGTCGCCATTCAAGAGCAGATAGCTTCAAAATGTTTCTACTCCTTTTTTACTCTTC

Upstream homology arm primer R SEQ_ID_NO.16

CATAATGTGAGTTTTGCTCAACATTTCTCTCTCCATTTTGTAATTAAAACTTAGATTAG

Downstream homology arm primer F SEQ_ID_NO.17

CCCAAAGCTAAGAGTTCCATTTTATTC

Downstream homology arm primer R SEQ_ID_NO.18

GAGTAGAAACATTTTGAAGCTATCTGCTCTTGAATGGCGACAGCCTATTGCCCCAGTGT

(3) Solid medium formulation: Medium formulation: 1% Yeast Extract, 2% Peptone, 2% Dextrose (glucose), 2% agar powder

Liquid medium formulation: Medium formulation: 1% yeast extract, 2% peptone, 2% glucose

Recombinant budding yeast strains ZWBY04RS-UGTPg45 and ZWBY04RS-Pn50 streaked on a solid medium plate were taken and cultured with shaking overnight in a test tube containing 5 mL of a liquid medium, respectively (30 °C, 250 rpm, 16 hours); Cells were collected by centrifugation, transferred to a 50 mL Erlenmeyer flask containing 10 mL of liquid medium, and cultured for 4 days at 30 °C and 250 rpm until OD600 reached 0.05 to obtain a fermentation product. In this method, one parallel experiment was set up for each recombinant yeast at the same time.

Extraction and detection of protophanoxadiol and rare ginsenoside Rh2: Take 100 μL of fermentation broth from 10 mL of fermentation broth, lyse yeast with Fastprep shaking, add equal volume of n-butanol, then n-butanol Evaporate to dryness under vacuum. After dissolving in 100 μL of methanol, the acid amount of the target product was measured by HPLC. HPLC results are shown in FIG. 3 .

The recombinant budding yeast strain ZWBY04RS-UGTPg45 constructed by introducing the glycosyltransferase gene UGTPg45 derived from ginseng into the budding yeast strain producing protopanoxadiol can synthesize the rare ginsenoside Rh2, and its output is 35.66 mg/L. The recombinant budding yeast strain ZWBY04RS-Pn50 constructed by introducing the glycosyltransferase gene Pn50 derived from Samchil into the budding yeast strain producing protopanoxadiol can synthesize the rare ginsenoside Rh2, and its acidity is 45.55 mg/L.

Example 5. Construction of Ginseng-derived Glycosyltransferase UGTPg45 Random Mutation Library

Plasmid UGTPg45-pMD18T as template, GeneMorph II Random Mutagenesis Kit (Agilent Technology), UGTPg45 random mutagenesis primer F SEQ ID NO: 23 (Gcatagcaatctaatctaagttttaattacaaaaatggagagagaaaatgttgagcaagaaatttcaa SEQ ID NO:24) and UGTPg45 random mutagenesis primer (Rattagtag45 NO. Perform error-prone PCR, and the procedure is as follows. predenatured for 2 minutes under a temperature of 95 °C; 30 cycles of denaturing at a temperature of 95° C. for 30 seconds, annealing at a temperature of 58° C. for 30 seconds, and stretching at a temperature of 72° C. for 3 minutes and 15 seconds; Final stretching was performed for 10 minutes at a temperature of 72 °C. According to the kit instructions, 1 ug, 1.5 ug, and 2 ug of the template were put in to investigate the mutation rate. The PCR product was recovered by tapping, and ligated to the transporter pMD18T with Taq enzyme addition A, and transfected into E. coli TOP10. Ten positive clones were randomly selected and sequenced, and it was confirmed that the template amount corresponding to 1 to 2 bases/gene of mutation was 1.5 ug. In subsequent experiments, error-prone PCR was performed using the above conditions, ie, a random mutant library of UGTPg45 was well constructed.

Primers SEQ ID NO: 25 (fragment 7 primer F) (Acactggggcaataggctgtcgccattcaagagcagatagcttcaaaatgttttctactc) and SEQ ID NO: 26 (fragment 7 primer R) (Cataatgtgagtttttgctcaacatttctctctccattttgtaattaaaacttagattag to obtain the genomic yeast subtype fragment by PCR and PCR as a template yeast subtype fragment) Using primers SEQ ID NO: 27 (fragment 8 primer F) (Ttgatgagttcattttcaaagcttgtttcctcctgagattaataataattataaaaaata) and SEQ ID NO: 28 (fragment 8 primer R) (Actgtcaaggagggtattctgggcctccatgtcgctgctatataacagttgaaatttgg, budding DNA as a template, using the germinating DNA as a template, using the primers SEQ ID NO: 27 (fragment 8 primer F) SEQ ID NO: 29 (Fragment 9 primer F) (Cccaaagctaagagtcccattttattc) and SEQ ID NO: 30 (Fragment 9 primer R) (Gaagagtaaaaaaggagtagaaacattttgaagctatctgctcttgaatggcgacacagcc), SEQ ID NO: 31 (Fragment 10 primer F) Fragment 9 and fragment 10 were obtained by PCR using (fragment 10 primer R) (Tctggtgaggatttacggtatg) using budding yeast genomic DNA as a template. Primers SEQ ID NO: 33 (fragment 11 primer F) (Aagatgttcttatccaaatttcaactgttatatagcagcgacatggaggcccagaatac) and SEQ ID NO: 34 (fragment 11 primer R) (tacttcttgcagacatcagacatactattgtaattctcgacactggatggcggcgttag) were obtained by PCR using plasmid fragment 11 as a template by PCR. The fragments 7 to 11 were mixed in an equimolar ratio, the PPD high-yield strain ZWBY04RS was transformed, and coated on a YPD plate (100 ug/ml of G418 was put), and cultured at 30 ° C. for 2 days, UGTPg45 Yeast transformants expressing the mutant gene were grown. Similarly, a yeast transformant was constructed by transformation into wild-type UGTPg45 as a control.

In a 96-well plate, 600 ul of YPD medium per well (100 ug/ml of G418 was put) was put, and a yeast single clone was selected and put into the medium, and cultured with shaking for 1 day at 30° C. and 280 rpm. 6 ul of the culture was transferred to a new 96-well plate containing 600 ul of YPD stock, and cultured with shaking for 3 days at 30° C. and 280 rpm. 600 ul of n-butanol was added to each well, covered with a rubber cap, sealed with tape, and spin-extracted for 3 hours. After centrifugation at 4000 rpm for 10 minutes, 150 ul of the n-butanol phase was taken and pipetted into a new 96-well plate, and the product was measured by HPLC.

The output of Rh2 in the rare ginsenoside Rh2 strain ZWBY04RS-8E7 constructed using the mutant gene 8E7 was 70% higher than that of Rh2 in the strain ZWBY04RS-UGTPg45 constructed using UGTPg45, reaching 60.48 mg/L.

The wild-type gene UGTPg45 has the nucleotide sequence of SEQ ID NO: 20. The first to 1374 site nucleotides at the 5' end of SEQ ID NO: 20 are the open reading frame of UGTPg45, and the first to 3 site nucleotides at the 5' end of SEQ ID NO: 20 are the start codon ATG of the UGTPg45 gene, SEQ ID NO: 20 The nucleotides 1371 to 1374 at the 5' end of ID NO: 20 are the stop codon TGA of the UGTPg45 gene. The glycosyltransferase UGTPg45 gene encodes the protein UGTPg45 containing 457 amino acids, and the amino acid residue sequence with SEQ ID NO: 19 was predicted by software to have a theoretical molecular weight of 51.1 kDa and an isoelectric point pI of 5.10. The amino acid at the 332 to 375 region of the amino acid terminus of SEQ ID NO: 19 is a glycosyltransferase PSPG conserved functional region.

UGTPg45 amino acid sequence SEQ_ID_NO.19

MEREMLSKTHIMFIPFPAQGHMSPMMQFAKRLAWKGLRITIVLPAQIRDFMQITNPLINTECISFDFDKDDGMPYSMQAYMGVVKLKVTNKLSDLLEKQRTNGYPVNLLVVDSLYPSRVEMCHQLGVKGAPFFTHSCAVGAIYYNARLGKLKIPPEEGLTSVSLPSIPLLGRDDLPIIRTGTFPDLFEHLGNQFSDLDKADWIFFNTFDKLENEEAKWLSSQWPITSIGPLIPSMYLDKQLPNDKDNGINFYKADVGSCIKWLDAKDPGSVVYASFGSVKHNLGDDYMDEVAWGLLHSKYHFIWVVIESERTKLSSDFLAEAEAEEKGLIVSWCPQLQVLSHKSIGSFMTHCGWNSTVEALSLGVPMVALPQQFDQPANAKYIVDVWQIGVRVPIGEEGVVLRGEVANCIKDVMEGEIGDELRGNALKWKGLAVEAMEKGGSSDKNIDEFISKLVSS

UGTPg45 nucleotide sequence SEQ_ID_NO.20

ATGGAGAGAGAAATGTTGAGCAAAACTCACATTATGTTCATCCCATTCCCAGCTCAAGGCCACATGAGCCCAATGATGCAATTCGCCAAGCGTTTAGCCTGGAAAGGCCTGCGAATCACGATAGTTCTTCCGGCTCAAATTCGAGATTTCATGCAAATAACCAACCCATTGATCAACACTGAGTGCATCTCCTTTGATTTTGATAAAGACGATGGGATGCCATACAGCATGCAGGCTTATATGGGAGTTGTAAAACTCAAGGTCACAAATAAACTGAGTGACCTACTCGAGAAGCAAAGAACAAATGGCTACCCTGTTAATTTGCTAGTGGTTGATTCATTATATCCATCTCGGGTAGAAATGTGCCACCAACTTGGGGTAAAAGGAGCTCCATTTTTCACTCACTCTTGTGCTGTTGGTGCCATTTATTATAATGCTCGCTTAGGGAAATTGAAGATACCTCCTGAGGAAGGGTTGACTTCTGTTTCATTGCCTTCAATTCCATTGTTGGGGAGAGATGATTTGCCAATTATTAGGACTGGCACCTTTCCTGATCTCTTTGAGCATTTGGGGAATCAGTTTTCAGATCTTGATAAAGCGGATTGGATCTTTTTCAATACTTTTGATAAGCTTGAAAATGAGGAAGCAAAATGGCTATCTAGCCAATGGCCAATTACATCCATCGGACCATTAATCCCTTCAATGTACTTAGACAAACAATTACCAAATGACAAAGACAATGGCATTAATTTCTACAAGGCAGACGTCGGATCGTGCATCAAGTGGCTAGACGCCAAAGACCCTGGCTCGGTAGTCTACGCCTCATTCGGGAGCGTGAAGCACAACCTCGGCGATGACTACATGGACGAAGTAGCATGGGGCTTGTTACATAGCAAATATCACTTCATATGGGTTGTTATAGAATCCGAACGTACAAAGCTCTCTAGCGATTTCTTGGCAGAGGCAGAGGCAGAGGAAAAAGGCCTAATAGTGAGTTGGT GCCCTCAACTCCAAGTTTTGTCACATAAATCTATAGGGAGTTTTATGACTCATTGTGGTTGGAACTCGACGGTTGAGGCATTGAGTTTGGGCGTGCCAATGGTGGCACTGCCACAACAGTTTGATCAGCCTGCTAATGCCAAGTATATCGTGGATGTATGGCAAATTGGGGTTCGGGTTCCGATTGGTGAAGAGGGGGTTGTTTTGAGGGGAGAAGTTGCTAACTGTATAAAGGATGTTATGGAGGGGGAAATAGGGGATGAGCTTAGAGGGAATGCTTTGAAATGGAAGGGGTTGGCTGTGGAGGCAATGGAGAAAGGGGGTAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTGA

The mutant gene 8E7 has the nucleotide sequence of SEQ ID NO: 22. The 1st to 1374 site nucleotides at the 5' end of SEQ ID NO: 22 are the open reading frame of 8E7, the 1st to 3 site nucleotides at the 5' end of SEQ ID NO: 22 are the initiation codon ATG of the 8E7 gene, SEQ ID NO: 22 The nucleotides 1371 to 1374 at the 5' end of ID NO: 22 are the stop codon TGA of the 8E7 gene. The glycosyltransferase 8E7 gene encodes a protein 8E7 containing 457 amino acids and has the amino acid residue sequence of SEQ ID NO: 21.

