CN112646834A

CN112646834A - Lupeol derivative and synthesis method and application thereof

Info

Publication number: CN112646834A
Application number: CN202110012588.2A
Authority: CN
Inventors: 段礼新; 刘中秋; 熊文波; 李钰; 季爱加; 梁锦才
Original assignee: Guangzhou University Of Chinese Medicine Guangzhou Institute Of Chinese Medicine
Current assignee: Guangzhou University Of Chinese Medicine Guangzhou Institute Of Chinese Medicine; Guangzhou University of Chinese Medicine
Priority date: 2021-01-06
Filing date: 2021-01-06
Publication date: 2021-04-13

Abstract

The invention discloses a lupeol derivative and a synthesis method and application thereof, relating to the technical field of biosynthesis, wherein the synthesis method adopts a new synthesis path, adopts CYP450 enzymes of different plant sources for modifying lupeol, and expresses a gene encoding the lupeol synthase, a gene encoding the CYP450 enzymes and a gene encoding CPR reductase in a microorganism capable of generating 2, 3-oxidosqualene exogenous, so that a plurality of new lupeol derivatives can be obtained, and a foundation is laid for further development of lupeol.

Description

Lupeol derivative and synthesis method and application thereof

Technical Field

The invention relates to the technical field of biosynthesis, in particular to a lupeol derivative and a synthesis method and application thereof.

Background

The triterpenoid is taken as a plant secondary metabolite, has important physiological significance to the plant and draws attention due to wide pharmacological activity. Lupeol (Lupeol) is used as a basic skeleton in a triterpene compound, and the C-28 derivative Betulinic acid (Betulinic acid) of the Lupeol has strong biological activities of resisting tumors, AIDS virus, inflammation, malaria, liver and the like, has low toxicity and has a wide application prospect.

However, due to poor pharmaceutical performance, low bioavailability and difficult structural modification of betulinic acid, further development and utilization of the compound are restricted; the lupeol nucleus is a 6-6-6-6-5 pentacyclic fused structure, and fixed-point oxidation modification on a framework is difficult to realize by a chemical means, so that structural modification of the compound is greatly limited.

Lupeol derivatives are classified into lupeol (Lupane) type triterpenes according to the classification of mother nucleus structure, and in recent years, researchers found various lupeol type triterpenes in plants such as birch bark, liquorice and spina date seeds, and found that a small part of the lupeol type triterpenes (betulinic acid, betulin and betulonic acid) have abundant and important biological activity and pharmacological action after intensively studying the lupeol type triterpenes, such as: anti-tumor, anti-inflammatory, anti-diabetic and liver-protecting. Betulinic acid which is the most studied is lupane-type triterpene mainly derived from the bark of white birch, has various biological activities of resisting tumor, HIV, inflammation, malaria in vitro, protecting liver and the like, and has great application prospect. Betulinic acid has very low content in cortex Betulae Pendulae, and the cost of plant extraction is high.

In addition, the existing research reports on lupane triterpenes mainly focus on very few lupeol derivatives such as betulinic acid and betulin, and have a great space for the research on the biological activity screening and pharmacological action of other compounds; research has shown that the structural modification based on natural lupane pentacyclic triterpene compound is expected to synthesize derivative with stronger activity, so the research on the modification and the structure-activity relationship of lupane pentacyclic triterpene has great potential value.

However, the lupeol parent nucleus can realize fewer oxidation sites and has high chemical synthesis difficulty, and the known oxidation modification P450 enzyme and parent nucleus biological catalytic sites are fewer, so that research such as drug screening, new drug development and the like is limited.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a lupeol derivative and a synthetic method and application thereof.

The invention is realized by the following steps:

in a first aspect, embodiments provide a method of synthesizing a lupeol derivative comprising culturing a cell; the cell is capable of producing 2, 3-oxidosqualene, and the cell contains a first gene encoding a CYP450 enzyme, a second gene encoding lupeol synthase, and a third gene encoding CPR reductase;

wherein the CYP450 enzyme is selected from: at least one of CYP51H10, CYP716A83, CYP88D6, CYP93E3, CYP93E2 and CYP716A83, or at least one of mutants having the same catalytic function as any of the CYP450 enzyme genes.

