CN106987533A - A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone - Google Patents
A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone Download PDFInfo
- Publication number
- CN106987533A CN106987533A CN201710179505.2A CN201710179505A CN106987533A CN 106987533 A CN106987533 A CN 106987533A CN 201710179505 A CN201710179505 A CN 201710179505A CN 106987533 A CN106987533 A CN 106987533A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- enoxolone
- genetic fragments
- yeast
- ggbas
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0036—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
- C12N9/0038—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
- C12N9/0042—NADPH-cytochrome P450 reductase (1.6.2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
- C12N9/0079—Steroid 11 beta monooxygenase (P-450 protein)(1.14.15.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
- C12Y106/02—Oxidoreductases acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
- C12Y106/02004—NADPH-hemoprotein reductase (1.6.2.4), i.e. NADP-cytochrome P450-reductase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/15—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced iron-sulfur protein as one donor, and incorporation of one atom of oxygen (1.14.15)
- C12Y114/15004—Steroid 11-beta-monooxygenase (1.14.15.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y504/00—Intramolecular transferases (5.4)
- C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
- C12Y504/99039—Beta-amyrin synthase (5.4.99.39)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to biological chemical field, and in particular to a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone.The construction method will respectively build to form expression casette from β amyrin synthase genes GgbAS, the Cytochrome P450 oxidase C YP88D6 and CYP72A154 of glycyrrhiza glabra (Glycyrrhiza glabra) and from the cytochrome P450 reductase CPR1 and CPR2 of arabidopsis (Arabidopsis thaliana), then cotransformation expression casette assembles to form the saccharomyces cerevisiae engineered yeast with complete enoxolone biosynthesis pathway in saccharomyces cerevisiae CEN.PK2 1C using yeast homologous restructuring ability.The method of the invention saccharomyces cerevisiae engineered yeast can fermenting and producing enoxolone, realize the artificial synthesized of enoxolone in saccharomyces cerevisiae yeast.
Description
Technical field
The invention belongs to biological chemical field, and in particular to a kind of saccharomyces cerevisiae engineered yeast that can synthesize enoxolone
Construction method, includes the construction method of the saccharomyces cerevisiae engineered yeast containing enoxolone biosynthesis pathway.
Background technology
Terpene is representative bioactive molecule in nature, is material necessary to growth and development of plants,
Plant in environmental interaction with playing an important role, while being also the industry of the products such as spices, medicine, insecticide, sweetener
Raw material.Enoxolone is a kind of pentacyclic triterpene compound, due to two molecules grape fewer than radix glycyrrhizae main active glycyrrhizic acid
Saccharic acid acid, makes it be more easy to penetration cell film, is more easy to play anti-inflammatory, antiviral, reducing blood lipid, anti-curing oncoma and anti-AIDS in the cell
Disease etc. is acted on.Influenceed by factors such as epigenetics, enoxolone cumulant in radix glycyrrhizae is very low, mainly pass through chemical hydrolysis at present
Glycyrrhizic acid and obtain, cost height, cycle length, process contamination are big；And highly complex chemical constitution to close using traditional chemical
Into being also difficult to.
On the contrary, the artificial synthesized system of structure that resolves to of enoxolone biosynthesis pathway provides chance, micro- life is utilized
Thing can advantage fermenting and producing enoxolone be beneficial to improve high level using cheap carbon source, growth cycle be short, more easy to control etc.
The production efficiency of chemicals, reduces production cost, and meet Green Development theory.
Enoxolone synthesis related enzyme or gene are found also not in microorganism at present, there is crucial conjunction only in plant
Into enzyme or gene.
The content of the invention
The problem of limitation of production and chemical synthesis process is with difficulty is hydrolyzed for enoxolone, the present invention provides a kind of sharp
The method that enoxolone is synthesized with saccharomyces cerevisiae.The saccharomyces cerevisiae engineered yeast that the present invention is built, multiple expression casettes are passed through
The powerful homologous recombination system of yeast is recombinated into Yeast genome, and expression heredity is more stable, without extra addition antibiotic control
The stability of foreign gene processed.
The present invention is achieved by the following technical solutions：
A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, first with from glycyrrhiza glabra
β-amyrin synthase GgbAS genes (Genbank registration sequences number be AB037203), from the cell of Glycyrrhiza Uralensis
Cytochrome p 450 oxidase C YP88D6 genes (Genbank registration sequences number are AB433179) and Cytochrome P450 oxidizing ferment
CYP72A154 genes (Genbank registration sequences number be AB558146) and from the cytochrome reductase of arabidopsis
CPR1 genes (Genbank registration sequences number are AB433179) and cytochrome reductase CPR2 gene (Genbank registration sequences
Number be AB558146) prepare GgbAS genetic fragments, CYP88D6 genetic fragments, CYP72A154 genetic fragments, CPR1 genes
Fragment and CPR2 genetic fragments, said gene fragment and Yeast promoter and yeast terminator pass through two step overlap-extension PCRs respectively
PCR connections, obtain expression casette FBA1p-GgbAS-FBA1t, PGK1p-CYP88D6-GMP1t, ALA1p-CPR1-ALA1t,
ENO2p-CYP72A154-TYS1t and GPM1p-CPR2-CYC1t；Then by cotransformation said gene expression cassette in saccharomyces cerevisiae
In CEN.PK2-1C, assemble to form the wine brewing ferment with complete enoxolone biosynthesis pathway using yeast homologous restructuring ability
Female engineering bacteria.
Further, the preparation of GgbAS genetic fragments is specially：Using saccharomyces cerevisiae codon preference to glycyrrhiza glabra
In β-amyrin synthase GgbAS gene orders (Genbank registration sequences number be AB037203) carry out codon optimization simultaneously
Chemical synthesis, then amplification obtains GgbAS genetic fragments (as shown in SEQ.ID No.1)；
Further, the preparation of CYP88D6 genetic fragments is specially：Using saccharomyces cerevisiae codon preference to Ural
Cytochrome P450 oxidase C YP88D6 gene orders (Genbank registration sequences number are AB433179) in radix glycyrrhizae carry out close
Numeral optimization and chemical synthesis, then amplification obtain CYP88D6 genetic fragments (as shown in SEQ.ID No.4)；
Further, the preparation of CYP72A154 genetic fragments is specially：Crow is drawn using saccharomyces cerevisiae codon preference
Cytochrome P450 oxidase C YP72A154 gene orders (Genbank registration sequences number are AB558146) in your radix glycyrrhizae are entered
Row codon optimization and chemical synthesis, then amplification obtain CYP72A154 genetic fragments (as shown in SEQ ID No.7)；
Further, the preparation of CPR1 genetic fragments is specially：Total serum IgE is extracted from arabidopsis leaf, reverse transcription into cDNA,
With arabidopsis cell pigment reductase CPR1 gene orders (Genbank registration sequences number is AB433179) design primer, utilize
CDNA is that template amplification obtains CPR1 genetic fragments (as shown in SEQ ID No.10)；
Further, the preparation of CPR2 genetic fragments is specially：Total serum IgE is extracted from arabidopsis leaf, reverse transcription into cDNA,
With arabidopsis cell pigment reductase CPR2 gene orders (Genbank registration sequences number is AB558146) design primer, utilize
CDNA is that template amplification obtains CPR2 genetic fragments (as shown in SEQ ID No.13)；
Further, the preparation of the expression casette is specially：Respectively by Yeast promoter FBA1p, terminator FBA1t
With the GgbAS genetic fragments, Yeast promoter PGK1p, terminator GMP1t and the CYP88D6 genetic fragments, yeast start
Sub- ENO2p, terminator TYS1t and the CYP72A154 genetic fragments, Yeast promoter ALA1p, terminator ALA1t and described
CPR1 genetic fragments, Yeast promoter GPM1p, terminator CYC1t and the CPR2 genetic fragments pass through two step Overlap extension PCRs
Connection, obtain expression casette FBA1p-GgbAS-FBA1t, PGK1p-CYP88D6-GMP1t, ALA1p-CPR1-ALA1t,
ENO2p-CYP72A154-TYS1t and GPM1p-CPR2-CYC1t.