8E7 amino acid sequence SEQ_ID_NO.21

MEREMLSKTHIMFIPFPAQGHMSPMMQFAKRLAWKGLRITIVLPAQIRDFMQITNPLINTECISFDFDKDDGMPYSMQAYMGVVKLKVTNKLSDLLEKQRTNGYPVNLLVVDSLYPSRVEMCHQLGVKGAPFFTHSCAVGAIYYNARLGKLKIPPEEGLTSVSLPSIPLLGRDDLPIIRTGTFPDLFEHLGNQFSDLDKADWIFFNTFDKLENEEAKWLSSHWPITSIGPLIPSMYLDKQLPNDKDNGINFYKADVGSCIKWLDAKDPGSVVYASFGSVKHNLGDDYMDEVAWGLLHSKYHFIWVVIESERTKLSSDFLAEVEAEEKGLIVSWCPQLQVLSHKSIGSFMTHCGWNSTVEALSLGVPMVALPQQFDQPANAKYIVDVWQIGVRVPIGEEGVVLRGEVANCIKDVMEGEIGDELRGNALKWKGLAVEAMEKGGSSDKNIDEFISKLVSS

8E7 nucleotide sequence SEQ_ID_NO.22

ATGGAGAGAGAAATGTTGAGCAAAACTCACATTATGTTCATCCCATTCCCAGCTCAAGGCCACATGAGCCCAATGATGCAATTCGCCAAGCGTTTAGCCTGGAAAGGCCTGCGAATCACGATAGTTCTTCCGGCTCAAATTCGAGATTTCATGCAAATAACCAACCCATTGATCAACACTGAGTGCATCTCCTTTGATTTTGATAAAGACGATGGGATGCCATACAGCATGCAGGCTTATATGGGAGTTGTAAAACTCAAGGTCACAAATAAACTGAGTGACCTACTCGAGAAGCAAAGAACAAATGGCTACCCTGTTAATTTGCTAGTGGTTGATTCATTATATCCATCTCGGGTAGAAATGTGCCACCAACTTGGGGTAAAAGGAGCTCCATTTTTCACTCACTCTTGTGCTGTTGGTGCCATTTATTATAATGCTCGCTTAGGGAAATTGAAGATACCTCCTGAGGAAGGGTTGACTTCTGTTTCATTGCCTTCAATTCCATTGTTGGGGAGAGATGATTTGCCAATTATTAGGACTGGCACCTTTCCTGATCTCTTTGAGCATTTGGGGAATCAGTTTTCAGATCTTGATAAAGCGGATTGGATCTTTTTCAATACTTTTGATAAGCTTGAAAATGAGGAAGCAAAATGGCTATCTAGCCATTGGCCAATTACATCCATCGGACCATTAATCCCTTCAATGTACTTAGACAAACAATTACCAAATGACAAAGACAATGGCATTAATTTCTACAAGGCAGACGTCGGATCGTGCATCAAGTGGCTAGACGCCAAAGACCCTGGCTCGGTAGTCTACGCCTCATTCGGGAGCGTGAAGCACAACCTCGGCGATGACTACATGGACGAAGTAGCATGGGGCTTGTTACATAGCAAATATCACTTCATATGGGTTGTTATAGAATCCGAACGTACAAAGCTCTCTAGCGATTTCTTGGCAGAGGTAGAGGCAGAGGAAAAAGGCCTAATAGTGAGTTGGT GCCCTCAACTCCAAGTTTTGTCACATAAATCTATAGGGAGTTTTATGACTCATTGTGGTTGGAACTCGACGGTTGAGGCATTGAGTTTGGGCGTGCCAATGGTGGCACTGCCACAACAGTTTGATCAGCCTGCTAATGCCAAGTATATCGTGGATGTATGGCAAATTGGGGTTCGGGTTCCGATTGGTGAAGAGGGGGTTGTTTTGAGGGGAGAAGTTGCTAACTGTATAAAGGATGTTATGGAGGGGGAAATAGGGGATGAGCTTAGAGGGAATGCTTTGAAATGGAAGGGGTTGGCTGTGGAGGCAATGGAGAAAGGGGGTAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTGA

According to the above results, the glycosyltransferase gene Pn50 derived from ginseng of the present invention or the mutant gene 8E7 obtained by genetic modification of wild-type glycosyltransferase of the present invention were used to replace the glycosyltransferase gene UGTPg45 derived from ginseng. The synthesis efficiency of ginsenoside Rh2 could be greatly improved, and a remarkable effect was exhibited.

Example 6. Synthesis of Rh2 in budding yeast using the glycosyltransferase mutant gene Pn50-Q222H-VE of Samchil Pn50

The inventor mutated amino acid residue Q at site 222 of Pn50 to H, and at the same time deleted amino acid residues at sites 322 and 323 of Pn50, the inventor inserted two amino acids VE after site 321, mutant Pn50-Q222H- of Pn50 VE was obtained.

(1) Synthesis of 12-stranded primers as in sequence SEQ ID NO: 7-18, and promoter, terminator, ORF, selectable marker, upstream and downstream homology arms expressed by glycosyltransferase by the method of PCR A fragment was obtained, and the PCR method was the same as in Example 1. After mixing 100 ng of each of the PCR fragment and the ORF of Pn50-Q222H-VE, the recombinant budding yeast strain ZWBY04RS was transformed using a conventional LiAc/ssDNA transformation method of budding yeast, and the recombinant budding yeast Strain ZWBY04RS-QE was obtained.

(2) taking the recombinant budding yeast strain ZWBY04RS-QE streaked on a solid medium plate, and culturing with shaking overnight in a test tube each containing 5 mL of a liquid medium (30 °C, 250 rpm, 16 hours); Cells were collected by centrifugation, transferred to a 50 mL Erlenmeyer flask containing 10 mL of liquid medium, and cultured for 4 days at 30 °C and 250 rpm until OD ₆₀₀ reached 0.05 to obtain a fermentation product. In this method, one parallel experiment was set up for each recombinant yeast at the same time.

Extraction and detection of protophanoxadiol and rare ginsenoside Rh2: Take 100 μL of fermentation broth from 10 mL of fermentation broth, lyse yeast with Fastprep shaking, add equal volume of n-butanol, then n-butanol Evaporate to dryness under vacuum. After dissolving in 100 μL of methanol, the acid amount of the target product was measured by HPLC.

The recombinant budding yeast strain ZWBY04RS-QE constructed by introducing the glycosyltransferase gene Pn50-Q222H-VE derived from Samchil into a budding yeast strain producing protopanoxadiol can synthesize the rare ginsenoside Rh2 and , its acid content is 59.09 mg/L (FIG. 4).

Amino acid sequence of Pn50-Q222H-VE, SEQ_ID_NO.41

MEREMLSKTHIMFIPFPAQGHMSPMMQFVKRLAWKGVRITIVLPAEIRDSMQINNSLINTECISFDFDKDDEMPYSMRAYMGVVKLKVTNKLSDLLEKQKTNGYPVNLLVVDSLYPSRVEMCHQLGVKGAPFFTHSCAVGAIYYNARLGKLKIPPEEGLTSVSLPSIPLLGRNDLPIIRTGTFPDLFEHLGNQFSDLDKADWIFFNTFDKLENEEAKWLSSHWPITSIGPLIPSMYLDKQLPNDKDNDINFYKADVGSCIKWLDAKDPGSVVYASFGSVKHNLGDDYMDEVAWGLLHSKYHFIWVVIESERTKLSSDFLAEVEAEEKGLIVSWCPQLEVLSHKSIGSFMTHCGWNSTVEALSLGVPMVAVPQQFDQPVNAKYIVDVWRIGVQVPIGENGVLLRGEVANCIKDVMEGEIGDELRGNALKWKGLAVEAMEKGGSSDKNIDEFISKLVSS

Nucleic acid sequence of Pn50-Q222H-VE, SEQ_ID_NO.42

ATGGAGAGAGAAATGTTGAGCAAAACTCACATTATGTTCATCCCATTCCCAGCTCAAGGCCACATGAGCCCAATGATGCAATTCGTCAAGCGTTTAGCCTGGAAAGGCGTGCGAATCACGATAGTTCTTCCGGCTGAGATTCGAGATTCTATGCAAATAAACAACTCATTGATCAACACTGAGTGCATCTCCTTTGATTTTGATAAAGATGATGAGATGCCATACAGCATGCGGGCTTATATGGGAGTTGTAAAGCTCAAGGTCACAAATAAACTGAGTGACCTACTCGAGAAGCAAAAAACAAATGGCTACCCTGTTAATTTGCTAGTGGTCGATTCATTATATCCATCTCGGGTAGAAATGTGCCACCAACTTGGGGTAAAAGGAGCTCCATTTTTCACTCACTCTTGTGCTGTTGGTGCCATTTATTATAATGCTCGCTTAGGGAAATTGAAGATACCTCCTGAGGAAGGGTTGACTTCTGTTTCATTGCCTTCAATTCCATTGTTGGGGAGAAATGATTTGCCAATTATTAGGACTGGCACCTTTCCTGATCTCTTTGAGCATTTGGGGAATCAGTTTTCAGATCTTGATAAAGCGGATTGGATCTTTTTCAATACTTTTGATAAGCTTGAAAATGAGGAAGCAAAATGGCTATCTAGCCATTGGCCAATTACATCCATCGGACCATTAATCCCTTCAATGTACTTAGACAAACAATTACCAAATGACAAAGACAATGACATTAATTTCTACAAGGCAGACGTCGGATCGTGCATCAAGTGGCTAGACGCCAAAGACCCTGGCTCGGTAGTCTACGCCTCATTCGGGAGCGTGAAGCACAACCTCGGCGATGACTACATGGACGAAGTAGCATGGGGCTTGTTACACAGCAAATATCACTTCATATGGGTTGTTATAGAATCCGAACGTACAAAGCTCTCTAGCGATTTCTTGGCAGAGGTAGAGGCAGAGGAAAAAGGCCTAATAGTGAGTTGGT GCCCTCAACTCGAAGTTTTGTCACATAAATCTATAGGTAGTTTTATGACTCATTGTGGTTGGAACTCGACGGTTGAGGCATTGAGTTTGGGCGTGCCAATGGTGGCAGTGCCACAACAGTTTGATCAGCCTGTTAATGCCAAGTATATCGTGGATGTATGGCGAATTGGGGTTCAGGTTCCGATTGGTGAAAATGGGGTTCTTTTGAGGGGAGAAGTTGCTAACTGTATAAAGGATGTTATGGAGGGGGAAATAGGGGATGAGCTTAGAGGGAATGCTTTGAAATGGAAGGGGTTGGCTGTGGAGGCAATGGAGAAAGGGGGTAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTGA

Example 7. Synthesis of Rh2 in budding yeast using glycosyltransferase mutant genes UGT-MUT1, UGT-MUT2 and UGT-MUT3

The inventors saturated and mutated amino acid residue K at site 280 and/or amino acid residue N at site 247 of Pn50-Q222H-VE to obtain mutants UGT-MUT1, UGT-MUT2 and UGT-MUT3 with improved three catalytic effects. . UGT-MUT1 is a mutation of amino acid residue K at site 280 of Pn50-Q222H-VE to amino acid residue I, and UGT-MUT2 is a mutation of amino acid residue N at site 247 of Pn50-Q222H-VE with amino acid residue S, UGT-MUT3 was obtained by mutating amino acid residue K at site 280 of Pn50-Q222H-VE to amino acid residue I, and mutating amino acid residue N to amino acid residue S at site 247.