In a second aspect, embodiments provide a lupeol derivative comprising: at least one of 11 alpha-Hydroxy-lupeol, 16 beta-Hydroxy-lupeol, 24-Hydroxy-lupeol, 11 alpha-Hydroxy-lupeol derivatives, 16 beta-Hydroxy-lupeol derivatives, and 24-Hydroxy-lupeol derivatives;

wherein, the mother nucleus general formula of the 11 alpha-Hydroxy-lupeol derivative is shown as formula 1:

formula 1:

the mother nucleus general formula of the 16 beta-Hydroxy-lupeol derivative is shown as a formula 2:

formula 2:

the mother nucleus general formula of the 24-Hydroxy-lupeol derivative is shown as a formula 3:

formula 3:

in the formulas 1 to 3, R1 and R2 are both selected from any one of hydroxyl and carbonyl, and R1 and R2 are not hydroxyl at the same time, in the formula 1, when R1 and R2 are hydroxyl at the same time, the formula 1 is a structural formula of 11 alpha-Hydroxy-lupeol, in the formula 2, when R1 and R2 are hydroxyl at the same time, the formula 1 is a structural formula of 16 beta-Hydroxy-lupeol, in the formula 3, when R1 and R2 are hydroxyl at the same time, the formula 1 is a structural formula of 24-Hydroxy-lupeol. In a third aspect, embodiments provide the use of a lupeol derivative synthesized according to the method for the synthesis of a lupeol derivative as described in the preceding examples or a lupeol derivative as described in the preceding examples for the preparation of an anti-tumour drug, an anti-inflammatory or an anti-viral drug.

In a fifth aspect, embodiments also provide an anti-tumor drug, an anti-inflammatory drug or an anti-viral drug, which comprises a lupeol derivative synthesized by the method for synthesizing a lupeol derivative as described in the previous embodiments or a lupeol derivative as described in the previous embodiments.

The invention has the following beneficial effects:

the embodiment of the invention provides a lupeol derivative and a synthesis method and application thereof, the synthesis method adopts a new synthesis path, CYP450 enzymes from different plant sources are used for modifying lupeol, and a plurality of new lupeol derivatives can be obtained by expressing a gene coding for the lupeol synthase, a gene coding for the CYP450 enzyme and a gene coding for CPR reductase in a microorganism capable of generating 2, 3-oxidosqualene exogenous, thereby laying a foundation for further development of lupeol.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a schematic diagram of the synthesis of lupeol derivatives in an embodiment;

FIG. 2 is a plasmid map of pESC-tHMGR-Ura-GgLUS1 in example 1;

FIG. 3 is a GC-MS chromatogram of the expression product of WAT11 yeast transformed with pESC-Ura-tHMGR-GgLUS1 in example 1;

FIG. 4 is a comparison of the GgLUS1 gene expression product and lupeol standard quality spectrum in example 1;

FIG. 5 is the physical map of pESC-His-P450 and pESC-Leu-CPR in example 1 and the inserted gene thereof;

FIG. 6 is a GC-MS chromatogram of the expression product of CYP716A83 and AaCPR (opt) cotransformed yeast WAT11 in example 1;

FIG. 7 is a comparison of mass spectra of the products of the expression of CYP716A83 and AaCPR (opt) cotransformed yeast WAT11 in example 1;

FIG. 8 is a GC-MS chromatogram of an expression product of CYP88D6 and AaCPR (opt) cotransformed yeast WAT11 in example 1;

FIG. 9 is a mass spectrum alignment of the expression products of CYP88D6 and AaCPR (opt) cotransformed yeast of example 1;

FIG. 10 is a GC-MS chromatogram of the combination optimization result of the CYP88D6 transformant strain and the plasmid in example 1;

FIG. 11 is a chromatogram obtained by detecting a thin layer chromatography and GC-MS of the CYP88D6 catalytic product after silica gel column chromatography in example 1;

FIG. 12 is a thin layer chromatography and GC-MS detection chromatogram of a purified catalytic product of CYP88D6 in example 1;

FIG. 13 is a NMR chart of CYP88D6 catalyzing a lupeol mother nucleus modified product (11 α -hydroxy-lupeol) in example 1;

FIG. 14 is a NMR carbon spectrum of CYP88D6 catalyzed lupeol parent nucleus modification product of example 1;

FIG. 15 is a NOESY detection spectrum of CYP88D6 catalyzing a lupeol mother nucleus modified product in example 1;