The saccharomyces cerevisiae engineered yeast with complete enoxolone biosynthesis pathway is in fermenting and producing enoxolone
Application.
The advantageous effects of the present invention：
(1) the method for the invention has imported complete enoxolone route of synthesis, Neng Goufa in saccharomyces cerevisiae engineered yeast
Ferment produces enoxolone, realizes the artificial synthesized of enoxolone in saccharomyces cerevisiae.
(2) saccharomyces cerevisiae engineered yeast that the method for the invention is prepared, with advantages below：
Multiple expression casettes are passed through the powerful homologous recombination system of yeast by the saccharomyces cerevisiae engineered yeast constructed by the present invention
System restructuring is into Yeast genome, and expression heredity is more stable, and the stability of foreign gene is controlled without extra addition antibiotic.
In saccharomyces cerevisiae engineered yeast constructed by the present invention, enoxolone route of synthesis is by constitutive promoter control, hair
Ferment process need not add derivant, effector agent, save fermentation costs, and fermentation processes are simpler.
The saccharomyces cerevisiae engineered yeast of the present invention can provide the precursor of enoxolone synthesis using yeast own metabolism, can
Using glucose or ethanol as Material synthesis enoxolone, cost of material is low.
Brief description of the drawings
Fig. 1 is the component analysis ion flow graph of enoxolone standard items；
Fig. 2 is the component analysis ion flow graph of saccharomyces cerevisiae engineered yeast fermenting and producing enoxolone in the present invention.
Embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, it is right below in conjunction with drawings and Examples
The present invention is explained in further detail.It should be appreciated that specific embodiment described herein is used only for explaining the present invention, and
It is not used in the restriction present invention.
On the contrary, the present invention covers any replacement done in the spirit and scope of the present invention being defined by the claims, repaiied
Change, equivalent method and scheme.Further, in order that the public has a better understanding to the present invention, below to the thin of the present invention
It is detailed to describe some specific detail sections in section description.Part without these details for a person skilled in the art
Description can also understand the present invention completely.
Embodiment 1
A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, first with from glycyrrhiza glabra
β-amyrin synthase GgbAS genes (Genbank registration sequences number be AB037203), from the cell of Glycyrrhiza Uralensis
Cytochrome p 450 oxidase C YP88D6 genes (Genbank registration sequences number are AB433179) and Cytochrome P450 oxidizing ferment
CYP72A154 genes (Genbank registration sequences number be AB558146) and from the cytochrome reductase of arabidopsis
CPR1 genes (Genbank registration sequences number are AB433179) and cytochrome reductase CPR2 gene (Genbank registration sequences
Number be AB558146) prepare GgbAS genetic fragments, CYP88D6 genetic fragments, CYP72A154 genetic fragments, CPR1 genes
Fragment and CPR2 genetic fragments, said gene fragment and Yeast promoter and yeast terminator pass through two step overlap-extension PCRs respectively
PCR connections, obtain expression casette FBA1p-GgbAS-FBA1t, PGK1p-CYP88D6-GMP1t, ALA1p-CPR1-ALA1t,
ENO2p-CYP72A154-TYS1t and GPM1p-CPR2-CYC1t；Then by cotransformation said gene expression cassette in saccharomyces cerevisiae
In CEN.PK2-1C, assemble to form the wine brewing ferment with complete enoxolone biosynthesis pathway using yeast homologous restructuring ability
Female engineering bacteria.
Wherein, saccharomyces cerevisiae is as eukaryotic microorganisms, with precursor necessary to synthesis terpenoid, and the heredity back of the body
Scape understands that genetic manipulation is simple, with whole protein posttranslational modification function, therefore is expression plant source gene chemical synthesis radix glycyrrhizae
The outstanding potential host of hypo acid.Aoxidized by introducing the required β-amyrin synthase of enoxolone synthesis, Cytochrome P450
Enzyme and cytochrome P450 reductase realize that saccharomyces cerevisiae produces triterpenoid, will be other labyrinth terpenoids
The microorganism of thing manually efficiently synthesizes offer technical support.
The construction method specifically includes following steps：
1. the structure of expression casette
(1) inquiry obtains glycyrrhiza glabra β-amyrin synthase GgbAS gene orders from Genbank gene pools
(Genbank registration sequences number are AB037203), codon optimization, chemical synthesis are carried out using saccharomyces cerevisiae codon preference
Amplification obtains GgbAS genetic fragments afterwards (as shown in SEQ.ID No.1).
Primer sequence is：
5’>TTGTCATATATAACCATAACCAAGTAATACATATTCAAAA TGTGGAG ATTGAAGATCGC<3’
(as shown in SEQ.ID No.2)；With
5’>ATACTCATTAAAAAACTATATCAATTAATTTGAATTAACTT AAGTCAAACAAACTGGAG<3 ' (such as
Shown in SEQ ID No.3)；
(2) inquiry obtains Glycyrrhiza Uralensis Cytochrome P450 oxidase C YP88D6 gene sequences from Genbank gene pools
Row (Genbank registration sequences number are AB433179), carry out codon optimization, chemistry is closed using saccharomyces cerevisiae codon preference
CYP88D6 genetic fragments are obtained into rear amplification (as shown in SEQ ID No.4).Primer sequence is：
5’>AGGAAGTAATTATCTACTTTTTACAACAAATATAAAACAA TGGAAG TACATTGGGTTTG<3’
(as shown in SEQ ID No.5)；With
5’>GAGGGAAAAAGAAATCATCAAATCATTCATTCTTCAGAC TTAAGCACAAGAAACCTTGA<3 ' (such as
Shown in SEQ ID No.6).
(3) inquiry obtains Glycyrrhiza Uralensis Cytochrome P450 oxidase C YP72A154 genes from Genbank gene pools
Sequence (Genbank registration sequences number are AB558146), codon optimization, chemistry are carried out using saccharomyces cerevisiae codon preference
Amplification obtains CYP72A154 genetic fragments after synthesis (as shown in SEQ ID No.7).Primer sequence is：
5’>CATAACACCAAGCAACTAATACTATAACATACAATAATAA TGGACGC TTCTTCTACTCC<3’
(as shown in SEQ ID No.8)；With
5’>TTATTATATTATGAATCGTGAAAACGGATTAAGCTATGCT TACAACTTGTGCAAGATGA<3 ' (such as
Shown in SEQ ID No.9)；
(4) total serum IgE is extracted from fresh arabidopsis leaf, reverse transcription is obtained into cDNA to be inquired about in Genbank gene pools
Arabidopsis cell pigment reductase CPR1 gene orders (Genbank registration sequences number be AB433179) design primer, utilize
CDNA is that template amplification obtains CPR1 genetic fragments (as shown in SEQ ID No.10).Primer sequence is：
5’>TCTTTCAAGAAGCAATTAACTACATCAACTAGAACCATA ATGACTT CTGCTTTGTATGC<3’
(as shown in SEQ ID No.11)；With
5’>AGAACTCCTATGCATTATTTTTCGTTTTATTTTAACTTCTC ACCAGACATCTCTGAGGT<3 ' (such as
Shown in SEQ ID No.12)；
(5) total serum IgE is extracted from fresh arabidopsis leaf, reverse transcription is obtained into cDNA to be inquired about in Genbank gene pools
Arabidopsis cell pigment reductase CPR2 gene orders (Genbank registration sequences number be AB558146) design primer, utilize
CDNA is that template amplification obtains CPR2 genetic fragments (as shown in SEQ ID No.13).Primer sequence is：
5’>TTCTTCTTAATAATCCAAACAAACACACATATTACAATAA TGTCCTC TTCTTCTTCTTC<3’
(as shown in SEQ ID No.14)；With
5’>GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGA TTACCATACATCTCTAAGAT<3 ' (such as
Shown in SEQ ID No.15).
