CN116515872A - Cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene and application thereof in preparation of beta-amyrin - Google Patents

Abstract

The invention relates to a cyclocarya paliurus Liu San terpene synthaseCpalOSC2The gene and the application in preparing beta-amyrin alcohol belong to the biotechnology field. The cyclocarya paliurus Liu San terpene synthaseCpalOSC2The nucleotide sequence of the gene is shown as SEQ ID NO.1, and the total length of the sequence is 2289bp; the amino acid sequence of the encoded protein is shown as SEQ ID NO.2, and 763 amino acid residues are encoded. The invention discloses a cyclocarya paliurus Liu San terpene synthaseCpalOSC2The gene can be used as beta-amyrinThe biosynthesis regulatory gene is applied to the preparation of beta-amyrin, has obvious application prospect and is easy to popularize and apply.

Description

Cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene and application thereof in preparation of beta-amyrin

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene and application thereof in preparation of beta-amyrin.

Background

The oleanane-type triterpene saponin is also called as beta-perfume resin alkane-type triterpene saponin, which is pentacyclic triterpene saponin taking oleanane as aglycone, has wide distribution in plant area, and has a plurality of pharmacological activities such as anti-tumor, anticancer, antidiabetic activity, hypoglycemic, hypolipidemic, liver-protecting, bacteriostasis and the like (Ayeleso et al, 2017). Beta-amyrin is the skeleton of oleanane-type compound, which is the key intermediate for biosynthesis of all oleanane-type triterpene saponins. Beta-amyrin synthase is the first key enzyme in the branch of oleanane-type saponin biosynthesis, and it can catalyze 2, 3-oxidation squalene to form oleanane-type saponin skeleton beta-amyrin (Liang & Zhao et al, 2008), and then the beta-amyrin is modified by cytochrome P450-dependent monooxygenase (CYP), glycosyltransferase (UGT) mediated oxidation, substitution, glycosylation and the like to finally generate various types of oleanane-type triterpene saponins.

Cyclocarya paliurus (Cyclocarya paliurus) is a plant of cyclocarya genus of Juglandaceae family. Cyclocarya paliurus leaves are often used for the prevention and treatment of hypertension, hyperlipidemia and diabetes (Xiao et al, 2017; tang et al, 2017), and are also often used as herbal tea due to their sweet taste. Recent studies have shown that cyclocarya paliurus leaves contain a variety of active ingredients including triterpenes, flavonoids, phenolic acids, polysaccharides and the like, wherein the triterpenes and the glycosides thereof are the natural products with the most abundant content and highest activity in cyclocarya paliurus leaves (Xiong et al, 2018;Xie et al.2015,Li et al.2017), and have the effects of resisting cancer, reducing blood sugar, resisting blood fat, protecting liver and resisting inflammation (Sun et al, 2020a; zhou et al, 2021; liu et al, 2014; liu et al, 2020).

Triterpene saponins in cyclocarya paliurus can be classified into dammarane type, oleanane type, bearberry alkane type, lupeol type and the like according to structural types, wherein the oleanane type triterpene saponins have remarkable activities in reducing blood sugar, resisting cancer, reducing blood fat and protecting liver (Zhu et al, 2015; gao et al, 2015; wu et al, 2017; yang et al, 2018). But oleanane-type triterpene saponin has low content in cyclocarya paliurus, and a large amount of raw materials are required for extraction from plant materials. However, the existing cyclocarya paliurus resources are mostly wild, the quantity is rare and distributed sporadically, and the growth years are long. Therefore, the production of monomeric compounds by synthetic biology is one of the most effective and feasible methods for realizing the mass production of triterpenoid saponins in cyclocarya paliurus in the future. However, the current research on cyclocarya paliurus mainly focuses on extraction and separation of compounds and pharmacological activity identification, and the molecular mechanism of synthesis of the cyclocarya paliurus is not clear. In order to obtain oleanane-type triterpene saponin in cyclocarya paliurus by a biosynthesis method, the biosynthesis way of the compounds is analyzed, and beta-amyrin alcohol is taken as a key intermediate of the oleanane-type triterpene saponin, so that the identification of biosynthetic enzyme is important. However, the function of the related enzyme responsible for the generation of beta-amyrin alcohol in cyclocarya paliurus has not been verified so far, and the promotion of the biosynthesis work of oleanane-type triterpenoid saponins in cyclocarya paliurus is affected.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provides a cyclocarya paliurus Liu San terpene synthase Cpalaosc 2 gene which can be used as a beta-amyrin alcohol regulatory gene formed in the biosynthesis of oleanane-type triterpene saponins and applied to the preparation of beta-amyrin alcohol.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

the first aspect of the invention provides a cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene, wherein the nucleotide sequence of the cyclocarya paliurus Qian Liusan terpene synthase CpalOSC2 gene is shown as SEQ ID NO.1, and the total length of the sequence is 2289bp.