FIG. 16 is a mass spectrum of CYP88D6 catalyzed lupeol mother nucleus modification product in example 1;

FIG. 17 is the biological modification of Lupeol by CYP716A83 in example 2;

FIG. 18 is the biological modification of Lupeol by CYP93E3 in example 3;

FIG. 19 is the biological modification of Lupeol by CYP51H10 in example 4.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

First, embodiments provide a method of synthesizing a lupeol derivative, comprising culturing cells; the cell is capable of producing 2, 3-oxidosqualene, and the cell contains a first gene encoding a CYP450 enzyme, a second gene encoding lupeol synthase, and a third gene encoding CPR reductase;

The invention identifies 6 CYP450 enzymes which are not from plant sources and can be used for catalyzing different sites of lupeol. CYP450 enzymes, also known as cytochrome P450, cytochromeP450, represent a family of auto-oxidizable heme proteins, belong to the class of monooxygenases, and are named because they have specific absorption peaks at 450 nm.

The synthesis method takes the endogenous substrate 2, 3-oxidosqualene of cells as a starting point, and generates the lupeol by cyclization under the catalytic action of a lupeol synthase gene. In some embodiments, the specific operations may be: cloning a second gene for encoding Lupeol synthetase, constructing a yeast expression vector of the second gene in a homologous connection mode, and performing functional characterization in yeast to obtain a first-step tool enzyme for producing a substrate Lupeol.

Then, the first gene and the third gene are introduced into the cell, so that the produced lupeol reacts by electron transfer by different CYP450 enzymes and CPR reductase. Different CYP450 enzymes respectively hydroxylate different sites of the biologically modified lupeol, and the 6 different CYP450 enzymes can obtain the lupeol derivatives oxidized and modified at different positions. The method can prepare new lupeol derivatives to further promote development of new lupeol drug molecules and new lupeol-related drugs.

In some embodiments, the synthesis methods may employ any 2,3, 4, or 5 of the 6 CYP450 enzymes described above, or a combination of 6 CYP450 enzymes, for the synthesis of the derivatives.

In some embodiments, the third gene encoding CPR reductase is selected from at least one of the following genes: AaCPR (anemarrhena CPR gene), GgCPR1 (glycyrrhiza CPR gene), and AtCPR (arabidopsis CPR gene).

Preferably, the third gene is a codon optimized gene, and the sequence of AaCPR is shown in SEQ ID No. 1; the sequence of GgCPR is shown in SEQ ID No. 2.

Specifically, the base sequence of AaCPR is:

atgcaatcggagacgatgaagctctcacctttggatctgatgatggcgatcttgaccgggaagctcggggacagcggcctacccccagaggtggcctcgatcaccgagaaccgcgagctccttatgattctgacgacgtcgatcgccgtcctgattggatgcgctgttgttttcttgtggcggcggtcgagcgggaagtccagcaagtctgtggaacctccgagacctctcgtgattcccaaggagccggagcctgaggtcgacgatgggaagaagaaagtcaccatcttttttggtacccagaccgggacggctgaaggttttgctaagtcgctggcggaagaggccaaggctagatatgacaaggcgaccttcaaagtcgtcgatctggatgattacgcggcggacgatgatgagtacgaggagaagatgaagaaagaaaccctagccctgttcttcttggcaacatatggagacggggaaccaactgataacgctgccagattctataaatggtttactgaggggaaagagagggaacaatggctggagaatcttcaatatgctgtgttcggtttgggcaataggcagtacgagcatttcaataaggtggcaaaggtggtggatgaggtccttgctgaacagggagcaaagcgccttgtcccagtgggtcttggggatgatgatcagtgcattgaggatgatttcgccgcatggagagagctattatggccagaattagatcaattgctacgagatgaagatgatgcatcgggtgcatccaccacatatacagctgctgttcctgaataccgagttgtattgattgactctgcaggcgcatctcatttggagaagaattggagtcttgcaaatggtcatgctgttcatgatattcaccatccatgcagagctaatgtggctgtgcggagggagcttcatactccagcttctgaccgttcctgcattcatctggagtttgatatttcggggacaggtcttgcatatgaaacaggggatcatgttggtgtatattcagagaattgtcttgagactgtagaggaggcagagaagttattaggtcttccatcagacacatttttctccattcatgctgacaatgaagatggaactccacttggcagctctttgccacctccattcccatctccatgcactttaagaacagcactcacacgctatgctgatcttctgaattctcctaaaaaggctgctttggttgctttagctactcatgcttctgatcccaatgaagcagaaagattgagatttttggcttctcctgcaggaaaggatgagtactctcaatgggtagttgctagtcagaggagccttctggaggttatggctgagtttccttcagccaagcctccactaggagttttctttgcagcaatagccccccgcttgcagcctagatattattcaatatcatcttcaccaaggatggcaccaactagaattcatgtcacatgcgctctagtttatggaccaacacctacaggaaggattcacaaaggagtctgctcaacctggatgaagcatgcagttccttcagaggagagcaaagagtgcagctgggcccctatatttgtgagacagtcaaacttcaaactcccttcacatccctccacaccaattattatgattggcccaggcacagggttggcacccttcaggggcttcctgcaggaaagattggcactaaagcaagctggcacagaacttggccctgccattctcttctttggttgccggaaccgaagaatggatttcatatacgaggatgagctgaaaaattttgttgaggaaggtgcactttctgagctgattgtagccttttctcgtgagggtcagaccaaggaatatgtgcagcataagatggctgagaaggctgttgagctctggaatatcatctctaagggtggatatctttatgtatgtggtgacgcgaaaggtatggctagagatgtccatagagtgctccacactatagttcaagagcagggatcattggatagctcaaaggctgagagcatggtaaagagtctacagatggaagggagatatctgcgtgatgtgtggtaa；