2. respectively by Yeast promoter FBA1p, terminator FBA1t and the GgbAS genetic fragments, Yeast promoter
PGK1p, terminator GMP1t and the CYP88D6 genetic fragments, Yeast promoter ENO2p, terminator TYS1t and described
CYP72A154 genetic fragments, Yeast promoter ALA1p, terminator ALA1t and the CPR1 genetic fragments, Yeast promoter
GPM1p, terminator CYC1t and the CPR2 genetic fragments are connected by two step Overlap extension PCRs, obtain expression casette
FBA1p-GgbAS-FBA1t、PGK1p-CYP88D6-GMP1t、ALA1p-CPR1-ALA1t、ENO2p-CYP72A154-TYS1t
And GPM1p-CPR2-CYC1t.
3. the structure of enoxolone biosynthesis pathway
(1) clone of homology arm is recombinated
Using saccharomyces cerevisiae CEN.PK2-1C genomes as template, primer 5 ' is designed>
GAAGTACCTCCCAACTACTTTTCCTCAC<3 ' (as shown in SEQ ID No.16) and 5 '>
GCCAAGTAGGCAATTATTTAGTACTGTCAGTATTG TTATGATAGTTTAACGGAAACGCA<3 ' (such as SEQ ID
Shown in No.17), amplification rDNA sequences obtain left homology arm NTS2 (as shown in SEQ ID No.18).Design primer
5’>TTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGGC GGTTGCGGCCATATCTACCA<3 ' (such as
Shown in SEQ ID No.19)；With
5’>CGTTGCAAAGATGGGTTGAAAGAG<3 ' (as shown in SEQ ID No.20) amplification rDNA sequences obtain the right side
Homology arm NTS1 (as shown in SEQ ID No.21).
(2) clone of resistance screening mark
Using plasmid pRS41H as template, primer 5 ' is designed>
TTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGGCCA GCGACATGGAGGCCCAGA<3 ' (such as SEQ ID
Shown in No.22)；With
5’>GACGGGAAACGGTGCTTTCTGGTAGATATGGCCGCAAC CGCCGTCCCAAAACCTTCTCA<3 ' (such as
Shown in SEQ ID No.23) amplification acquisition hygromycin selectable marker TEF1p-hphNT1-CYCt.
(3) connection that homology arm is marked with expression casette or resistance screening
Left homology arm NTS2 and β-amyrin Synthase Gene Expression box FBA1p-GgbAS-FBA1t are passed through into overlap-extension PCR
PCR connections, obtain NTS2-FBA1p-GgbAS-FBA1t.
Right homology arm NTS1 is connected with hygromycin selectable marker TEF1p-hphNT1-CYCt by Overlap extension PCR, obtained
To TEF1p-hphNT1-CYCt-NTS1.
(4) assembling of enoxolone biosynthesis pathway
By NTS2-FBA1p-GgbAS-FBA1t, PGK1p-CYP88D6-GMP1t, ALA1p-CPR1-ALA1t, ENO2p-
CYP72A154-TYS1t, GPM1p-CPR2-CYC1t and TEF1p-hphNT1-CYCt-NTS1 expression casette utilize electric shocking method
Transformed saccharomyces cerevisiae CEN.PK2-1C, yeast is inserted into using the homologous recombination ability of saccharomyces cerevisiae by enoxolone route of synthesis
On genome.
4. the identification of saccharomyces cerevisiae engineered yeast
By it is above-mentioned it is electroporated after saccharomyces cerevisiae CEN.PK2-1C be coated on containing in Hygromycin B resistant screening flat board,
Because recombination module contains hygromycin B resistant gene, convert successful engineered strain and grown on Hygromycin B resistant flat board.Enter
One step utilizes bacterium colony PCR Screening and Identification positive colonies, obtains saccharomyces cerevisiae engineered yeast.
Embodiment 2
The checking of saccharomyces cerevisiae engineered yeast fermenting and producing enoxolone
The saccharomyces cerevisiae engineered yeast that embodiment 1 is filtered out is selected, is containing 2% glucose, 2% peptone and 1% ferment
30 DEG C of Shaking cultures in the culture medium of female powder, take the saccharomyces cerevisiae bacterium solution 8000rpm centrifugation 10min after 50ml cultures, go after 7 days
Fall culture medium, use 30ml sterile water wash, 8000rpm centrifugation 10min abandon supernatant, are resuspended with 2ml saturated nacl aqueous solutions thin
Born of the same parents.Break broken 5 5min of instrument break up cell using cell column, isometric ethyl acetate is added into centrifuge tube, be vortexed concussion
3min, fully extracts yeast extract.8000rpm centrifuges 10min, draws organic phase into heart bottle, is steamed in Rotary Evaporators
Dry ethyl acetate, adds 1ml methanol and fully dissolves, cross 0.22 μm of filter membrane, the sample handled is carried out into liquid chromatography-mass spectrography
(HPLC-MS) detect, carry out the analysis of saccharomyces cerevisiae engineered yeast fermenting and producing enoxolone, carried in saccharomyces cerevisiae engineered yeast cell
Ion flow graph (as shown in Figure 1) consistent with enoxolone standard items in liquid ion flow graph (as shown in Figure 2) is taken, is as a result illustrated as
Work(builds the saccharomyces cerevisiae engineered yeast of biosynthesis enoxolone, can synthesize enoxolone.
Embodiment 3
Saccharomyces cerevisiae engineered yeast fermenting and producing enoxolone
The saccharomyces cerevisiae engineered yeast single bacterium colony that embodiment 1 is filtered out is selected, is inoculated in containing 2% glucose, 2% peptone
In the 30mL culture mediums of 1% dusty yeast, 30 DEG C, 150rpm shaken cultivations, the nutrient solution after 36h are used as seed liquor.By seed
Liquid according to 10% inoculum concentration inoculation as in the 500mL shaking flasks for filling 150mL culture mediums, 30 DEG C, 170rpm shaken cultivations,
The sugared concentration of glucose is added to 0.5~1.0% every 12h after 24h, and fermentation determines enoxolone in brewing yeast cell and contained after 5 days
Amount, finds saccharomyces cerevisiae engineered yeast synthesis enoxolone 35.5 μ g/L.
Ferment after 24h using ethanol be carbon source every 12h feed supplements, discovery adds concentration at 0.4~0.6%, ferments 5 days
After to measure in cell enoxolone concentration be 48.6 μ g/L.