The second aspect of the present invention provides the protein encoded by the gene CpalOSC2 of the green Qian Liusan terpene synthase, wherein the amino acid sequence of the encoded protein is shown as SEQ ID NO.2, and 763 amino acid residues are encoded.

In a third aspect the present invention provides a recombinant plasmid comprising the above-described cyan Qian Liusan terpene synthase CpalOSC2 gene.

Further, it is preferable that the Qingqian Liu San terpene synthase CpalOSC2 gene is subjected to homologous recombination with the pYES2 vector to obtain a pYES2-CpalOSC2 recombinant plasmid.

The fourth aspect of the present invention provides a genetically engineered bacterium comprising the recombinant plasmid, or wherein the genome of the genetically engineered bacterium has incorporated therein the exogenous gene of the enzyme CpalOSC2 of the enzyme Qing Qian Liusan terpene.

Further, it is preferable that the transgenic engineering bacterium is Saccharomyces cerevisiae GIL77 strain.

In a fifth aspect, the invention provides a cyclocarya paliurus Liu San terpene synthase Cpalsc 2 encoded by the cyclocarya paliurus Qian Liusan terpene synthase Cpalsc 2 gene.

The sixth aspect of the invention provides the use of the above-described green Qian Liusan terpene synthase CpalOSC2 gene in the preparation of β -amyrin.

Further, it is preferable that the beta-amyrin is produced by subjecting 2, 3-oxidized squalene to carbanion rearrangement cyclization with the use of 2, 3-oxidized squalene as a substrate under the catalysis of the cyclose Liu San terpene synthase CpalsC 2 encoded by the cyclose CpalsC 2 gene of cyclose Liu San.

The invention obtains target protein after expression in Saccharomyces cerevisiae through recombinant plasmid, and directly generates beta-amyrin through further catalyzing substrate 2, 3-oxidation squalene.

The cyclocarya paliurus Liu San terpene synthase Cpalaosc 2 gene is identified from cyclocarya paliurus plants through transcriptome sequencing and bioinformatics, and is screened after a large number of experiments; is obtained by a method of artificial synthesis through codon optimization. The amplification primers of the cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene are as follows:

5'F：ATGTGGAGATTGAAAATCGCTG；

3'R：TTATAGACTAGTAGATGGCAATGG。

in addition, when homologous recombination is performed with vector pYES2, cpalOSC2 gene is amplified and recovered by using a primer with homology wall as follows:

upstream homology arm primer: 5'F: ttggtaccgagctcggatccATGTGGAGATTGAAAATCGCT G;

downstream homology arm primer: 3' R: : cggccgttactagtggatccTTATAGACTAGTAGATGGCAA TGG.

The triterpene synthase CpalOSC2 gene separated and identified from cyclocarya paliurus can be used as an important marker gene for molecular auxiliary breeding of cyclocarya paliurus, and can also be used as an important candidate gene for producing beta-amyrin and oleanane type triterpene saponin in construction of yeast chassis cells.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides a cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene which can be used as a biosynthesis regulatory gene of beta-amyrin and applied to preparation of beta-amyrin.

(1) Along with the rapid development of bioinformatics technology, the excavation of key enzyme genes of the biosynthesis path of the beta-amyrin is greatly promoted, and the biosynthesis regulating gene of the beta-amyrin, namely the triterpene synthase CpalOSC2 gene, is first identified and successfully verified in cyclocarya paliurus, and opens up a novel biosynthesis method for producing the beta-amyrin. The invention obtains the target product by heterologously expressing protein in saccharomyces cerevisiae and carrying out catalysis, adopts in vivo biosynthesis to carry out directional production, and has the advantages of high yield and the like.

(2) The invention provides recombinant plasmid and genetic engineering bacteria containing the triterpene synthase CpalOSC2 gene, which lay a foundation for synthesizing a large amount of beta-amyrin through a bioengineering method and further constructing cell factory research for producing the beta-amyrin.

(3) The heterologous biosynthesis of the beta-amyrin alcohol has strong controllability, can reduce the requirement on raw material planting, has high yield of the produced product, and is convenient for the separation and purification of the beta-amyrin alcohol in the later period; can also reduce the problems of difficult chemical synthesis, complex synthesis path and the like. The beta-amyrin alcohol synthase CpalOSC2 gene is used as a key gene for biosynthesis of beta-amyrin alcohol, and can also be used for breeding research of plants rich in beta-amyrin alcohol such as cyclocarya paliurus.