(1) Synthesis of 12-stranded primers as in sequence SEQ ID NO: 7-18, promoter, terminator, ORF, selectable marker, upstream and downstream homology arms expressed by glycosyltransferase by the method of PCR A fragment was obtained, and the PCR method was the same as in Example 1. The PCR fragment and the ORF of UGT-MUT1 (Pn50-Q222H-VE-K280I), UGT-MUT2 (Pn50-Q222H-VE-N247S) and UGT-MUT3 (Pn50-Q222H-VE-K280I-N247S) were each 100 ng After mixing, the recombinant budding yeast strain ZWBY04RS was transformed using a conventional LiAc/ssDNA transformation method of budding yeast to obtain recombinant budding yeast strains ZWBY04RS-MUT1, ZWBY04RS-MUT2 and ZWBY04RS-MUT3.

(2) Recombinant budding yeast strains ZWBY04RS-MUT1, ZWBY04RS-MUT2 and ZWBY04RS-MUT3 streaked on a solid medium plate were taken and cultured with shaking overnight in a test tube containing 5 mL of each liquid medium (30 ° C, 250 rpm, 16 hour); Cells were collected by centrifugation, transferred to a 50 mL Erlenmeyer flask containing 10 mL of liquid medium, and cultured for 4 days at 30 ° C. and 250 rpm until OD ₆₀₀ reached 0.05 to obtain a fermentation product. In this method, one parallel experiment was set up for each recombinant yeast at the same time.

Extraction and detection of protophanoxadiol and rare ginsenoside Rh2: Take 100 μL of fermentation broth from 10 mL of fermentation broth, lyse yeast with Fastprep shaking, add equal volume of n-butanol, then n-butanol Evaporate to dryness under vacuum. After dissolving in 100 μL of methanol, the acid amount of the target product was measured by HPLC. HPLC results are shown in FIG. 4 .

The recombinant budding yeast strain ZWBY04RS-MUT constructed by introducing the glycosyltransferase gene UGT-MUT1 derived from Samchil into the budding yeast strain producing protopanoxadiol can synthesize the rare ginsenoside Rh2, and its The acid amount is 67.96 mg/L. The recombinant budding yeast strain ZWBY04RS-MUT2 constructed by introducing the glycosyltransferase gene UGT-MUT2 derived from Samchil into the budding yeast strain producing protopanoxadiol can synthesize the rare ginsenoside Rh2, and its The acid amount is 78.29 mg/L. The recombinant budding yeast strain ZWBY04RS-MUT3 constructed by introducing the glycosyltransferase gene UGT-MUT3 derived from Samchil into the budding yeast strain producing protopanoxadiol can synthesize the rare ginsenoside Rh2, and its The acid amount is 83.53 mg/L.

Glycosyltransferase mutant gene UGT-MUT1 amino acid sequence SEQ_ID_NO.35

MEREMLSKTHIMFIPFPAQGHMSPMMQFVKRLAWKGVRITIVLPAEIRDSMQINNSLINTECISFDFDKDDEMPYSMRAYMGVVKLKVTNKLSDLLEKQKTNGYPVNLLVVDSLYPSRVEMCHQLGVKGAPFFTHSCAVGAIYYNARLGKLKIPPEEGLTSVSLPSIPLLGRNDLPIIRTGTFPDLFEHLGNQFSDLDKADWIFFNTFDKLENEEAKWLSSHWPITSIGPLIPSMYLDKQLPNDKDNDINFYKADVGSCIKWLDAKDPGSVVYASFGSVIHNLGDDYMDEVAWGLLHSKYHFIWVVIESERTKLSSDFLAEVEAEEKGLIVSWCPQLEVLSHKSIGSFMTHCGWNSTVEALSLGVPMVAVPQQFDQPVNAKYIVDVWRIGVQVPIGENGVLLRGEVANCIKDVMEGEIGDELRGNALKWKGLAVEAMEKGGSSDKNIDEFISKLVSS

Glycosyltransferase mutant gene UGT-MUT1 nucleotide sequence SEQ_ID_NO.36

ATGGAGAGAGAAATGTTGAGCAAAACTCACATTATGTTCATCCCATTCCCAGCTCAAGGCCACATGAGCCCAATGATGCAATTCGTCAAGCGTTTAGCCTGGAAAGGCGTGCGAATCACGATAGTTCTTCCGGCTGAGATTCGAGATTCTATGCAAATAAACAACTCATTGATCAACACTGAGTGCATCTCCTTTGATTTTGATAAAGATGATGAGATGCCATACAGCATGCGGGCTTATATGGGAGTTGTAAAGCTCAAGGTCACAAATAAACTGAGTGACCTACTCGAGAAGCAAAAAACAAATGGCTACCCTGTTAATTTGCTAGTGGTCGATTCATTATATCCATCTCGGGTAGAAATGTGCCACCAACTTGGGGTAAAAGGAGCTCCATTTTTCACTCACTCTTGTGCTGTTGGTGCCATTTATTATAATGCTCGCTTAGGGAAATTGAAGATACCTCCTGAGGAAGGGTTGACTTCTGTTTCATTGCCTTCAATTCCATTGTTGGGGAGAAATGATTTGCCAATTATTAGGACTGGCACCTTTCCTGATCTCTTTGAGCATTTGGGGAATCAGTTTTCAGATCTTGATAAAGCGGATTGGATCTTTTTCAATACTTTTGATAAGCTTGAAAATGAGGAAGCAAAATGGCTATCTAGCCATTGGCCAATTACATCCATCGGACCATTAATCCCTTCAATGTACTTAGACAAACAATTACCAAATGACAAAGACAATGACATTAATTTCTACAAGGCAGACGTCGGATCGTGCATCAAGTGGCTAGACGCCAAAGACCCTGGCTCGGTAGTCTACGCCTCATTCGGGAGCGTGATTCACAACCTCGGCGATGACTACATGGACGAAGTAGCATGGGGCTTGTTACACAGCAAATATCACTTCATATGGGTTGTTATAGAATCCGAACGTACAAAGCTCTCTAGCGATTTCTTGGCAGAGGTAGAGGCAGAGGAAAAAGGCCTAATAGTGAGTTGGT GCCCTCAACTCGAAGTTTTGTCACATAAATCTATAGGTAGTTTTATGACTCATTGTGGTTGGAACTCGACGGTTGAGGCATTGAGTTTGGGCGTGCCAATGGTGGCAGTGCCACAACAGTTTGATCAGCCTGTTAATGCCAAGTATATCGTGGATGTATGGCGAATTGGGGTTCAGGTTCCGATTGGTGAAAATGGGGTTCTTTTGAGGGGAGAAGTTGCTAACTGTATAAAGGATGTTATGGAGGGGGAAATAGGGGATGAGCTTAGAGGGAATGCTTTGAAATGGAAGGGGTTGGCTGTGGAGGCAATGGAGAAAGGGGGTAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTGA

Glycosyltransferase mutant gene UGT-MUT2 amino acid sequence SEQ_ID_NO.37

MEREMLSKTHIMFIPFPAQGHMSPMMQFVKRLAWKGVRITIVLPAEIRDSMQINNSLINTECISFDFDKDDEMPYSMRAYMGVVKLKVTNKLSDLLEKQKTNGYPVNLLVVDSLYPSRVEMCHQLGVKGAPFFTHSCAVGAIYYNARLGKLKIPPEEGLTSVSLPSIPLLGRNDLPIIRTGTFPDLFEHLGNQFSDLDKADWIFFNTFDKLENEEAKWLSSHWPITSIGPLIPSMYLDKQLPNDKDSDINFYKADVGSCIKWLDAKDPGSVVYASFGSVKHNLGDDYMDEVAWGLLHSKYHFIWVVIESERTKLSSDFLAEVEAEEKGLIVSWCPQLEVLSHKSIGSFMTHCGWNSTVEALSLGVPMVAVPQQFDQPVNAKYIVDVWRIGVQVPIGENGVLLRGEVANCIKDVMEGEIGDELRGNALKWKGLAVEAMEKGGSSDKNIDEFISKLVSS

Glycosyltransferase mutant gene UGT-MUT2 nucleotide sequence SEQ_ID_NO.38

ATGGAGAGAGAAATGTTGAGCAAAACTCACATTATGTTCATCCCATTCCCAGCTCAAGGCCACATGAGCCCAATGATGCAATTCGTCAAGCGTTTAGCCTGGAAAGGCGTGCGAATCACGATAGTTCTTCCGGCTGAGATTCGAGATTCTATGCAAATAAACAACTCATTGATCAACACTGAGTGCATCTCCTTTGATTTTGATAAAGATGATGAGATGCCATACAGCATGCGGGCTTATATGGGAGTTGTAAAGCTCAAGGTCACAAATAAACTGAGTGACCTACTCGAGAAGCAAAAAACAAATGGCTACCCTGTTAATTTGCTAGTGGTCGATTCATTATATCCATCTCGGGTAGAAATGTGCCACCAACTTGGGGTAAAAGGAGCTCCATTTTTCACTCACTCTTGTGCTGTTGGTGCCATTTATTATAATGCTCGCTTAGGGAAATTGAAGATACCTCCTGAGGAAGGGTTGACTTCTGTTTCATTGCCTTCAATTCCATTGTTGGGGAGAAATGATTTGCCAATTATTAGGACTGGCACCTTTCCTGATCTCTTTGAGCATTTGGGGAATCAGTTTTCAGATCTTGATAAAGCGGATTGGATCTTTTTCAATACTTTTGATAAGCTTGAAAATGAGGAAGCAAAATGGCTATCTAGCCATTGGCCAATTACATCCATCGGACCATTAATCCCTTCAATGTACTTAGACAAACAATTACCAAATGACAAAGACAGCGACATTAATTTCTACAAGGCAGACGTCGGATCGTGCATCAAGTGGCTAGACGCCAAAGACCCTGGCTCGGTAGTCTACGCCTCATTCGGGAGCGTGAAGCACAACCTCGGCGATGACTACATGGACGAAGTAGCATGGGGCTTGTTACACAGCAAATATCACTTCATATGGGTTGTTATAGAATCCGAACGTACAAAGCTCTCTAGCGATTTCTTGGCAGAGGTAGAGGCAGAGGAAAAAGGCCTAATAGTGAGTTGGT GCCCTCAACTCGAAGTTTTGTCACATAAATCTATAGGTAGTTTTATGACTCATTGTGGTTGGAACTCGACGGTTGAGGCATTGAGTTTGGGCGTGCCAATGGTGGCAGTGCCACAACAGTTTGATCAGCCTGTTAATGCCAAGTATATCGTGGATGTATGGCGAATTGGGGTTCAGGTTCCGATTGGTGAAAATGGGGTTCTTTTGAGGGGAGAAGTTGCTAACTGTATAAAGGATGTTATGGAGGGGGAAATAGGGGATGAGCTTAGAGGGAATGCTTTGAAATGGAAGGGGTTGGCTGTGGAGGCAATGGAGAAAGGGGGTAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTGA

Glycosyltransferase mutant gene UGT-MUT3 amino acid sequence SEQ_ID_NO.39

MEREMLSKTHIMFIPFPAQGHMSPMMQFVKRLAWKGVRITIVLPAEIRDSMQINNSLINTECISFDFDKDDEMPYSMRAYMGVVKLKVTNKLSDLLEKQKTNGYPVNLLVVDSLYPSRVEMCHQLGVKGAPFFTHSCAVGAIYYNARLGKLKIPPEEGLTSVSLPSIPLLGRNDLPIIRTGTFPDLFEHLGNQFSDLDKADWIFFNTFDKLENEEAKWLSSHWPITSIGPLIPSMYLDKQLPNDKDSDINFYKADVGSCIKWLDAKDPGSVVYASFGSVIHNLGDDYMDEVAWGLLHSKYHFIWVVIESERTKLSSDFLAEVEAEEKGLIVSWCPQLEVLSHKSIGSFMTHCGWNSTVEALSLGVPMVAVPQQFDQPVNAKYIVDVWRIGVQVPIGENGVLLRGEVANCIKDVMEGEIGDELRGNALKWKGLAVEAMEKGGSSDKNIDEFISKLVSS

Glycosyltransferase mutant gene UGT-MUT3 nucleotide sequence SEQ_ID_NO.40

ATGGAGAGAGAAATGTTGAGCAAAACTCACATTATGTTCATCCCATTCCCAGCTCAAGGCCACATGAGCCCAATGATGCAATTCGTCAAGCGTTTAGCCTGGAAAGGCGTGCGAATCACGATAGTTCTTCCGGCTGAGATTCGAGATTCTATGCAAATAAACAACTCATTGATCAACACTGAGTGCATCTCCTTTGATTTTGATAAAGATGATGAGATGCCATACAGCATGCGGGCTTATATGGGAGTTGTAAAGCTCAAGGTCACAAATAAACTGAGTGACCTACTCGAGAAGCAAAAAACAAATGGCTACCCTGTTAATTTGCTAGTGGTCGATTCATTATATCCATCTCGGGTAGAAATGTGCCACCAACTTGGGGTAAAAGGAGCTCCATTTTTCACTCACTCTTGTGCTGTTGGTGCCATTTATTATAATGCTCGCTTAGGGAAATTGAAGATACCTCCTGAGGAAGGGTTGACTTCTGTTTCATTGCCTTCAATTCCATTGTTGGGGAGAAATGATTTGCCAATTATTAGGACTGGCACCTTTCCTGATCTCTTTGAGCATTTGGGGAATCAGTTTTCAGATCTTGATAAAGCGGATTGGATCTTTTTCAATACTTTTGATAAGCTTGAAAATGAGGAAGCAAAATGGCTATCTAGCCATTGGCCAATTACATCCATCGGACCATTAATCCCTTCAATGTACTTAGACAAACAATTACCAAATGACAAAGACAGCGACATTAATTTCTACAAGGCAGACGTCGGATCGTGCATCAAGTGGCTAGACGCCAAAGACCCTGGCTCGGTAGTCTACGCCTCATTCGGGAGCGTGATTCACAACCTCGGCGATGACTACATGGACGAAGTAGCATGGGGCTTGTTACACAGCAAATATCACTTCATATGGGTTGTTATAGAATCCGAACGTACAAAGCTCTCTAGCGATTTCTTGGCAGAGGTAGAGGCAGAGGAAAAAGGCCTAATAGTGAGTTGGT GCCCTCAACTCGAAGTTTTGTCACATAAATCTATAGGTAGTTTTATGACTCATTGTGGTTGGAACTCGACGGTTGAGGCATTGAGTTTGGGCGTGCCAATGGTGGCAGTGCCACAACAGTTTGATCAGCCTGTTAATGCCAAGTATATCGTGGATGTATGGCGAATTGGGGTTCAGGTTCCGATTGGTGAAAATGGGGTTCTTTTGAGGGGAGAAGTTGCTAACTGTATAAAGGATGTTATGGAGGGGGAAATAGGGGATGAGCTTAGAGGGAATGCTTTGAAATGGAAGGGGTTGGCTGTGGAGGCAATGGAGAAAGGGGGTAGCTCTGATAAGAATATTGATGAGTTCATTTCAAAGCTTGTTTCCTCCTAA

debate

Currently, the research team found a large number of glycosyltransferase candidate genes through transcriptomic analysis of ginseng, Hwagisam and ginseng, but only a very small number of glycosyltransferases were found to be involved in the synthesis of ginsenosides. A glycosyltransferase involved in ginsenoside synthesis in Samchil has not been reported so far. Since ginseng also synthesizes the same ginsenosides, glycosyltransferase derived from ginsenosides, on the one hand, allows these two plants to better understand the convolutional pathway for synthesizing ginsenosides, and on the other hand, the synthesis of ginsenosides It can provide a richer component to synthetic biology research, which has important implications.

All publications mentioned herein are incorporated herein by reference as if each publication was incorporated by reference in its entirety. In addition, after reading the above content of the present invention, those skilled in the art may make various changes or modifications to the present invention, and it should be understood that such equivalent forms also fall within the scope defined by the claims appended hereto.