SEQUENCE LISTING
<110>Shihezi Univ
<120>A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone
<160> 23
<170> PatentIn version 3.5
<210> 1
<211> 2298
<212> DNA
<213>Artificial sequence
<400> 1
atgtggagat tgaagatcgc tgaaggtggt aaggacccat acatctactc tactaacaac 60
ttcgttggta gacaaacttg ggaatacgac ccagacggtg gtactccaga agaaagagct 120
caagttgacg ctgctagatt gcacttctac aacaacagat tccaagttaa gccatgtggt 180
gacttgttgt ggagattcca aatcttgaga gaaaacaact tcaagcaaac tatcgcttct 240
gttaagatcg gtgacggtga agaaatcact tacgaaaagg ctactactgc tgttagaaga 300
gctgctcacc acttgtctgc tttgcaaact tctgacggtc actggccagc tcaaatcgct 360
ggtccattgt tcttcttgcc accattggtt ttctgtatgt acatcactgg tcacttggac 420
tctgttttcc cagaagaata cagaaaggaa atcttgagat acatctacta ccaccaaaac 480
gaagacggtg gttggggttt gcacatcgaa ggtcactcta ctatgttctg tactgctttg 540
aactacatct gtatgagaat cttgggtgaa ggtccagacg gtggtcaaga caacgcttgt 600
gctagagcta gaaagtggat ccacgaccac ggtggtgtta ctcacatccc atcttggggt 660
aagacttggt tgtctatctt gggtgttttc gactggtgtg gttctaaccc aatgccacca 720
gaattctgga tcttgccatc tttcttgcca atgcacccag ctaagatgtg gtgttactgt 780
agattggttt acatgccaat gtcttacttg tacggtaaga gattcgttgg tccaatcact 840
ccattgatct tgcaattgag agaagaattg ttcactgaac catacgaaaa ggttaactgg 900
aagaaggcta gacaccaatg tgctaaggaa gacttgtact acccacaccc attgttgcaa 960
gacttgatct gggactcttt gtacttgttc actgaaccat tgttgactag atggccattc 1020
aacaagttgg ttagagaaaa ggctttgcaa gttactatga agcacatcca ctacgaagac 1080
gaaacttcta gatacatcac tatcggttgt gttgaaaagg ttttgtgtat gttggcttgt 1140
tgggttgaag acccaaacgg tgacgctttc aagaagcact tggctagagt tccagactac 1200
ttgtgggttt ctgaagacgg tatgactatg caatctttcg gttctcaaga atgggacgct 1260
ggtttcgctg ttcaagcttt gttggctact aacttggttg aagaaatcgc tccaactttg 1320
gctaagggtc acgacttcat caagaagtct caagttagag acaacccatc tggtgacttc 1380
aagtctatgt acagacacat ctctaaaggc tcttggacat tctctgacca agaccacggt 1440
tggcaagttt ctgactgtac tgctgaaggt ttgaagtgtt gtttgttgtt gtctatgttg 1500
ccaccagaaa tcgttggtga aaagatggaa ccagaaagat tgtacgactc tgttaacgtt 1560
ttgttgtctt tgcaatctaa gaagggtggt ttgtctgctt gggaaccagc tggtgctcaa 1620
gaatggttgg aattgttgaa cccaactgaa ttcttcgctg acatcgttgt tgaacacgaa 1680
tacgttgaat gtactggttc tgctatacaa gcgttggtgc tgttcaagaa gttgtaccca 1740
ggtcacagaa agaaggaaat cgaaaacttc atcgctaacg ctgttagatt cttggaagac 1800
actcaaactg ctgacggttc ttggtacggt aactggggtg tttgtttcac ttacggttct 1860
tggttcgctt tgggtggttt ggctgctgct ggtaagactt tcgctaactg tgctgctatc 1920
agaaaggctg ttaagttctt gttgactact caaagagaag acggtggttg gggtgaatct 1980
tacttgtctt ctccaaagaa gatctacgtt ccattggaag gttctagatc taacgttgtt 2040
cacactgctt gggctttgat gggtttgatc cacgctggtc aagctgaaag agacccagct 2100
ccattgcaca gagctgctaa gttgatcatc aactctcaat tggaagaagg tgactggcca 2160
caacaagaaa tcactggtgt tttcatgaag aactgtatgt tgcactaccc aatgtacaga 2220
gacatctatc ccatgtgggc tctcgctgaa taccgtagaa gagttccatt gccatctact 2280
ccagtttgtt tgacttaa 2298
<210> 2
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 2
ttgtcatata taaccataac caagtaatac atattcaaaa tgtggagatt gaagatcgc 59
<210> 3
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 3
atactcatta aaaaactata tcaattaatt tgaattaact taagtcaaac aaactggag 59
<210> 4
<211> 1482
<212> DNA
<213>Artificial sequence
<400> 4
atggaagttc actgggtttg tatgtctgct gctactttgt tggtttgtta catcttcggt 60
tctaagttcg ttagaaactt gaacggttgg tactacgacg ttaagttgag aagaaaggaa 120
cacccattgc caccaggtga catgggttgg ccattgatcg gtgacttgtt gtctttcatc 180
aaggacttct cttctggtca cccagactct ttcatcaaca acttggtttt gaagtacggt 240
agatctggta tctacaagac tcacttgttc ggtaacccat ctatcatcgt ttgtgaacca 300
caaatgtgta gaagagtttt gactgacgac gttaacttca agttgggtta cccaaagtct 360
atcaaggaat tggctagatg tagaccaatg atcgacgttt ctaacgctga acacagattg 420
ttcagaagat tgatcacttc tccaatcgtt ggtcacaagg ctttggctat gtacttggaa 480
agattggaag aaatcgttat caactctttg gaagaattgt cttctatgaa gcacccagtt 540
gaattgttga aggaaatgaa gaaggtttct ttcaaggcta tcgttcacgt tttcatgggt 600
tcttctaacc aagacatcat caagaagatc ggttcttctt tcactgactt gtacaacggt 660
atgttctcta tcccaatcaa cgttccaggt ttcactttcc acaaggcttt ggaagctaga 720
aagaagttgg ctaagatcgt tcaaccagtt gttgacgaaa gaagattgat gatcgaaaac 780
ggtccacaag aaggttctca aagaaaggac ttgatcgaca tcttgttgga agttaaggac 840
gaaaacggta gaaagttgga agacgaagac atctctgact tgttgatcgg tttgttgttc 900
gctggtcacg aatctactgc tacttctttg atgtggtcta tcacttactt gactcaacac 960
ccacacatct tgaagaaggc taaggaagaa caagaagaaa tcactagaac tagattctct 1020
tctcaaaagc aattgtcttt gaaggaaatc aagcaaatgg tttacttgtc tcaagttatc 1080
gacgaaactt tgagatgtgc taacatcgct ttcgctactt tcagagaagc tactgctgac 1140
gttaacatca acggttacat catcccaaag ggttggagag ttttgatctg ggctagagct 1200
atccacatgg actctgaata ctacccaaac ccagaagaat tcaacccatc tagatgggac 1260
gactacaacg ctaaggctgg tactttcttg ccattcggtg ctggttctag attgtgtcca 1320
ggtgctgact tggctaagtt ggaaatctct atcttcttgc actacttctt gagaaactac 1380
agattggaaa gaatcaaccc agaatgtcac gttacttctt tgccagtttc taagccaact 1440
gacaactgtt tggctaaggt tatcaaggtt tcttgtgctt aa 1482
<210> 5
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 5
aggaagtaat tatctacttt ttacaacaaa tataaaacaa tggaagttca ctgggtttg 59
<210> 6
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 6
gagggaaaaa gaaatcatca aatcattcat tcttcagact taagcacaag aaaccttga 59