Drawings

FIG. 1 is a schematic diagram of a synthetic route derived from β -amyrin;

FIG. 2 is a schematic diagram of the construction of recombinant expression plasmid pYES2-CpalOSC 2;

FIG. 3 shows the result of electrophoresis detection after the recombination of the cyclostyle Liu San terpene synthase CpalOSC2 gene. Wherein M is nucleic acid Mar, and 1-4 are positive single colony detection results;

FIG. 4 shows the HPLC detection of the catalytic effect of the gene CpalOSC2 of the green Qian Liusan terpene synthase on endogenous 2, 3-oxidized squalene in yeast (standard: peak time of beta-amyrin standard; CK: empty plasmid of control group pYES2 as positive control; cpalOSC2: catalytic reaction result of the gene CpalOSC2 of the green Qian Liusan terpene synthase in yeast, peak time of beta-amyrin product);

FIG. 5 is a characteristic peak ion diagram (theoretical molecular weight 427) of the standard beta-amyrin alcohol as a GC-MS detection result;

FIG. 6 is a characteristic peak ion diagram (theoretical molecular weight 427) of the reaction product beta-amyrin alcohol as a result of GC-MS detection.

Detailed Description

The present invention will be described in further detail with reference to examples.

It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The specific techniques or conditions are not identified in the examples and are performed according to techniques or conditions described in the literature in this field or according to the product specifications. The materials or equipment used are conventional products available from commercial sources, not identified to the manufacturer.

Example 1

Screening OSC candidate genes in sequencing annotation results based on cyclocarya paliurus transcriptome Unigene basic function annotation information, simultaneously taking the oxidation squalene cyclase (Oxidosqualene cyclases, OSCs) identified in plants as a reference sequence, performing sequence local BLAST analysis, performing finishing analysis on the screening results, and finally finding 8 OSC genes, wherein the candidate genes are named CpalOSC 1-Cpal OSC8 respectively. Wherein CpalOSC2 is functionally annotated AS beta-amyrin synthase (beta-AS), and finally Unigene nucleotide sequences are extracted from fasta files according to the ID numbers corresponding to Unige ne for subsequent analysis. And then carrying out a series of works such as codon optimization, artificial synthesis, homologous recombination, in-vivo induced expression of yeast, incubation reaction, extraction of yeast metabolites, GC-MS detection and the like, and finally identifying that the CpalOSC2 gene can cyclize an endogenous substrate 2, 3-oxidation squalene to generate beta-amyrin (figure 1). The steps of each stage of the beta-amyrin alcohol synthesis are as follows (the reagents, raw materials, instruments and equipment used in the following implementation are all commercially available):

(1) Codon optimization and artificial synthesis of CpalOSC2 gene

The beta-amyrin alcohol synthase encoding gene CpalOSC2 annotated from the transcriptome was codon optimized and then synthesized by the company.

(2) Construction and identification of Gene recombination vectors

A schematic diagram of homologous recombination is shown in FIG. 2. Firstly, linearizing the vector pYES2, carrying out single enzyme digestion by using BamH I enzyme to obtain a linearized vector, carrying out enzyme digestion on 1 mu g of a system (50 mu L) of a circular pYES2 vector, supplementing 50 mu L of the system with 10 XNEBuffer 5 mu L of Restriction Enzyme mu L of double distilled water, and carrying out incubation on the reaction solution at 37 ℃ for 15min to obtain the linearized vector pYES2. And (5) recycling the EasyPure Qu ick Gel Extraction Kit kit, measuring the concentration of the kit after recycling, and finally storing the kit in a refrigerator at the temperature of minus 20 ℃ for standby. During homologous recombination, assembling according to the operation instructions of the homologous recombinase kit, and then calculating the consumption of each component according to the concentrations of the inserted fragment and the carrier and the recombination instructions; finally, the components were added to the PCR reaction tube on ice as shown in Table 1. The recombinant plasmid was obtained by homologous recombination of the cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene with the pY ES2 vector and was designated pYES2-CpalOSC2. The recombinant plasmid is transformed into DH5 alpha escherichia coli, positive clones are selected for detection and sent to a company for sequencing, and the assembled electrophoresis detection result is shown in figure 3, so that the assembly is successful. The method comprises the following steps of:

table 1candidate Gene recombination reaction System Table 1Candidate genes Recombination System

Wherein x= (0.02×pyes2 base pair number) ng/linearised pYES2 concentration ng/μl; y= (0.02×pyes2 base pair) ng/cpaosc 2 recovery concentration ng/μl;

(3) Recombinant plasmid extraction

10 mu L of positive monoclonal seed preservation solution detected by suction sequencing is placed in 6mL of LB liquid medium (100 mg/mL of Amp) and cultured overnight at 37 ℃ in a shaking table (220 r/min). Extracting plasmid according to the specification of plasmid DNA miniprep kit centrifugal column (GenStar, shenzhen China), measuring its recovery concentration of extracted plasmid DN A on NanoReady ultra-micro ultraviolet visible spectrophotometer, and storing in-20deg.C refrigerator.