<110> SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES <120> glycosyltransferase, mutant, and application thereof <130> PIPB194370CN <150> CN 201710344730.7 <151> 2017-05-16 <160> 42 <170> KoPatentIn 3.0 < 210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer Forward <400> 1 atggagagag aaatgttgag ca 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence < 220> <223> Primer reverse <400> 2 tcaggaggaa acaagctttg aa 22 <210> 3 <211> 1368 <212> DNA <213> Artificial Sequence <220> <223> Pn50 necleotide sequence <400> 3 atggagagag aaatgttgag caaaactcac attatgttca tcccattccc agctcaaggc 60 cacatgagcc caatgatgca attcgtcaag cgtttagcct ggaaaggcgt gcgaatcacg 120 atagttcttc cggctgagat tcgagattct atgcaaataa acaactcatt gatcaacact 180 gagtgcatct cctttgattt tgataaagat gatgagatgc catacagcat gcgggcttat 240 atgggagttg taaagctcaa ggtcacaaat aaactgagtg acctactcga gaagcaaaaa 300 acaaatggct accctgttaa tttgctagtg gtcgattcat tatatccatc tcgggtagaa 360 atgtgccacc aacttggggt aaaaggagct ccatttttca ctcactcttg tgctgttggt 420 gccatttatt ataatgctcg cttagggaaa ttgaagatac ctcctgagga agggttgact 480 tctgtttcat tgccttcaat tccattgttg gggagaaatg atttgccaat tattaggact 540 ggcacctttc ctgatctctt tgagcatttg gggaatcagt tttcagatct tgataaagcg 600 gattggatct ttttcaatac ttttgataag cttgaaaatg aggaagcaaa atggctatct 660 agccaatggc caattacatc catcggacca ttaatccctt caatgtactt agacaaacaa 720 ttaccaaatg acaaagacaa tgacattaat ttctacaagg cagacgtcgg atcgtgcatc 780 aagtggctag acgccaaaga ccctggctcg gtagtctacg cctcattcgg gagcgtgaag 840 cacaacctcg gcgatgacta catggacgaa gtagcatggg gcttgttaca cagcaaatat 900 cacttcatat gggttgttat agaatccgaa cgtacaaagc tctctagcga tttcttggca 960 gaggcagagg aaaaaggcct aatagtgagt tggtgccctc aactcgaagt tttgtcacat 1020 aaatctatag gtagttttat gactcattgt ggttggaact cgacggttga ggcattgagt 1080 ttgggcgtgc caatggtggc agtgccacaa cagtttgatc agcctgttaa tgccaagtat 1140 atcgtggatg tatggcgaat tggggttcag gttccgattg gtgaaaatgg ggttcttttg 1200 aggggagaag ttgctaactg tataaaggat gtta tggagg gggaaatagg ggatgagctt 1260 agagggaatg ctttgaaatg gaaggggttg gctgtggagg caatggagaa agggggtagc 1320 tctgataaga atattgatga gttcattttca aagctt213ttt Glue sequence amino acid sequence aagctt213gtt ctt cctcct 213 < 4212 Artificial cctcct < 211 400 <21050 Arg Glu Met Leu Ser Lys Thr His Ile Met Phe Ile Pro Phe 1 5 10 15 Pro Ala Gln Gly His Met Ser Pro Met Met Gln Phe Val Lys Arg Leu 20 25 30 Ala Trp Lys Gly Val Arg Ile Thr Ile Val Leu Pro Ala Glu Ile Arg 35 40 45 Asp Ser Met Gln Ile Asn Asn Ser Leu Ile Asn Thr Glu Cys Ile Ser 50 55 60 Phe Asp Phe Asp Lys Asp Asp Glu Met Pro Tyr Ser Met Arg Ala Tyr 65 70 75 80 Met Gly Val Val Lys Leu Lys Val Thr Asn Lys Leu Ser Asp Leu Leu 85 90 95 Glu Lys Gln Lys Thr Asn Gly Tyr Pro Val Asn Leu Leu Val Val Asp 100 105 110 Ser Leu Tyr Pro Ser Arg Val Glu Met Cys His Gln Leu Gly Val Lys 115 120 125 Gly Ala Pro Phe Phe Thr His Ser Cys Ala Val Gly Ala Ile Tyr Tyr 13 0 135 140 Asn Ala Arg Leu Gly Lys Leu Lys Ile Pro Pro Glu Glu Gly Leu Thr 145 150 155 160 Ser Val Ser Leu Pro Ser Ile Pro Leu Leu Gly Arg Asn Asp Leu Pro 165 170 175 Ile Ile Arg Thr Gly Thr Phe Pro Asp Leu Phe Glu His Leu Gly Asn 180 185 190 Gln Phe Ser Asp Leu Asp Lys Ala Asp Trp Ile Phe Phe Asn Thr Phe 195 200 205 Asp Lys Leu Glu Asn Glu Glu Ala Lys Trp Leu Ser Ser Gln Trp Pro 210 215 220 Ile Thr Ser Ile Gly Pro Leu Ile Pro Ser Met Tyr Leu Asp Lys Gln 225 230 235 240 Leu Pro Asn Asp Lys Asp Asn Asp Ile Asn Phe Tyr Lys Ala Asp Val 245 250 255 Gly Ser Cys Ile Lys Trp Leu Asp Ala Lys Asp Pro Gly Ser Val Val 260 265 270 Tyr Ala Ser Phe Gly Ser Val Lys His Asn Leu Gly Asp As p Tyr Met 275 280 285 Asp Glu Val Ala Trp Gly Leu Leu His Ser Lys Tyr His Phe Ile Trp 290 295 300 Val Val Ile Glu Ser Glu Arg Thr Lys Leu Ser Ser Asp Phe Leu Ala 305 310 315 320 Glu Ala Glu Glu Lys Gly Leu Ile Val Ser Trp Cys Pro Gln Leu Glu 325 330 335 Val Leu Ser His Lys Ser Ile Gly Ser Phe Met Thr His Cys Gly Trp 340 345 350 Asn Ser Thr Val Glu Ala Leu Ser Leu Gly Val Pro Met Val Ala Val 355 360 365 Pro Gln Gln Phe Asp Gln Pro Val Asn Ala Lys Tyr Ile Val Asp Val 370 375 380 Trp Arg Ile Gly Val Gln Val Pro Ile Gly Glu Asn Gly Val Leu Leu 385 390 395 400 Arg Gly Glu Val Ala Asn Cys Ile Lys Asp Val Met Glu Gly Glu Ile 405 410 415 Gly Asp Glu Leu Arg Gly Asn Ala Leu Lys Tr p Lys Gly Leu Ala Val 420 425 430 Glu Ala Met Glu Lys Gly Gly Ser Ser Asp Lys Asn Ile Asp Glu Phe 435 440 445 Ile Ser Lys Leu Val Ser 450 455 <210> 5 <211> 28 <212> DNA < 213> Artificial Sequence <220> <223> Pn50 expression Primer Forward <400> 5 ggatccatgg agagagaaat gttgagca 28 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Pn50 expression Primer reverse < 400> 6 ctcgagtcag gaggaaacaa gctttgaa 28 <210> 7 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> promoter Primer Forward <400> 7 tagctctgat aagaatattg atgagttcat ttcaaagctt gtttcctcct gagatt 56 <210> 8 <211 > 69 <212> DNA <213> Artificial Sequence <220> <223> promoter Primer reverse <400> 8 actgtcaagg agggtattct gggcctccat gtcgctgcta tataacagtt gaaatttgga 60 taagaacat 69 <210> 9 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> ORF Primer Forward <400> 9 gctatactgc tgtcgattcg atactaacgc cgccatccag tgtcgagaat tacaatagt 59 <210> 10 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> ORF Primer reverse <400> 10 tctggtgagg atttacggta tgatcatgct <ggtaagcttc <ggtaagcttc> 59 <212> DNA <213> Artificial Sequence <220> <223> terminator Primer Forward <400> 11 gaaaagaaga taatattttt atataattat attaatctca ggaggaaaca agctttgaa 59 <210> 12 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> terminator Primer reverse <400> 12 gcatagcaat ctaatctaag ttttaattac aaaatggaga gagaaatgtt gagcaaaac 59 <210> 13 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> selection marker Primer Forward <400> 13 cgcgttgaga agatgttctt atccaaattt caactgttat atagcagcga 50 <210> 14 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> selection marker Primer reverse <400> 14 ttacttcttg cagacatcag acatactatt gtaattctcg acactggatg gcggcgtta 59 <210> 15 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Upstream homology arm primer Forward <400> 15 ggctgtcgcc attcaagagc agatagcttc aaaatgtttc tactcctttt ttactcttc 59 <210> 16 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> Upstream homology arm Primer reverse <400> 16 taatgtga gtttttgctca < acattttt 59 ctatattttt 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> downstream homology arm Primer Forward <400> 17 cccaaagcta agagtcccat tttattc 27 <210> 18 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> downstream homology arm Primer reverse <400> 18 gagtagaaac attttgaagc tatctgctct tgaatggcga cagcctattg ccccagtgt 59 <210> 19 <211> 457 <212> PRT <213> Artificial Sequence <220> <223> UGTPg45 amino acid sequence < 400> 19 Met Glu Arg Glu Met Leu Ser Lys Thr His Ile Met Phe Ile Pro Phe 1 5 10 15 Pro Ala Gln Gly His Met Ser Pro Met Met Gln Phe Ala Lys Arg Leu 20 25 30 Ala Trp Lys Gly Leu Arg Ile Thr Ile Val Leu Pro Ala Gln Ile Arg 35 40 45 Asp Phe Met Gln Ile Thr Asn Pro Leu Ile Asn Thr Glu Cys Ile Ser 50 55 60 Phe Asp Phe Asp Lys Asp Asp Gly Met Pro Tyr Ser Met Gln Ala Tyr 65 70 75 80 Met Gly Val Val Lys Leu Lys Val Thr Asn Lys Leu Ser Asp Leu Leu 85 90 95 Glu Lys Gln Arg Thr Asn Gly Tyr Pro Val Asn Leu Leu Val Val Asp 100 105 110 Ser Leu Tyr Pro Ser Arg Val Glu Met Cys His Gln Leu Gly Val Lys 115 120 125 Gly Ala Pro Phe Phe Thr His Ser Cys Ala Val Gly Ala Ile Tyr Tyr 130 135 140 Asn Ala Arg Leu Gly Lys Leu Lys Ile Pro Pro Glu Glu Gly Leu Thr 145 150 155 160 Ser Val Ser Leu Pro Ser Ile Pro Leu Leu Gly Arg Asp Asp Leu Pro 165 170 175 Ile Ile Arg Thr Gly Thr Phe Pro Asp Leu Phe Glu His Leu Gly Asn 180 185 190 Gln Phe Ser Asp Leu Asp Lys Ala Asp Trp Ile Phe Phe Asn Thr Phe 195 200 205 Asp Lys Leu Glu Asn Glu Glu Ala Lys Trp Leu Ser Ser Gln Trp Pro 210 215 220 Ile Thr Ser Ile Gly Pro Leu Ile Pro Ser Met Tyr Leu Asp Lys Gln 225 230 235 240 Leu Pro Asn Asp Lys Asp Asn Gly Ile Asn Phe Tyr Lys Ala Asp Val 245 250 255 Gly Ser Cys Ile Lys Trp Leu Asp Ala Lys Asp Pro Gly Ser Val Val 260 265 270 Tyr Ala Ser Phe Gly Ser Val Lys His Asn Leu Gly Asp Asp Tyr Met 275 280 285 Asp Glu Val Ala Trp Gly Leu Leu His Ser Lys Tyr His Phe Ile Trp 290 295 300 Val Val Ile Glu Ser Glu Arg Thr Lys Leu Ser Ser Asp Phe Leu Ala 305 310 315 320 Glu Ala Glu Ala Glu Glu Lys Gly Leu Ile Val Ser Trp Cys Pro Gln 325 330 335 Leu Gln Val Leu Ser His Lys Ser Ile Gly Ser Phe Met Thr His Cys 340 345 350 Gly Trp Asn Ser Thr Val Glu Ala Leu Ser Leu Gly Val Pro Met Val 355 360 365 Ala Leu Pro Gln Gln Phe Asp Gln Pro Ala Asn Ala Lys Tyr Ile Val 370 375 380 Asp Val Trp Gln Ile Gly Val Arg Val Pro Ile Gly Glu Glu Gly Val 385 390 395 400 Val Leu Arg Gly Glu Val Ala Asn Cys Ile Lys Asp Val Met Glu Gly 405 410 415 Glu Ile Gly Asp Glu Leu Arg Gly Asn Ala Leu Lys Trp Lys Gly Leu 420 425 430 Ala Val Glu Ala Met Glu Lys Gly Gly Ser Ser Asp Lys Asn Ile Asp 435 440 445 Glu Phe Ile Ser Lys Leu Val Ser 450 455 <210> 20 <211> 1374 <212> DNA <213> Artificial Sequence <220> <223> UGTPg45 nucleotide sequence <400> 20 atggagagag aaatgttgag caaaactcac attatgttca tcccattccc agctcaaggc 60 caatgatgca attcgcc agctcaaggc tag cagtgagcc ggaaaggcct gcgaatcacg 120 atagttcttc cggctcaaat tcgagatttc atgcaaataa ccaacccatt gatcaacact 180 gagtgcatct cctttgattt tgataaa gac gatgggatgc catacagcat gcaggcttat 240 atgggagttg taaaactcaa ggtcacaaat aaactgagtg acctactcga gaagcaaaga 300 acaaatggct accctgttaa tttgctagtg gttgattcat tatatccatc tcgggtagaa 360 atgtgccacc aacttggggt aaaaggagct ccatttttca ctcactcttg tgctgttggt 420 gccatttatt ataatgctcg cttagggaaa ttgaagatac ctcctgagga agggttgact 480 tctgtttcat tgccttcaat tccattgttg gggagagatg atttgccaat tattaggact 540 ggcacctttc ctgatctctt tgagcatttg gggaatcagt tttcagatct tgataaagcg 600 gattggatct ttttcaatac ttttgataag cttgaaaatg aggaagcaaa atggctatct 660 agccaatggc caattacatc catcggacca ttaatccctt caatgtactt agacaaacaa 720 ttaccaaatg acaaagacaa tggcattaat ttctacaagg cagacgtcgg atcgtgcatc 780 aagtggctag acgccaaaga ccctggctcg gtagtctacg cctcattcgg gagcgtgaag 840 cacaacctcg gcgatgacta catggacgaa gtagcatggg gcttgttaca tagcaaatat 900 cacttcatat gggttgttat agaatccgaa cgtacaaagc tctctagcga tttcttggca 960 gaggcagagg cagaggaaaa aggcctaata gtgagttggt gccctcaact ccaagttttg 1020 tcacataaat ctatagggag ttttatgact cattgtggtt ggaa ctcgac ggttgaggca 1080 ttgagtttgg gcgtgccaat ggtggcactg ccacaacagt ttgatcagcc tgctaatgcc 1140 aagtatatcg tggatgtatg gcaaattggg gttcgggttc cgattggtga agagggggtt 1200 gttttgaggg gagaagttgc taactgtata aaggatgtta tggaggggga aataggggat 1260 gagcttagag ggaatgcttt gaaatggaag gggttggctg tggaggcaat ggagaaaggg 1320 ggtagctctg ataagaatat tgatgagttc atttcaaagc ttgtttcctc ctga 1374 <210> 21 <211> 457 <212> PRT <213> Artificial Sequence <220> <223> 8E7 amino acid sequence <400> 21 Met Glu Arg Glu Met Leu Ser Lys Thr His Ile Met Phe Ile Pro Phe 1 5 10 15 Pro Ala Gln