<210> 7
<211> 1572
<212> DNA
<213>Artificial sequence
<400> 7
atggacgctt cttctactcc aggtgctatc tgggttgttt tgactgttat cttggctgct 60
atcccaatct gggtttgtca catggttaac actttgtggt tgagaccaaa gagattggaa 120
agacacttga gagctcaagg tttgcacggt gacccataca agttgtcttt ggacaactct 180
aagcaaactt acatgttgaa gttgcaacaa gaagctcaat ctaagtctat cggtttgtct 240
aaggacgacg ctgctccaag aatcttctct ttggctcacc aaactgttca caagtacggt 300
aagaactctt tcgcttggga aggtactgct ccaaaggtta tcatcactga cccagaacaa 360
atcaaggaag ttttcaacaa gatccaagac ttcccaaagc caaagttgaa cccaatcgct 420
aagtacatct ctatcggttt ggttcaatac gaaggtgaca agtgggctaa gcacagaaag 480
atcatcaacc cagctttcca cttggaaaag ttgaagggta tgttgccagc tttctctcac 540
tcttgtcacg aaatgatctc taagtggaag ggtttgttgt cttctgacgg tacttgtgaa 600
gttgacgttt ggccattctt gcaaaacttg acttgtgacg ttatctctag aactgctttc 660
ggttcttctt acgctgaagg tgctaagatc ttcgaattgt tgaagagaca aggttacgct 720
ttgatgactg ctagatacgc tagaatccca ttgtggtggt tgttgccatc tactactaag 780
agaagaatga aggaaatcga aagaggtatc agagactctt tggaaggtat catcagaaag 840
agagaaaagg ctttgaagtc tggtaagtct actgacgacg acttgttggg tatcttgttg 900
caatctaacc acatcgaaaa caagggtgac gaaaactcta agtctgctgg tatgactact 960
caagaagtta tggaagaatg taagttgttc tacttggctg gtcaagaaac tactgctgct 1020
ttgttggctt ggactatggt tttgttgggt aagcacccag aatggcaagc tagagctaga 1080
caagaagttt tgcaagtttt cggtaaccaa aacccaaact tcgaaggttt gggtagattg 1140
aagatcgtta ctatgatctt gtacgaagtt ttgagattgt acccaccagg tatctacttg 1200
actagagctt tgagaaagga cttgaagttg ggtaacttgt tgttgccagc tggtgttcaa 1260
gtttctgttc caatcttgtt gatccaccac gacgaaggta tctggggtaa cgacgctaag 1320
gaattcaacc cagaaagatt cgctgaaggt atcgctaagg ctactaaggg tcaagtttgt 1380
tacttcccat tcggttgggg tccaagaatc tgtgttggtc aaaacttcgc tttgttggaa 1440
gctaagatcg ttttgtcttt gttgttgcaa aacttctctt tcgaattgtc tccaacttac 1500
gctcacgttc caactactgt tttgactttg caaccaaagc acggtgctcc aatcatcttg 1560
cacaagttgt aa 1572
<210> 8
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 8
cataacacca agcaactaat actataacat acaataataa tggacgcttc ttctactcc 59
<210> 9
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 9
ttattatatt atgaatcgtg aaaacggatt aagctatgct tacaacttgt gcaagatga 59
<210> 10
<211> 2067
<212> DNA
<213>Artificial sequence
<400> 10
atgacttctg ctttgtatgc ttccgatttg tttaagcagc tcaagtcaat tatggggaca 60
gattcgttat ccgacgatgt tgtacttgtg attgcaacga cgtctttggc actagtagct 120
ggatttgtgg tgttgttatg gaagaaaacg acggcggatc ggagcgggga gctgaagcct 180
ttgatgatcc ctaagtctct tatggctaag gacgaggatg atgatttgga tttgggatcc 240
gggaagacta gagtctctat cttcttcggt acgcagactg gaacagctga gggatttgct 300
aaggcattat ccgaagaaat caaagcgaga tatgaaaaag cagcagtcaa agatgactat 360
gctgccgatg atgaccagta tgaagagaaa ttgaagaagg aaactttggc atttttctgt 420
gttgctactt atggagatgg agagcctact gacaatgctg ccagatttta caaatggttt 480
acggaggaaa atgaacggga tataaagctt caacaactag catatggtgt gtttgctctt 540
ggtaatcgcc aatatgaaca ttttaataag atcgggatag ttcttgatga agagttatgt 600
aagaaaggtg caaagcgtct tattgaagtc ggtctaggag atgatgatca gagcattgag 660
gatgatttta atgcctggaa agaatcacta tggtctgagc tagacaagct cctcaaagac 720
gaggatgata aaagtgtggc aactccttat acagctgtta ttcctgaata ccgggtggtg 780
actcatgatc ctcggtttac aactcaaaaa tcaatggaat caaatgtggc caatggaaat 840
actactattg acattcatca tccctgcaga gttgatgttg ctgtgcagaa ggagcttcac 900
acacatgaat ctgatcggtc ttgcattcat ctcgagttcg acatatccag gacgggtatt 960
acatatgaaa caggtgacca tgtaggtgta tatgctgaaa atcatgttga aatagttgaa 1020
gaagctggaa aattgcttgg ccactcttta gatttagtat tttccataca tgctgacaag 1080
gaagatggct ccccattgga aagcgcagtg ccgcctcctt tccctggtcc atgcacactt 1140
gggactggtt tggcaagata cgcagacctt ttgaaccctc ctcgaaagtc tgcgttagtt 1200
gccttggcgg cctatgccac tgaaccaagt gaagccgaga aacttaagca cctgacatca 1260
cctgatggaa aggatgagta ctcacaatgg attgttgcaa gtcagagaag tcttttagag 1320
gtgatggctg cttttccatc tgcaaaaccc ccactaggtg tattttttgc tgcaatagct 1380
cctcgtctac aacctcgtta ctactccatc tcatcctcgc caagattggc gccaagtaga 1440
gttcatgtta catccgcact agtatatggt ccaactccta ctggtagaat ccacaagggt 1500
gtgtgttcta cgtggatgaa gaatgcagtt cctgcggaga aaagtcatga atgtagtgga 1560
gccccaatct ttattcgagc atctaatttc aagttaccat ccaacccttc aactccaatc 1620
gttatggtgg gacctgggac tgggctggca ccttttagag gttttctgca ggaaaggatg 1680
gcactaaaag aagatggaga agaactaggt tcatctttgc tcttctttgg gtgtagaaat 1740
cgacagatgg actttatata cgaggatgag ctcaataatt ttgttgatca aggcgtaata 1800
tctgagctca tcatggcatt ctcccgtgaa ggagctcaga aggagtatgt tcaacataag 1860
atgatggaga aggcagcaca agtttgggat ctaataaagg aagaaggata tctctatgta 1920
tgcggtgatg ctaagggcat ggcgagggac gtccaccgaa ctctacacac cattgttcag 1980
gagcaggaag gtgtgagttc gtcagaggca gaggctatag ttaagaaact tcaaaccgaa 2040
ggaagatacc tcagagatgt ctggtga 2067
<210> 11
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 11
tctttcaaga agcaattaac tacatcaact agaaccataa tgacttctgc tttgtatgc 59
<210> 12
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 12
agaactccta tgcattattt ttcgttttat tttaacttct caccagacat ctctgaggt 59
<210> 13
<211> 2139
<212> DNA
<213>Artificial sequence
<400> 13
atgtcctctt cttcttcttc gtcaacctcc atgatcgatc tcatggcagc aatcatcaaa 60
ggagagcctg taattgtctc cgacccagct aatgcctccg cttacgagtc cgtagctgct 120
gaattatcct ctatgcttat agagaatcgt caattcgcca tgattgttac cacttccatt 180