(4) Competent preparation of GIL77 Yeast Strain (lanosterol synthase deficient)

GIL77 strain on YPD plates was picked up and inoculated into 100mL of YPD medium supplemented with ergosterol (20 μg/mL), heme (13 μg/mL) and tween 80 (5 mg/mL), incubated at 30 ℃ at 220rpm to od=0.8-0.9, separated with 50mL centrifuge tubes, and cells were collected at 5000g/5 min. The cells were washed twice with 25mL of sterilized water, the centrifugation step was repeated, and the washed cells were resuspended in 1mL of ddH o and transferred to a 1.5mL centrifuge tube at 13000rpm, and the cells were collected by centrifugation for 30 s. Resuspension with 600 μl dd water, 100 μl per tube was dispensed for transformation.

(5) GIL77 Yeast transformation

Centrifuging for 20s in a palm centrifuge, discarding supernatant, adding a transformation system: PEG4000 (50%) 240. Mu.L, LA C (lithium acetate) 1.0mol 36. Mu.L, SSDNA (frog's fish essence) 2.0 ug/. Mu.L 10. Mu.L, and a total of 74. Mu.L of plasmid with fragment of interest (400 ng) and ddH O. The mixed body weight is resuspended at 30 ℃ and kept for 20min, heat shock is carried out at 42 ℃ for 40min, 200 mu L of bacteria liquid is taken and coated, and the bacteria liquid is placed in a 30 ℃ incubator for 2 to 4 days in an inverted way, and then positive clone strains are selected for verification.

(6) Positive strain clone selection

mu.L of ddH2O was added to each of the 0.2mL PCR tubes, and 4 single colonies each of the above cultures were picked; and (3) carrying out reaction at 95 ℃ for 10min in a PCR instrument for wall breaking treatment. The following reaction system was added to the PCR tube: super 2x Mix 12.5. Mu.L, sterilized water 10.5. Mu.L, universal forward primer (10 mM) 0.5. Mu.L, universal reverse primer (10 mM) 0.5. Mu.L, 1. Mu.L of monoclonal template in water. Wherein the universal primer for detection is designed by software (SnapGene 3.2.1), and the upstream primer for detection: taatacgatctactataggg, downstream primer: GCGTGAATGTAAGCGTGAC; the PCR amplification cycle parameters were: 3min at 95 ℃;95 ℃ for 30s,55 ℃ for 30s,72 ℃ for 2min,35 cycles; 72 ℃ for 5min and 10 ℃ for 5min.

(7) Detection and sequencing

Taking 1.0 mu L of Loading buffer and adding 5 mu L of the PCR product, uniformly mixing, and detecting an amplification result by 1% agarose gel electrophoresis, wherein if the amplification result is similar to the size of the target fragment, the amplification result is a true positive yeast strain, and the conversion is successful. The bacterial liquid identified as positive clone is transferred into a culture medium (with resistance of Amp+ and 100 mug/mL) filled with 1mL of liquid LB in an ultra-clean workbench, and is cultured for about 5 hours at 37 ℃ and 220r/min, and after the bacterial liquid is sufficiently turbid, about 50 mu L of bacterial liquid is taken and sent to sequencing company for sequencing. And (5) performing seed preservation after sequencing and confirming no errors. The method comprises the steps of adding 50% glycerol and bacterial liquid into a seed preservation tube according to a ratio of 1:1, fully and uniformly mixing, and then placing into an ultralow temperature refrigerator at-80 ℃ for preservation for standby.

(8) Yeast induced expression and detection

Selecting positive GIL77 yeast strain with normal growth, culturing in culture medium (50 ml) without uracil (SC-U), supplementing ergosterol (20 μg/ml), heme (13 μg/ml) and Tween 80 (5 mg/ml) at 30deg.C, shaking culture at 220 rpm; after 2 days of culture, glucose was changed to galactose and induced at 30 ℃ for 48h; centrifuging at 8000rpm for 5min, collecting cells, re-suspending with 0.5ml of 1M potassium phosphate buffer solution with pH of 7.0, supplementing 50ul/ml glucose and 1 μl/ml heme, and culturing in a constant temperature incubator at 30deg.C for 24 hr; centrifuging at 8000rpm for 5min to collect cells, and breaking cell wall by using 2ml of lysate (20% KOH,50% EtOH); extracting with n-hexane of the same volume for three times; 200 mu L N-methyl-N- (trimethyllyl) trifluoracemide was then added to the concentrated extract and derivatised for 1h at 70 ℃. The extracted metabolites and GC-MS were analyzed for the derived metabolites by HPLC.