Gly His Met Ser Pro Met Met Gln Phe Ala Lys Arg Leu 20 25 30 Ala Trp Lys Gly Leu Arg Ile Thr Ile Val Leu Pro Ala Gln Ile Arg 35 40 45 Asp Phe Met Gln Ile Thr Asn Pro Leu Ile Asn Thr Glu Cys Ile Ser 50 55 60 Phe Asp Phe Asp Lys Asp Asp Gly Met Pro Tyr Ser Met Gln Ala Tyr 65 70 75 80 Met Gly Val Val Lys Leu Lys Val Thr Asn Lys Leu Ser Asp Leu Leu 85 90 95 Glu Lys Gln Arg Thr Asn Gly Tyr Pro Val Asn Leu Leu Val Val Asp 100 105 110 Ser Leu Tyr Pro Ser Arg Val Glu Met Cys His Gln Leu Gly Val Lys 115 120 125 Gly Ala Pro Phe Phe Thr His Ser Cys Ala Val Gly Ala Ile Tyr Tyr 130 135 140 Asn Ala Arg Leu Gly Lys Leu Lys Ile Pro Pro Glu Glu Gly Leu Thr 145 150 155 160 Ser Val Ser Leu Pro Ser Ile Pro Leu Leu Gly Arg Asp Asp Leu Pro 165 170 175 Ile Ile Arg Thr Gly Thr Phe Pro Asp Leu Phe Glu His Leu Gly Asn 180 185 190 Gln Phe Ser Asp Leu Asp Lys Ala Asp Trp Ile Phe Phe Asn Thr Phe 195 200 205 Asp Lys Leu Glu Asn Glu Glu Ala Lys Trp Leu Ser Ser His Trp Pro 210 215 220 Ile Thr Ser Ile Gly Pro Leu Ile Pro Ser Met Tyr Leu Asp Lys Gln 225 230 235 240 Leu Pro Asn Asp Lys Asp Asn Gly Ile Asn Phe Tyr Lys Ala Asp Val 245 250 255 Gly Ser Cys Ile Lys Trp Leu Asp Ala Lys Asp Pro Gly Ser Val Val 260 265 270 Tyr Ala Ser Phe Gly Ser Val Lys His Asn Leu Gly Asp Asp Tyr Met 275 280 285 Asp Glu Val Ala Trp Gly Leu Leu His Ser Lys Tyr His Phe Ile Trp 290 295 300 Val Val Ile Glu Ser Glu Arg Thr Lys Leu Ser Ser Asp Phe Leu Ala 305 310 315 320 Glu Val Glu Ala Glu Glu Lys Gly Leu Ile Val Ser Trp Cys Pro Gln 325 330 335 Leu Gln Val Leu Ser His Lys Ser Ile Gly Ser Phe Met Thr His Cys 340 345 350 Gly Trp Asn Ser Thr Val Glu Ala Leu Ser Leu Gly Val Pro Met Val 355 360 365 Ala Leu Pro Gln Gln Phe Asp Gln Pro Ala Asn Ala Lys Tyr Ile Val 370 375 380 Asp Val Trp Gln Ile Gly Val Arg Val Pro Ile Gly Glu Glu Gly Val 385 390 395 400 Val Leu Arg Gly Glu Val Ala Asn Cys Ile Lys Asp Val Met Glu Gly 405 410 415 Glu Ile Gly Asp Glu Leu Arg Gly Asn Ala Leu Lys Trp Lys Gly Leu 420 425 430 Ala Val Glu Ala Met Glu Lys Gly Gly Ser Ser Asp Lys Asn Ile Asp 435 440 445 Glu Phe Ile Ser Lys Leu Val Ser Ser 450 455 <210> 22 <211> 1374 <212> DNA <213> Artificial Sequence <220> <223> 8E7 nucleotide sequence <400> 22 atggagagag aaatgttgag caaaactcac attatgttca tcccattccc agctcaaggc 60 cacatgagcc caatgatgca attcgccaag cgtttagcct ggaaaggcct gcgaatcacg 120 atagttcttc cggctcaaat tcgagatttc atgcaaataa ccaacccatt gatcaacact 180 gagtgcatct cctttgattt tgataaagac gatgggatgc catacagcat gcaggcttat 240 atgggagttg taaaactcaa ggtcacaaat aaactgagtg acctactcga gaagcaaaga 300 acaaatggct accctgttaa tttgctagtg gttgattcat tatatccatc tcgggtagaa 360 atgtgccacc aacttggggt aaaaggagct cca tttttca ctcactcttg tgctgttggt 420 gccatttatt ataatgctcg cttagggaaa ttgaagatac ctcctgagga agggttgact 480 tctgtttcat tgccttcaat tccattgttg gggagagatg atttgccaat tattaggact 540 ggcacctttc ctgatctctt tgagcatttg gggaatcagt tttcagatct tgataaagcg 600 gattggatct ttttcaatac ttttgataag cttgaaaatg aggaagcaaa atggctatct 660 agccattggc caattacatc catcggacca ttaatccctt caatgtactt agacaaacaa 720 ttaccaaatg acaaagacaa tggcattaat ttctacaagg cagacgtcgg atcgtgcatc 780 aagtggctag acgccaaaga ccctggctcg gtagtctacg cctcattcgg gagcgtgaag 840 cacaacctcg gcgatgacta catggacgaa gtagcatggg gcttgttaca tagcaaatat 900 cacttcatat gggttgttat agaatccgaa cgtacaaagc tctctagcga tttcttggca 960 gaggtagagg cagaggaaaa aggcctaata gtgagttggt gccctcaact ccaagttttg 1020 tcacataaat ctatagggag ttttatgact cattgtggtt ggaactcgac ggttgaggca 1080 ttgagtttgg gcgtgccaat ggtggcactg ccacaacagt ttgatcagcc tgctaatgcc 1140 aagtatatcg tggatgtatg gcaaattggg gttcgggttc cgattggtga agagggggtt 1200 gttttgaggg gagaagttgc taactgtata aaggatgtta tggaggggga aataggggat 1260 gagcttagag ggaatgcttt gaaatggaag gggttggctg tggaggcaat ggagaaaggg 1320 ggtagctctg ataagaatat tgatgagttc atttcaaagc ttgtttcctc ctga 1374 <210> 23 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> UGTPg45 random mutation Primer Forward <400> 23 gcatagcaat ctaatctaag ttttaattac aaaatggaga g agaaatgtt gagcaaaac 59 <210> 24 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> UGTPg45 random mutation Primer reverse <400> 24 gaaaagaaga taatattttt atataattat attaatctca ggaggaaaca agctttgaa 59 <210> 25 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> fragment 7 Primer Forward <400> 25 acactggggc aataggctgt cgccattcaa gagcagatag cttcaaaatg tttctactc 59 <210> 26 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> fragment 7 Primer reverse <400> 26 cataatgtga gttttgctca acatttctct ctccattttg taattaaaac ttagattag 59 <210> 27 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> fragment 8 Primer Forward <400> 27 ttgatgagtt catttcaaag cttgtttcct cctgagatta atataattat ataaaaata 59 <210> 28 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> fragment 8 Primer reverse <400> 28 actgtcaagg agggtattct ggg210cctccat gtcgctgcta tataacagtt <gaaattgg> 29 > 27 <212> DNA <213> Artificial Sequence <220> <223> fragment 9 Primer Forward <400> 29 cccaaagcta agagtcc cat tttattc 27 <210> 30 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> fragment 9 Primer reverse <400> 30 gaagagtaaa aaaggagtag aaacattttg aagctatctg ctcttgaatg gcgacagcc 59 <210> 31 <211> 59 < 212> DNA <213> Artificial Sequence <220> <223> fragment 10 Primer Forward <400> 31 tgtcgattcg atactaacgc cgccatccag tgtcgagaat tacaatagta tgtctgatg 59 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> < 223> fragment 10 Primer reverse <400> 32 tctggtgagg atttacggta tg 22 <210> 33 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> fragment 11 Primer Forward <400> 33 aagatgttct tatccaaatt tcaactgtta tatagcagcg acatggaggc ccagaatac 59 <210> 34 <211> 59 <212> DNA <213> Artificial Sequence <220> <223> fragment 11 Primer reverse <400> 34 tacttcttgc agacatcaga catactattg taattctcga cactggatgg cggcgttag 59 <210> 35 <211> 457 <212 > PRT <213> Artificial Sequence <220> <223> UGT-MUT1 amino acid sequence <400> 35 Met Glu Arg Glu Met Leu Ser Lys Thr His Ile Met Phe Ile Pro Phe 1 5 10 15 Pro Ala Gln Gly His Met Ser Pro Met Met Gln Phe Val Lys Arg Leu 20 25 30 Ala Trp Lys Gly Val Arg Ile Thr Ile Val Leu Pro Ala Glu Ile Arg 35 40 45 Asp Ser Met Gln Ile Asn Asn Ser Leu Ile Asn Thr Glu Cys Ile Ser 50 55 60 Phe Asp Phe Asp Lys Asp Asp Glu Met Pro Tyr Ser Met Arg Ala Tyr 65 70 75 80 Met Gly Val Val Lys Leu Lys Val Thr Asn Lys Leu Ser Asp Leu Leu 85 90 95 Glu Lys Gln Lys Thr Asn Gly Tyr Pro Val Asn Leu Leu Val Val Asp 100 105 110 Ser Leu Tyr Pro Ser Arg Val Glu Met Cys His Gln Leu Gly Val Lys 115 120 125 Gly Ala Pro Phe Phe Thr His Ser Cys Ala Val Gly Ala Ile Tyr Tyr 130 135 140 Asn Ala Arg Leu Gly Lys Leu Lys Ile Pro Pro Glu Glu Gly Leu Thr 145 150 155 160 Ser Val Ser Leu Pro Ser Ile Pro Leu Leu Gly Arg Asn Asp Leu Pro 165 170 175 Ile Ile Arg Thr Gly Thr Phe Pro Asp Leu Phe Glu His Leu Gly Asn 180 185 190 Gln Phe Ser Asp Leu Asp Lys Ala Asp Trp Ile Phe Phe Asn Thr Phe 195 200 205 Asp Lys Leu Glu Asn Glu Glu Ala Lys Trp Leu Ser Ser His Trp Pro 210 215 220 Ile Thr Ser Ile Gly Pro Leu Ile Pro Ser Met Tyr Leu Asp Lys Gln 225 230 235 240 Leu Pro Asn Asp Lys Asp Asn Asp Ile Asn Phe Tyr Lys Ala Asp Val 245 250 255 Gly Ser Cys Ile Lys Trp Leu Asp Ala Lys Asp Pro Gly Ser Val Val 260 265 270 Tyr Ala Ser Phe Gly Ser Val Ile His Asn Leu Gly Asp Asp Tyr Met 275 280 285 Asp Glu Val Ala Trp Gly Leu Leu His Ser Lys Tyr His Phe Ile Trp 290 295 300 Val Val Ile Glu Ser Glu Arg Thr Lys Leu Ser Ser Asp Phe Leu Ala 305 310 315 320 Glu Val Glu Ala Glu Glu Lys Gly Leu Ile Val Ser Trp Cys Pro Gln 325 330 335 Leu Glu Val Leu Ser His Lys Ser Ile Gly Ser Phe Met Thr His Cys 340 345 350 Gly Trp Asn Ser Thr Val Glu Ala Leu Ser Leu Gly Val Pro Met Val 355 360 365 Ala Val Pro Gln Gln Phe Asp Gln Pro Val Asn Ala Lys Tyr Ile Val 370 375 380 Asp Val Trp Arg Ile Gly Val Gln Val Pro Ile Gly Glu Asn Gly Val 385 390 395 400 Leu Leu Arg Gly Glu Val Ala Asn Cys Ile Lys Asp Val Met Glu Gly 405 410 415 Glu Ile Gly Asp Glu Leu Arg Gly Asn Ala Leu Lys Trp Lys Gly Leu 420 425 430 Ala Val Glu Ala Met Glu Lys Gly Gly Ser Ser Asp Lys Asn Ile Asp 435 440 445 Glu Phe Ile Ser Lys Leu Val Ser Ser 450 455 <210> 36 <211> 1374 <212> DNA <213> Artificial Sequence <220> <223> UGT-MUT1 nucleotide sequence <4 00> 36 atggagagag aaatgttgag caaaactcac attatgttca tcccattccc agctcaaggc 60 cacatgagcc caatgatgca attcgtcaag cgtttagcct ggaaaggcgt gcgaatcacg 120 atagttcttc cggctgagat tcgagattct atgcaaataa acaactcatt gatcaacact 180 gagtgcatct cctttgattt tgataaagat gatgagatgc catacagcat gcgggcttat 240 atgggagttg taaagctcaa ggtcacaaat aaactgagtg acctactcga gaagcaaaaa 300 acaaatggct accctgttaa tttgctagtg gtcgattcat tatatccatc tcgggtagaa 360 atgtgccacc aacttggggt aaaaggagct ccatttttca ctcactcttg tgctgttggt 420 gccatttatt ataatgctcg cttagggaaa ttgaagatac ctcctgagga agggttgact 480 tctgtttcat tgccttcaat tccattgttg gggagaaatg atttgccaat tattaggact 540 ggcacctttc ctgatctctt tgagcatttg gggaatcagt tttcagatct tgataaagcg 600 gattggatct ttttcaatac ttttgataag cttgaaaatg aggaagcaaa atggctatct 660 agccattggc caattacatc catcggacca ttaatccctt caatgtactt agacaaacaa 720 ttaccaaatg acaaagacaa tgacattaat ttctacaagg cagacgtcgg atcgtgcatc 780 aagtggctag acgccaaaga ccctggctcg gtagtctacg cctcattcgg gagcgtgatt 840 cacaacctcg gcg atgacta catggacgaa gtagcatggg gcttgttaca cagcaaatat 900 cacttcatat gggttgttat agaatccgaa cgtacaaagc tctctagcga tttcttggca 960 gaggtagagg cagaggaaaa aggcctaata gtgagttggt gccctcaact cgaagttttg 1020 tcacataaat ctataggtag ttttatgact cattgtggtt ggaactcgac ggttgaggca 1080 ttgagtttgg gcgtgccaat ggtggcagtg ccacaacagt ttgatcagcc tgttaatgcc 1140 aagtatatcg tggatgtatg gcgaattggg gttcaggttc cgattggtga aaatggggtt 1200 cttttgaggg gagaagttgc taactgtata aaggatgtta tggaggggga aataggggat 1260 gagcttagag ggaatgcttt gaaatggaag gggttggctg tggaggcaat ggagaaaggg 1320 ggtagctctg ataagaatat tgatgagttc atttcaaagc ttgtttcctc ctga 1374 <210> 37 <211> 457 <212> PRT <213> Glu400 37 Met Glu Arg Glu400 Met <223> UGT Leu Ser Lys Thr His Ile Met Phe Ile Pro Phe 1 5 10 15 Pro Ala Gln Gly His Met Ser Pro Met Met Gln Phe Val Lys Arg Leu 20 25 30 Ala Trp Lys Gly Val Arg Ile Thr Ile Val Leu Pro Ala Glu Ile Arg 35 40 45 Asp Ser Met Gln Ile Asn Asn Ser Leu Ile Asn Thr Glu Cys Ile Ser 50 55 60 Phe Asp Phe Asp Lys Asp Asp Glu Met Pro Tyr Ser Met Arg Ala Tyr 65 70 75 80 Met Gly Val Val Lys Leu Lys Val Thr Asn Lys Leu Ser Asp Leu Leu 85 90 95 Glu Lys Gln Lys Thr Asn Gly Tyr Pro Val Asn Leu Leu Val Val Asp 100 105 110 Ser Leu Tyr Pro Ser Arg Val Glu Met Cys His Gln Leu Gly Val Lys 115 120 125 Gly Ala Pro Phe Phe Thr His Ser Cys Ala Val Gly Ala Ile Tyr Tyr 130 135 140 Asn Ala Arg Leu Gly Lys Leu Lys Ile Pro Pro Glu Glu Gly Leu Thr 145 150 155 160 Ser Val Ser Leu Pro Ser Ile Pro Leu Leu Gly Arg Asn Asp Leu Pro 165 170 175 Ile Ile Arg Thr Gly Thr Phe Pro Asp Leu Phe Glu His Leu Gly Asn 180 185 190 Gln Phe Ser Asp Leu Asp Lys Ala Asp Trp Ile Phe Phe Asn Thr Phe 195 200 