gctgttctta ttggttgcat cgttatgctc gtttggagga gatccggttc tgggaattca 240
aaacgtgtcg agcctcttaa gcctttggtt attaagcctc gtgaggaaga gattgatgat 300
gggcgtaaga aagttaccat ctttttcggt acacaaactg gtactgctga aggttttgca 360
aaggctttag gagaagaagc taaagcaaga tatgaaaaga ccagattcaa aatcgttgat 420
ttggatgatt acgcggctga tgatgatgag tatgaggaga aattgaagaa agaggatgtg 480
gctttcttct tcttagccac atatggagat ggtgagccta ccgacaatgc agcgagattc 540
tacaaatggt tcaccgaggg gaatgacaga ggagaatggc ttaagaactt gaagtatgga 600
gtgtttggat taggaaacag acaatatgag cattttaata aggttgccaa agttgtagat 660
gacattcttg tcgaacaagg tgcacagcgt cttgtacaag ttggtcttgg agatgatgac 720
cagtgtattg aagatgactt taccgcttgg cgagaagcat tgtggcccga gcttgataca 780
atactgaggg aagaagggga tacagctgtt gccacaccat acactgcagc tgtgttagaa 840
tacagagttt ctattcacga ctctgaagat gccaaattca atgatataaa catggcaaat 900
gggaatggtt acactgtgtt tgatgctcaa catccttaca aagcaaatgt cgctgttaaa 960
agggagcttc atactcccga gtctgatcgt tcttgtatcc atttggaatt tgacattgct 1020
ggaagtggac ttacgtatga aactggagat catgttggtg tactttgtga taacttaagt 1080
gaaactgtag atgaagctct tagattgctg gatatgtcac ctgatactta tttctcactt 1140
cacgctgaaa aagaagacgg cacaccaatc agcagctcac tgcctcctcc cttcccacct 1200
tgcaacttga gaacagcgct tacacgatat gcatgtcttt tgagttctcc aaagaagtct 1260
gctttagttg cgttggctgc tcatgcatct gatcctaccg aagcagaacg attaaaacac 1320
cttgcttcac ctgctggaaa ggttgatgaa tattcaaagt gggtagtaga gagtcaaaga 1380
agtctacttg aggtgatggc cgagtttcct tcagccaagc caccacttgg tgtcttcttc 1440
gctggagttg ctccaaggtt gcagcctagg ttctattcga tatcatcatc gcccaagatt 1500
gctgaaacta gaattcacgt cacatgtgca ctggtttatg agaaaatgcc aactggcagg 1560
attcataagg gagtgtgttc cacttggatg aagaatgctg tgccttacga gaagagtgaa 1620
aactgttcct cggcgccgat atttgttagg caatccaact tcaagcttcc ttctgattct 1680
aaggtaccga tcatcatgat cggtccaggg actggattag ctccattcag aggattcctt 1740
caggaaagac tagcgttggt agaatctggt gttgaacttg ggccatcagt tttgttcttt 1800
ggatgcagaa accgtagaat ggatttcatc tacgaggaag agctccagcg atttgttgag 1860
agtggtgctc tcgcagagct aagtgtcgcc ttctctcgtg aaggacccac caaagaatac 1920
gtacagcaca agatgatgga caaggcttct gatatctgga atatgatctc tcaaggagct 1980
tatttatatg tttgtggtga cgccaaaggc atggcaagag atgttcacag atctctccac 2040
acaatagctc aagaacaggg gtcaatggat tcaactaaag cagagggctt cgtgaagaat 2100
ctgcaaacga gtggaagata tcttagagat gtatggtaa 2139
<210> 14
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 14
ttcttcttaa taatccaaac aaacacacat attacaataa tgtcctcttc ttcttcttc 59
<210> 15
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 15
gagggcgtga atgtaagcgt gacataacta attacatgat taccatacat ctctaagat 59
<210> 16
<211> 28
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 16
gaagtacctc ccaactactt ttcctcac 28
<210> 17
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 17
gccaagtagg caattattta gtactgtcag tattgttatg atagtttaac ggaaacgca 59
<210> 18
<211> 1243
<212> DNA
<213>Artificial sequence
<400> 18
gaagtacctc ccaactactt ttcctcacac ttgtactcca tgactaaacc ccccctccca 60
ttacaaacta aaatcttact tttattttct tttgccctct ctgtcgctct gccttaacta 120
cgtatttctc gccgagaaaa acttcaattt aagctattct ccaaaaatct tagcgtatat 180
tttttttcca aagtgacagg tgccccgggt aacccagttc ctcactattt tttactgcgg 240
aagcggaagc ggaaaatacg gaaacgcgcg ggaacataca aaacatacaa aatatacctt 300
tctcacacaa gaaatatatg ctacttgcaa aatatcatac caaaaaactt ttcacaaccg 360
aaaccaaaac caacggatat catacattac actaccacca ttcaaacttt actactatcc 420
tcccttcagt ttcccttttt ctgccttttt cggtgacgga aatacgcttc agagacccta 480
aagggaaatc catgccataa caggaaagta acatcccaat gcggactata ccaccccacc 540
acactcctac caataacggt aactattcta tgttttctta ctcctatgtc tattcatctt 600
tcatctgact acctaatact atgcaaaaat gtaaaatcat cacacaaaac ataaacaatc 660
aaaatcagcc atttccgcac cttttcctct gtccactttc aaccgtccct ccaaatgtaa 720
aatggcctat cggaatacat tttctacatc ctaactacta taaaacaacc tttagactta 780
cgtttgctac tctcatggtc tcaatactgc cgccgacatt ctgtcccaca tactaaatct 840
cttcccgtca ttatcgcccg catccggtgc cgtaaatgca aaacaaatac catctatgtc 900
ttccacacca tcattttact atgcctgcca ccatccattt gtcttttgca ccatatcttc 960
ataacctgtc accttgaaac tacctctgca tgccacctac cgaccaactt tcatgttctg 1020
tttcgaccta cctcttgtaa atgacaaatc acctttttca tcgtatgcac cttattctcc 1080
acatcacaat gcactattgc ttttgctttt tcacctgtca tatcctattg ctattagatg 1140
aaatataata aaaattgtcc tccacccata acacctctca ctcccaccta ctgaacatgt 1200
ctggaccctg ccctcatatc acctgcgttt ccgttaaact atc 1243
<210> 19
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 19
ttatactgaa aaccttgctt gagaaggttt tgggacggcg gttgcggcca tatctacca 59
<210> 20
<211> 24
<212> DNA
<213> Artificial
<220>
<223>Primer
<400> 20
cgttgcaaag atgggttgaa agag 24
<210> 21
<211> 1001
<212> DNA
<213>Artificial sequence
<400> 21
ggttgcggcc atatctacca gaaagcaccg tttcccgtcc gatcaactgt agttaagctg 60
gtaagagcct gaccgagtag tgtagtgggt gaccatacgc gaaactcagg tgctgcaatc 120
tttatttctt tttttttttt tttttttttt tttttttcta gtttcttggc ttcctatgct 180
aaatcccata actaacctac cattcgattc agaaaaattc gcactatcca gctgcactct 240
tcttctgaag agttaagcac tccattatgc tcattgggtt gctactactt gatatgtaca 300
aacaatattc tcctccgata ttcctacaaa aaaaaaaaaa aaaacactcc ggttttgttc 360
tcttccctcc atttccctct cttctacggt taatactttc ctcttcgtct ttttctacac 420
cctcgtttag ttgcttctta ttccttcccg ctttcctgca ctaacatttt gccgcattac 480
actatatgat cgtagtacat cttacaactc cgcataccgc gtcgccgcgt cgccgcgtcg 540