The HPLC detection conditions were as follows:

the instrument used for HPLC detection is Agilent high performance liquid chromatograph. The column was an Agilent EC-C18 column (4.6X100 mm,2.7 um), column temperature: 45 ℃; the mobile phase of the beta-amyrin alcohol is determined as follows: water (a) -acetonitrile (B), gradient elution: 0-8 min, 85-90% B; 8-15 min, 90-92% B; 15-20 min, 92-94% B; 20-25 min, 94-97% B; 25-35 min, 94-100% B; 35-45 min,100% B; mobile phase a+b used in elution totals 100%; linear gradient elution is adopted; elution time: 45min; sample injection amount: 20. Mu.L; flow rate: 0.8ml/min; the detection wavelength is 194nm, and the detector is a diode array detector. The results of the assay are shown in FIG. 5, which shows that the experimental sample produced beta-amyrin under the catalysis of cyclostyle Liu San terpene synthase CpalOSC2.

The GC-MS detection conditions were as follows:

the derivatized samples were transferred to glass inserts in glass autosampler vials. mu.L of each sample was aspirated and directly injected into a quantitative GC-ultra-gas chromatograph (THERMO Sci service) coupled with ISQ-type mass spectrometry for detection. GC-MS analysis was performed using 7890B GC (Agilent) and electron bombardment (EI) 5977AMSD (Agilent) equipped with a Zebron ZB5-HT chromatographic column (Phen omenex). Briefly, 1. Mu.L of sample (sample inlet 250 ℃) was injected in non-split mode (pulse pressure 30 psi), which involved a 2 minute cartridge temperature of 170℃and a 20℃/min rise to 300℃for 11.5 minutes at 300 ℃. After a solvent delay of 8 minutes, the detection was performed in a scanning mode (60-800 mass units), set to 7.2. Data analysis was performed using MassHunter workstation (Agilent) software.

The foregoing has shown and described the basic principles, principal features and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, and that the above embodiments and descriptions are merely illustrative of the principles of the present invention, and various changes and modifications may be made without departing from the spirit and scope of the invention, which is defined in the appended claims. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims (9)

1. Cyclocarya paliurus Liu San terpene synthaseCpalOSC2A gene, characterized in that it is a green Qian Liusan terpene synthaseCpalOSC2The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

2. The cyclocarya paliurus Liu San terpene synthase of claim 1CpalOSC2The gene coding protein is characterized in that the amino acid sequence of the coding protein is shown as SEQ ID NO. 2.

3. A terpene synthase comprising cyclocarya paliurus Liu San according to claim 1CpalOSC2Recombinant plasmid of the gene.

4. The terpene synthase containing cyclocarya paliurus Liu San according to claim 3CpalOSC2A recombinant plasmid of a gene, characterized in that the recombinant plasmid is prepared from cyclocarya paliurus Liu San terpene synthasesCpalOSC2Homologous recombination of the gene and pYES2 vector to obtain pYES2-CpalOSC2Recombinant plasmids.

5. A transgenic engineering bacterium comprising the recombinant plasmid of claim 3, or wherein the exogenous cyclocarya paliurus Liu San terpene synthase of claim 1 is integrated into the genome of the genetically engineered bacteriumCpalOSC2And (3) a gene.

6. The genetically engineered bacterium of claim 5, wherein the genetically engineered bacterium is saccharomyces cerevisiae GIL77.

7. The cyclocarya paliurus Liu San terpene synthase of claim 1CpalOSC2The gene codes the obtained cyclocarya paliurus Liu San terpene synthase CpalOSC2.

8. The cyclocarya paliurus Liu San terpene synthase of claim 1CpalOSC2The application of the gene in the preparation of beta-amyrin.

9. The cyclocarya paliurus Liu San terpene synthase according to claim 8CpalOSC2The application of the gene in the preparation of beta-amyrin is characterized in that: with a substrate of 2, 3-oxidized squalene, in the synthesis of enzyme from said cyclocarya paliurus Liu San terpeneCpalOSC2The cyclocarya paliurus Liu San terpene synthase CpalOSC2 obtained by gene coding is catalyzed to undergo carbon ion rearrangement and cyclization to generate beta-amyrin.