205 Asp Lys Leu Glu Asn Glu Glu Ala Lys Trp Leu Se r Ser His Trp Pro 210 215 220 Ile Thr Ser Ile Gly Pro Leu Ile Pro Ser Met Tyr Leu Asp Lys Gln 225 230 235 240 Leu Pro Asn Asp Lys Asp Ser Asp Ile Asn Phe Tyr Lys Ala Asp Val 245 250 255 Gly Ser Cys Ile Lys Trp Leu Asp Ala Lys Asp Pro Gly Ser Val Val 260 265 270 Tyr Ala Ser Phe Gly Ser Val Lys His Asn Leu Gly Asp Asp Tyr Met 275 280 285 Asp Glu Val Ala Trp Gly Leu Leu His Ser Lys Tyr His Phe Ile Trp 290 295 300 Val Val Ile Glu Ser Glu Arg Thr Lys Leu Ser Ser Asp Phe Leu Ala 305 310 315 320 Glu Val Glu Ala Glu Glu Lys Gly Leu Ile Val Ser Trp Cys Pro Gln 325 330 335 Leu Glu Val Leu Ser His Lys Ser Ile Gly Ser Phe Met Thr His Cys 340 345 350 Gly Trp Asn Ser Thr Val Glu Ala Le u Ser Leu Gly Val Pro Met Val 355 360 365 Ala Val Pro Gln Gln Phe Asp Gln Pro Val Asn Ala Lys Tyr Ile Val 370 375 380 Asp Val Trp Arg Ile Gly Val Gln Val Pro Ile Gly Glu Asn Gly Val 385 390 395 400 Leu Leu Arg Gly Glu Val Ala Asn Cys Ile Lys Asp Val Met Glu Gly 405 410 415 Glu Ile Gly Asp Glu Leu Arg Gly Asn Ala Leu Lys Trp Lys Gly Leu 420 425 430 Ala Val Glu Ala Met Glu Lys Gly Gly Ser Ser Asp Lys Asn Ile Asp 435 440 445 Glu Phe Ile Ser Lys Leu Val Ser Ser 450 455 <210> 38 <211> 1374 <212> DNA <213> Artificial Sequence <220> <223> UGT-MUT2 nucleotide sequence <400> 38 atggagagag aaatgttgag caaaactcac attatgttca tcccattccc agctcaaggc 60 cacatgagcc caatgatgca attcgtcaag cgtttagcct ggaaaggcgt gcgaatcacg 120 atagttcttc cacaagactcatagat tccaa cact 180 gagtgcatct cctttgattt tgataaagat gatgagatgc catacagcat gcgggcttat 240 atgggagttg taaagctcaa ggtcacaaat aaactgagtg acctactcga gaagcaaaaa 300 acaaatggct accctgttaa tttgctagtg gtcgattcat tatatccatc tcgggtagaa 360 atgtgccacc aacttggggt aaaaggagct ccatttttca ctcactcttg tgctgttggt 420 gccatttatt ataatgctcg cttagggaaa ttgaagatac ctcctgagga agggttgact 480 tctgtttcat tgccttcaat tccattgttg gggagaaatg atttgccaat tattaggact 540 ggcacctttc ctgatctctt tgagcatttg gggaatcagt tttcagatct tgataaagcg 600 gattggatct ttttcaatac ttttgataag cttgaaaatg aggaagcaaa atggctatct 660 agccattggc caattacatc catcggacca ttaatccctt caatgtactt agacaaacaa 720 ttaccaaatg acaaagacag cgacattaat ttctacaagg cagacgtcgg atcgtgcatc 780 aagtggctag acgccaaaga ccctggctcg gtagtctacg cctcattcgg gagcgtgaag 840 cacaacctcg gcgatgacta catggacgaa gtagcatggg gcttgttaca cagcaaatat 900 cacttcatat gggttgttat agaatccgaa cgtacaaagc tctctagcga tttcttggca 960 gaggtagagg cagaggaaaa aggcctaata gtgagttggt gccctcaact cgaagttttg 1020 tcacataaat ctataggtag ttttatgact cattgtggtt ggaactcgac ggttgaggca 1080 ttgagtttgg gcgtgccaat ggtggcagtg ccacaacagt ttgatcagcc tgttaatgcc 1140 aagtatatcg tggatgtatg gcgaattggg gttcaggttc cgattggtga aaatggggtt 1200 cttttgaggg gagaagttgc taactgtata aaggatgtta tggaggggga aataggggat 1260 gagcttagag ggaatgcttt gaaatggaag gggttggctg tggaggcaat ggagaaaggg 1320 ggtagctctg ataagaatat tgatgagttc atttcaaagc ttgtttcctc ctga 1374 <210> 39 <211> 457 < 212> PRT <213> Artificial Sequence <220> <223> UGT-MUT3 amino acid sequence <400> 39 Met Glu Arg Glu Met Leu Ser Lys Thr His Ile Met Phe Ile Pro Phe 1 5 10 15 Pro Ala Gln Gly His Met Ser Pro Met Met Gln Phe Val Lys Arg Leu 20 25 30 Ala Trp Lys Gly Val Arg Ile Thr Ile Val Leu Pro Ala Glu Ile Arg 35 40 45 Asp Ser Met Gln Ile Asn Asn Ser Leu Ile Asn Thr Glu Cys Ile Ser 50 55 60 Phe Asp Phe Asp Lys Asp Asp Glu Met Pro Tyr Ser Met Arg Ala Tyr 65 70 75 80 Met Gly Val Val Lys Leu Lys Val Thr Asn Lys Leu Ser Asp Leu Leu 85 90 95 Glu Lys Gln Lys Thr Asn Gly T yr Pro Val Asn Leu Leu Val Val Asp 100 105 110 Ser Leu Tyr Pro Ser Arg Val Glu Met Cys His Gln Leu Gly Val Lys 115 120 125 Gly Ala Pro Phe Phe Thr His Ser Cys Ala Val Gly Ala Ile Tyr Tyr 130 135 140 Asn Ala Arg Leu Gly Lys Leu Lys Ile Pro Glu Glu Gly Leu Thr 145 150 155 160 Ser Val Ser Leu Pro Ser Ile Pro Leu Leu Gly Arg Asn Asp Leu Pro 165 170 175 Ile Ile Arg Thr Gly Thr Phe Pro Asp Leu Phe Glu His Leu Gly Asn 180 185 190 Gln Phe Ser Asp Leu Asp Lys Ala Asp Trp Ile Phe Phe Asn Thr Phe 195 200 205 Asp Lys Leu Glu Asn Glu Glu Ala Lys Trp Leu Ser Ser His Trp Pro 210 215 220 Ile Thr Ser Ile Gly Pro Leu Ile Pro Ser Met Tyr Leu Asp Lys Gln 225 230 235 240 Leu Pro Asn Asp L ys Asp Ser Asp Ile Asn Phe Tyr Lys Ala Asp Val 245 250 255 Gly Ser Cys Ile Lys Trp Leu Asp Ala Lys Asp Pro Gly Ser Val Val 260 265 270 Tyr Ala Ser Phe Gly Ser Val Ile His Asn Leu Gly Asp Asp Tyr Met 275 280 285 Asp Glu Val Ala Trp Gly Leu Leu His Ser Lys Tyr His Phe Ile Trp 290 295 300 Val Val Ile Glu Ser Glu Arg Thr Lys Leu Ser Ser Asp Phe Leu Ala 305 310 315 320 Glu Val Glu Ala Glu Glu Lys Gly Leu Ile Val Ser Trp Cys Pro Gln 325 330 335 Leu Glu Val Leu Ser His Lys Ser Ile Gly Ser Phe Met Thr His Cys 340 345 350 Gly Trp Asn Ser Thr Val Glu Ala Leu Ser Leu Gly Val Pro Met Val 355 360 365 Ala Val Pro Gln Gln Phe Asp Gln Pro Val Asn Ala Lys Tyr Ile Val 370 375 380 Asp Val Trp Arg Ile Gly V al Gln Val Pro Ile Gly Glu Asn Gly Val 385 390 395 400 Leu Leu Arg Gly Glu Val Ala Asn Cys Ile Lys Asp Val Met Glu Gly 405 410 415 Glu Ile Gly Asp Glu Leu Arg Gly Asn Ala Leu Lys Trp Lys Gly Leu 420 425 430 Ala Val Glu Ala Met Glu Lys Gly Gly Ser Ser Asp Lys Asn Ile Asp 435 440 445 Glu Phe Ile Ser Lys Leu Val Ser 450 455 <210> 40 <211> 1374 <212> DNA <213> Artificial Sequence < 220> <223> UGT-MUT3 nucleotide sequence <400> 40 atggagagag aaatgttgag caaaactcac attatgttca tcccattccc agctcaaggc 60 cacatgagcc caatgatgca attcgtcaag cgtttagcct ggaaaggcgt gcgaatcacg 120 atagttcttc cggctgagat tcgagattct atgcaaataa acaactcatt gatcaacact 180 gagtgcatct cctttgattt tgataaagat gatgagatgc catacagcat gcgggcttat 240 atgggagttg taaagctcaa ggtcacaaat aaactgagtg acctactcga gaagcaaaaa 300 acaaatggct accctgttaa tttgctagtg gtcgattcat tatatccatc tcg ggtagaa 360 atgtgccacc aacttggggt aaaaggagct ccatttttca ctcactcttg tgctgttggt 420 gccatttatt ataatgctcg cttagggaaa ttgaagatac ctcctgagga agggttgact 480 tctgtttcat tgccttcaat tccattgttg gggagaaatg atttgccaat tattaggact 540 ggcacctttc ctgatctctt tgagcatttg gggaatcagt tttcagatct tgataaagcg 600 gattggatct ttttcaatac ttttgataag cttgaaaatg aggaagcaaa atggctatct 660 agccattggc caattacatc catcggacca ttaatccctt caatgtactt agacaaacaa 720 ttaccaaatg acaaagacag cgacattaat ttctacaagg cagacgtcgg atcgtgcatc 780 aagtggctag acgccaaaga ccctggctcg gtagtctacg cctcattcgg gagcgtgatt 840 cacaacctcg gcgatgacta catggacgaa gtagcatggg gcttgttaca cagcaaatat 900 cacttcatat gggttgttat agaatccgaa cgtacaaagc tctctagcga tttcttggca 960 gaggtagagg cagaggaaaa aggcctaata gtgagttggt gccctcaact cgaagttttg 1020 tcacataaat ctataggtag ttttatgact cattgtggtt ggaactcgac ggttgaggca 1080 ttgagtttgg gcgtgccaat ggtggcagtg ccacaacagt ttgatcagcc tgttaatgcc 1140 aagtatatcg tggatgtatg gcgaattggg gttcaggttc cgattggtga aaatggggtt 1200 cttttgaggg gagaagttgc taactgtata aaggatgtta tggaggggga aataggggat 1260 gagcttagag ggaatgcttt gaaatggaag gggttggctg tggaggcaat ggagaaaggg 1320 ggtagctctg ataagaatat tgatgagttc atttcaaagc ttgtttcctc ctaa 1374 <210> 41 <211> 457 < 212> PRT <213> Artificial Sequence <220> <223> Pn50-Q222H-VE amino ac id sequence <400> 41 Met Glu Arg Glu Met Leu Ser Lys Thr His Ile Met Phe Ile Pro Phe 1 5 10 15 Pro Ala Gln Gly His Met Ser Pro Met Met Gln Phe Val Lys Arg Leu 20 25 30 Ala Trp Lys Gly Val Arg Ile Thr Ile Val Leu Pro Ala Glu Ile Arg 35 40 45 Asp Ser Met Gln Ile Asn Asn Ser Leu Ile Asn Thr Glu Cys Ile Ser 50 55 60 Phe Asp Phe Asp Lys Asp Asp Glu Met Pro Tyr Ser Met Arg Ala Tyr 65 70 75 80 Met Gly Val Val Lys Leu Lys Val Thr Asn Lys Leu Ser Asp Leu Leu 85 90 95 Glu Lys Gln Lys Thr Asn Gly Tyr Pro Val Asn Leu Leu Val Val Asp 100 105 110 Ser Leu Tyr Pro Ser Arg Val Glu Met Cys His Gln Leu Gly Val Lys 115 120 125 Gly Ala Pro Phe Phe Thr His Ser Cys Ala Val Gly Ala Ile Tyr Tyr 130 135 140 Asn Ala Arg Leu Gly Lys Leu Lys Ile Pro Glu Glu Gly Leu Thr 145 150 155 160 Ser Val Ser Leu Pro Ser Ile Pro Leu Leu Gly Arg Asn Asp Leu Pro 165 170 175 Ile Ile Arg Thr Gly Thr Phe Pro Asp Leu Phe Glu His Leu Gly Asn 180 185 190 Gln Phe Ser Asp Leu Asp Lys Ala Asp Trp Ile Phe Phe Asn Thr Phe 195 200 205 Asp Lys Leu Glu Asn Glu Glu Ala Lys Trp Leu Ser Ser His Trp Pro 210 215 220 Ile Thr Ser Ile Gly Pro Leu Ile Pro Ser Met Tyr Leu Asp Lys Gln 225 230 235 240 Leu Pro Asn Asp Lys Asp Asn Asp Ile Asn Phe Tyr Lys Ala Asp Val 245 250 255 Gly Ser Cys Ile Lys Trp Leu Asp Ala Lys Asp Pro Gly Ser Val Val 260 265 270 Tyr Ala Ser Phe Gly Ser Val Lys His Asn Leu Gly Asp Asp Tyr Met 275 280 285 Asp Glu Val Ala Trp Gly Leu Leu His Ser Lys Tyr His Phe Ile Trp 290 295 300 Val Val Ile Glu Ser Glu Arg Thr Lys Leu Ser Ser Asp Phe Leu Ala 305 310 315 320 Glu Val Glu Ala Glu Glu Lys Gly Leu Ile Val Ser Trp Cys Pro Gln 325 330 335 Leu Glu Val Leu Ser His Lys Ser Ile Gly Ser Phe Met Thr His Cys 340 345 350 Gly Trp Asn Ser Thr Val Glu Ala Leu Ser Leu Gly Val Pro Met Val 355 360 365 Ala Val Pro Gln Gln Phe Asp Gln Pro Val Asn Ala Lys Tyr Ile Val 370 375 380 Asp Val Trp Arg Ile Gly Val Gln Val Pro Ile Gly Glu Asn Gly Val 385 390 395 400 Leu Leu Arg Gly Glu Val Ala Asn Cys Ile Lys Asp Val Met Glu Gly 405 410 415 Glu Ile Gly Asp Glu Leu Arg Gly Asn Ala Leu Lys Trp Lys Gly Leu 420 425 430 Ala Val Glu Ala Met Glu Lys Gly Gly Ser Ser Asp Lys Asn Ile Asp 435 440 445 Glu Phe Ile Ser Lys Leu Val Ser Ser 450 455 <210> 4 2 <211> 1374 <212> DNA <213> Artificial Sequence <220> <223> Pn50-Q222H-VE nucleotide sequence <400> 42 atggagagag aaatgttgag caaaactcac attatgttca tcccattccc agctcaagtct acatgagcta cacatgagct 60 cacatgagcc caatgatcagacagtgt caatgatg cacgtttcgtcaag gatcaacact 180 gagtgcatct cctttgattt tgataaagat gatgagatgc catacagcat gcgggcttat 240 atgggagttg taaagctcaa ggtcacaaat aaactgagtg acctactcga gaagcaaaaa 300 acaaatggct accctgttaa tttgctagtg gtcgattcat tatatccatc tcgggtagaa 360 atgtgccacc aacttggggt aaaaggagct ccatttttca ctcactcttg tgctgttggt 420 gccatttatt ataatgctcg cttagggaaa ttgaagatac ctcctgagga agggttgact 480 tctgtttcat tgccttcaat tccattgttg gggagaaatg atttgccaat tattaggact 540 ggcacctttc ctgatctctt tgagcatttg gggaatcagt tttcagatct tgataaagcg 600 gattggatct ttttcaatac ttttgataag cttgaaaatg aggaagcaaa atggctatct 660 agccattggc caattacatc catcggacca ttaatccctt caatgtactt agacaaacaa 720 ttaccaacaatg cacaaagaca ttgacattaat cgtgcatc 780 aagtggctag acgccaaaga ccctggctcg gtagtctacg cctcattcgg gagcgtgaag 840 cacaacctcg gcgatgacta catggacgaa gtagcatggg gcttgttaca cagcaaatat 900 cacttcatat gggttgttat agaatccgaa cgtacaaagc tctctagcga tttcttggca 960 gaggtagagg cagaggaaaa aggcctaata gtgagttggt gccctcaact cgaagttttg 1020 tcacataaat ctataggtag ttttatgact cattgtggtt ggaactcgac ggttgaggca 1080 ttgagtttgg gcgtgccaat ggtggcagtg ccacaacagt ttgatcagcc tgttaatgcc 1140 aagtatatcg tggatgtatg gcgaattggg gttcaggttc cgattggtga aaatggggtt 1200 cttttgaggg gagaagttgc taactgtata aaggatgtta tggaggggga aataggggat 1260 gagcttagag ggaatgcttt gaaatggaag gggttggctg tggaggcaat ggagaaaggg 1320ggtagctctagc ata tagattt t 374 t