ccaaaaattt acttcgccaa ccattccata tctgttaagt atacatgtat atattgcact 600
ggctattcat cttgcacttt tcctctttct tcttcccagt agcctcatcc ttttacgctg 660
cctctctgga acttgccatc atcattccct agaaactgcc atttacttaa aaaaaaaaaa 720
aaaaaaaaaa tgtccccact gttcactgtt cactgttcac ttgtctctta catctttctt 780
ggtaaaatcg tagttcgtag tatttttttt catatcaaag gcatgtcctg ttaactatag 840
gaaatgagct tttctcaatt ctctaaactt atacaagcac tcatgtttgc cgctctgatg 900
gtgcggaaaa aactgctcca tgaagcaaac tgtccgggca aatcctttca cgctcgggaa 960
gctttgtgaa agcccttctc tttcaaccca tctttgcaac g 1001
<210> 22
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 22
ttatactgaa aaccttgctt gagaaggttt tgggacggcc agcgacatgg aggcccaga 59
<210> 23
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>Primer
<400> 23
gacgggaaac ggtgctttct ggtagatatg gccgcaaccg ccgtcccaaa accttctca 59
Claims (8)
1. a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, it is characterised in that first with source
β-amyrin synthase GgbAS genes (Genbank registration sequences number be AB037203) in glycyrrhiza glabra, from Ural
The Cytochrome P450 oxidase C YP88D6 genes (Genbank registration sequences number are AB433179) and cytochromes of radix glycyrrhizae
P450 oxidase C YP72A154 genes (Genbank registration sequences number be AB558146) and from the cell color of arabidopsis
Plain reductase CPR1 genes (Genbank registration sequences number are AB433179) and cytochrome reductase CPR2 genes (Genbank
Registration sequence number be AB558146) prepare GgbAS genetic fragments, CYP88D6 genetic fragments, CYP72A154 genetic fragments,
CPR1 genetic fragments and CPR2 genetic fragments, pass through two by said gene fragment and Yeast promoter and yeast terminator respectively
Overlap extension PCR connection is walked, expression casette FBA1p-GgbAS-FBA1t, PGK1p-CYP88D6-GMP1t, ALA1p- is obtained
CPR1-ALA1t, ENO2p-CYP72A154-TYS1t and GPM1p-CPR2-CYC1t；Then cotransformation said gene expression cassette in
In saccharomyces cerevisiae CEN.PK2-1C, assemble to be formed with complete enoxolone biosynthesis pathway using yeast homologous restructuring ability
Saccharomyces cerevisiae engineered yeast.
2. a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, its feature according to claim 1
It is, the preparation of GgbAS genetic fragments is specially：Using saccharomyces cerevisiae codon preference to β-botany bar gum in glycyrrhiza glabra
Alcohol synthase GgbAS gene orders (Genbank registration sequences number are AB037203) carry out codon optimization and chemical synthesis, then
Amplification obtains GgbAS genetic fragments (SEQ.ID No.1).
3. a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, its feature according to claim 1
It is, the preparation of CYP88D6 genetic fragments is specially：Using saccharomyces cerevisiae codon preference to the cell in Glycyrrhiza Uralensis
Cytochrome p 450 oxidase C YP88D6 gene orders (Genbank registration sequences number are AB433179) carry out codon optimization and changed
Synthesis is learned, then amplification obtains CYP88D6 genetic fragments (SEQ.ID No.4).
4. a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, its feature according to claim 1
It is, the preparation of CYP72A154 genetic fragments is specially：Using saccharomyces cerevisiae codon preference to thin in Glycyrrhiza Uralensis
Born of the same parents cytochrome p 450 oxidase C YP72A154 gene orders (Genbank registration sequences number are AB558146) carry out codon optimization
And chemical synthesis, then expand and obtain CYP72A154 genetic fragments (SEQ ID No.7).
5. a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, its feature according to claim 1
It is, the preparation of CPR1 genetic fragments is specially：Total serum IgE is extracted from arabidopsis leaf, reverse transcription is into cDNA, with arabidopsis cell
Pigment reductase CPR1 gene orders (Genbank registration sequences number are AB433179) design primer, is expanded using cDNA for template
Increase and obtain CPR1 genetic fragments (SEQ ID No.10).
6. a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, its feature according to claim 1
It is, the preparation of CPR2 genetic fragments is specially：Total serum IgE is extracted from arabidopsis leaf, reverse transcription is into cDNA, with arabidopsis cell
Pigment reductase CPR2 gene orders (Genbank registration sequences number are AB558146) design primer, is expanded using cDNA for template
Increase and obtain CPR2 genetic fragments (SEQ ID No.13).
7. a kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone, its feature according to claim 1
It is, the preparation of the expression casette is specially：Respectively by Yeast promoter FBA1p, terminator FBA1t and the GgbAS
Genetic fragment, Yeast promoter PGK1p, terminator GMP1t and the CYP88D6 genetic fragments, Yeast promoter ENO2p, end
Only sub- TYS1t and the CYP72A154 genetic fragments, Yeast promoter ALA1p, terminator ALA1t and the CPR1 genes piece
Section, Yeast promoter GPM1p, terminator CYC1t and the CPR2 genetic fragments are connected by two step Overlap extension PCRs, obtained
Expression casette FBA1p-GgbAS-FBA1t, PGK1p-CYP88D6-GMP1t, ALA1p-CPR1-ALA1t, ENO2p-
CYP72A154-TYS1t and GPM1p-CPR2-CYC1t.
8. according to application of any saccharomyces cerevisiae engineered yeasts of claim 1-7 in fermenting and producing enoxolone.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710179505.2A CN106987533A (en) | 2017-03-23 | 2017-03-23 | A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710179505.2A CN106987533A (en) | 2017-03-23 | 2017-03-23 | A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106987533A true CN106987533A (en) | 2017-07-28 |
Family
ID=59412883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710179505.2A Pending CN106987533A (en) | 2017-03-23 | 2017-03-23 | A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106987533A (en) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108373980A (en) * | 2018-04-09 | 2018-08-07 | 石河子大学 | A kind of S. cervisiae, its construction method and its application in fermentation prepares lycopene |
| CN111235045A (en) * | 2020-01-19 | 2020-06-05 | 天津大学 | Recombinant yarrowia lipolytica for heterologous synthesis of β -balsam stem and oleanolic acid and construction method thereof |
| CN111235047A (en) * | 2020-02-12 | 2020-06-05 | 天津大学 | Recombinant yarrowia lipolytica for heterogeneously synthesizing α -coumarol and ursolic acid and construction method |
| CN111411089A (en) * | 2020-03-02 | 2020-07-14 | 北京理工大学 | Method for efficiently synthesizing rare glycyrrhiza triterpenes by saccharomyces cerevisiae through controllable oxidation |
| CN111718948A (en) * | 2020-07-28 | 2020-09-29 | 江南大学 | Gene and application thereof in production of mannich |
| CN112921049A (en) * | 2021-02-06 | 2021-06-08 | 石河子大学 | Gene fragment for producing vanillin, saccharomyces cerevisiae engineering bacteria and construction method thereof |
| CN113930348A (en) * | 2021-09-22 | 2022-01-14 | 河北维达康生物科技有限公司 | Yarrowia lipolytica engineering strain for biosynthesis of glycyrrhetinic acid by taking glucose as substrate, construction and application thereof |
| CN114085784A (en) * | 2021-10-09 | 2022-02-25 | 浙江大学杭州国际科创中心 | Recombinant yeast with high cytochrome P450 expression and application thereof |
| CN114317304A (en) * | 2021-12-21 | 2022-04-12 | 浙江工业大学 | Construction method and application of engineering strain for producing chlorogenic acid by saccharomyces cerevisiae |
| CN116515872A (en) * | 2022-09-30 | 2023-08-01 | 云南农业大学 | Cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene and application thereof in preparation of beta-amyrin |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509726A (en) * | 2013-09-16 | 2014-01-15 | 北京理工大学 | Method for producing beta-amyrin with saccharomyces cerevisiae engineering bacterium |
-
2017
- 2017-03-23 CN CN201710179505.2A patent/CN106987533A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103509726A (en) * | 2013-09-16 | 2014-01-15 | 北京理工大学 | Method for producing beta-amyrin with saccharomyces cerevisiae engineering bacterium |
Non-Patent Citations (2)
| Title |
|---|
| ERY ODETTE FUKUSHIMA 等: "Plant Cytochrome P450s in Triterpenoid Biosynthesis: Diversity and Application to Combinatorial Biosynthesis", 《FIFTY YEARS OF CYTOCHROME P450 RESEARCH》 * |
| 朱明 等: "工程化酿酒酵母合成植物三萜类化合物", 《化工学报》 * |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108373980A (en) * | 2018-04-09 | 2018-08-07 | 石河子大学 | A kind of S. cervisiae, its construction method and its application in fermentation prepares lycopene |
| CN108373980B (en) * | 2018-04-09 | 2019-12-03 | 石河子大学 | A kind of S. cervisiae, its construction method and its application in lycopene is prepared in fermentation |
| CN111235045A (en) * | 2020-01-19 | 2020-06-05 | 天津大学 | Recombinant yarrowia lipolytica for heterologous synthesis of β -balsam stem and oleanolic acid and construction method thereof |
| CN111235047A (en) * | 2020-02-12 | 2020-06-05 | 天津大学 | Recombinant yarrowia lipolytica for heterogeneously synthesizing α -coumarol and ursolic acid and construction method |
| CN111411089A (en) * | 2020-03-02 | 2020-07-14 | 北京理工大学 | Method for efficiently synthesizing rare glycyrrhiza triterpenes by saccharomyces cerevisiae through controllable oxidation |
| CN111718948B (en) * | 2020-07-28 | 2022-02-01 | 江南大学 | Gene and application thereof in production of mannich |
| CN111718948A (en) * | 2020-07-28 | 2020-09-29 | 江南大学 | Gene and application thereof in production of mannich |
| CN112921049A (en) * | 2021-02-06 | 2021-06-08 | 石河子大学 | Gene fragment for producing vanillin, saccharomyces cerevisiae engineering bacteria and construction method thereof |
| CN112921049B (en) * | 2021-02-06 | 2024-01-23 | 石河子大学 | Gene segment for producing vanillin, saccharomyces cerevisiae engineering bacteria and construction method thereof |
| CN113930348A (en) * | 2021-09-22 | 2022-01-14 | 河北维达康生物科技有限公司 | Yarrowia lipolytica engineering strain for biosynthesis of glycyrrhetinic acid by taking glucose as substrate, construction and application thereof |
| CN114085784A (en) * | 2021-10-09 | 2022-02-25 | 浙江大学杭州国际科创中心 | Recombinant yeast with high cytochrome P450 expression and application thereof |
| CN114085784B (en) * | 2021-10-09 | 2023-12-22 | 浙江大学杭州国际科创中心 | Recombinant yeast for high expression of cytochrome P450 and application thereof |
| CN114317304A (en) * | 2021-12-21 | 2022-04-12 | 浙江工业大学 | Construction method and application of engineering strain for producing chlorogenic acid by saccharomyces cerevisiae |
| CN114317304B (en) * | 2021-12-21 | 2024-03-15 | 浙江工业大学 | Construction method and application of saccharomyces cerevisiae chlorogenic acid-producing engineering strain |
| CN116515872A (en) * | 2022-09-30 | 2023-08-01 | 云南农业大学 | Cyclocarya paliurus Liu San terpene synthase CpalOSC2 gene and application thereof in preparation of beta-amyrin |
| CN116515872B (en) * | 2022-09-30 | 2024-07-09 | 云南农业大学 | Cyclocarya paliurus Liu San terpene synthase CpalOSC gene and application thereof in preparation of beta-amyrin |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106987533A (en) | A kind of construction method for the saccharomyces cerevisiae engineered yeast that can synthesize enoxolone | |
| CN107287272A (en) | A kind of preparation method of Tauro ursodesoxy cholic acid | |
| CN112280698B (en) | Saccharomyces cerevisiae engineering bacteria for high-yield yacholanol type sesquiterpene and construction method and application thereof | |
| CN111454854B (en) | Rhodosporidium toruloides gene engineering strain for producing astaxanthin | |
| CN107723252A (en) | Produce the restructuring Yarrowia lipolytica and construction method of valencia orange alkene and nootkatone | |
| CN106566815B (en) | A kind of saccharomyces cerevisiae engineered yeast and construction method producing enoxolone or its precursor | |
| CN106318966B (en) | A method of 3-O- glucosyl group oleanolic acid and cellobiose oleanolic acid are synthesized using saccharomyces cerevisiae | |
| CN113416748A (en) | Expression vector for synthesizing cannabidiol, heterologous expression method and application | |
| CN114107078A (en) | High-yield valencene genetic engineering bacterium and construction method and application thereof | |
| CN114058525A (en) | High-yield squalene genetic engineering bacterium and construction method and application thereof | |
| CN103173368A (en) | Biosynthesis mehtod of dammarenediol and producing strain thereof | |
| CN110117582A (en) | Fusion protein, its encoding gene and the application in biosynthesis | |
| CN111154665B (en) | Recombinant yarrowia lipolytica and construction method and application thereof | |
| CN110305855A (en) | Rhizoma Gastrodiae GeCPR gene and its application | |
| CN107880134B (en) | Method for enzymatic synthesis of kaempferol | |
| CN113817757B (en) | Recombinant yeast engineering strain for producing cherry glycoside and application thereof | |
| CN113969288B (en) | Farnesol-producing genetically engineered bacterium and construction method and application thereof | |
| CN113956990A (en) | Recombinant saccharomyces cerevisiae for producing dihydronilotinib as well as preparation method and application thereof | |
| CN112626132B (en) | Microbial production method of cembrane diterpene | |
| CN115044574A (en) | Valencienene synthase mutant and application thereof in synthesizing Valencienene in yeast | |
| CN112708602B (en) | Dioscorea zingiberensis-derived diosgenin synthesis related protein, coding gene and application | |
| CN114736918A (en) | Recombinant escherichia coli for producing salidroside through integrated expression and application thereof | |
| CN113584110A (en) | Construction and application of engineering strain for biosynthesizing mogroside V by taking mogrol as substrate | |
| US20240301461A1 (en) | Recombinant Escherichia Coli for Expressing Synthesis Pathway of Asiaticoside and Application Thereof | |
| CN115820517B (en) | Improve biosynthesis methyl selenium method for producing cysteine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170728 |