Claims (16)

The amino acid residue at the 222 site whose amino acid sequence corresponds to the amino acid sequence shown in SEQ ID NO: 19 is not Gin, and the amino acid residue at the 322 site corresponding to the amino acid sequence shown in SEQ ID NO: 19 is Ala is not,
The amino acid residue at site 222 corresponding to the amino acid sequence of which the amino acid sequence is represented by SEQ ID NO: 19 is His,
The amino acid residue at site 322, whose amino acid sequence corresponds to the amino acid sequence shown in SEQ ID NO: 19, is any one of Val, Ile, and Leu,
The amino acid residue at site 247, whose amino acid sequence corresponds to the amino acid sequence shown in SEQ ID NO: 41, is any one of Ser, Asn, and Thr;
The isolated polypeptide, wherein the amino acid residue at site 280, the amino acid sequence of which corresponds to the amino acid sequence shown in SEQ ID NO: 41, is any one of Ile, Lys and Ala. (a) an isolated polypeptide having an amino acid sequence represented by SEQ ID NO.: 21, SEQ ID NO.: 35, SEQ ID NO.: 37, SEQ ID NO.: 39 or SEQ ID NO.: 41. (A) a nucleotide sequence encoding a polypeptide according to claim 1 or 2;
(B) a nucleotide sequence represented by SEQ ID NO.: 22, SEQ ID NO.: 36, SEQ ID NO.: 38, SEQ ID NO.: 40 or SEQ ID NO.: 42; and
(C) an isolated polynucleotide selected from the group consisting of a nucleotide sequence complementary to the nucleotide sequence according to any one of (A) and (B). A delivery system comprising the polynucleotide according to claim 3 . delete delete In the presence of a glycosyltransferase, a glycosyl group of a glycosyl group donor is transferred to a hydroxyl group at the C-3 site of a tetracyclic triterpenoid compound to form a glycosylated tetracyclic triterpenoid compound do,
The glycosyltransferase is an in vitro glycosylation method, characterized in that the polypeptide according to claim 1 or 2 or a derivative thereof. In the presence of the isolated polypeptide according to claim 1 or 2,
A method of performing a glycosyl group catalyzed reaction comprising the step of performing a glycosyl group catalyzed reaction. 9. The method of claim 8,
The isolated polypeptide is used to catalyze the following reaction or to prepare a catalyst that catalyzes the following reaction,

Formula (I) compound Formula (II) compound;
In the compound of formula (I) and the compound of formula (II), R 1 is H or OH; R2 is H or OH; R3 is H or a glycosyl group; R4 is a glycosyl group. In a genetically engineered host cell,
The genetically engineered host cell contains the carrier according to claim 3 . 11. A method of using a host cell according to claim 10, comprising:
A method of using a host cell for preparing an enzyme catalyzed reagent, for producing a glycosyltransferase, for use as a catalytic cell, or for producing a glycosylated tetracyclic triterpenoid compound. A method for producing a genetically modified plant comprising the step of regenerating the genetically engineered host cell according to claim 10 into a plant, wherein the genetically engineered host cell is a plant cell. delete delete delete delete

Images