the base sequence of GgCPR is:

ATGACTTCGAATTCCGATTTGGTTCGCACCATTGAGTCGGTGCTGGGCGTTTCACTCGGCGATTCGGTCTCCGATTCGCTCGTTCTGATAGCGACTACCTCCGTCGCCGTCATAATTGGGCTCCTTGTGTTCCTGTGGAAGAAATCTTCGGATCGGAGCAGGGAGGTGAGGCCGGTGATTGTGCCGAAGTCGTTGGTGAAGGATGAAGACGATGATGTCGACGTTGCCTCCGGGAAGACTAAGGTTACTGTTTTCTTCGGTACTCAGACTGGTACTGCTGAGGGCTTCGCTAAGGCATTGGCGGACGAGATCAAGGCAAGATATGAAAAAGCATATGTCAAAGTTGTTGATTTGGATGACTATGCAATGGATGATGATCAATATGAGGAGAAGCTGAAGAAAGAAACTCTTGCATTTTTCATGCTGGCAACTTATGGAGATGGAGAGCCAACTGACAATGCTGCAAGATTCTACAAATGGTTTACTGAGGGTAAAGAGGAGAGGGGCACCTGGCTTCAACAGCTCACACATGGAGTTTTTGGCCTAGGTAACAAGCAATATGAACATTTTAATAAGATAGGTAAAGTTGTTGATGAAGACCTTAGTGAACAAGGTGCAAAGCGTCTTGTTCCACTTGGACTAGGTGATGATGATCAATCCATTGAGGATGATTTTTCTGCCTGGAAAGAATCTCTGTGGCCTGAGTTGGATCAGTTGCTCCGAGATGAGGATGATGTGAATACTGTTTCTACTCCCTATACTGCTGCTATTCCTGAATATCGAGTAGTGATTCATGACTCCACTGTCACACCATCCTATGATAATCAATTCAGCGCAGCAAATGGGGGTGCTGTATTTGATATTCATCATCCTTGCAGGGTAAATGTTGCTGTTAAAAGGGAGCTTCACAAACCTCAGTCTGACCGTTCCTGCATACATTTGGAGTTTGATATATCGGGGACTGGCATAACATATGAAACTGGAGACCATGTGGGTGTTTATGCTGAGAACTGTGATGAAACTGTTGAAGAAGCTGGGAAGTTGTTGGGTCAAAATTTAGATTTGCTGTTTTCTCTTCACACTGATAACGAGGATGGCACTTCCCTTGGAGGCTCTCTGCTACCTCCTTTCCCTGGTCCTTGCACACTGCGTACGGCGTTAGCACGTTATGCAGATCTCTTGAACCCTCCACGAAAGGCTGCTTTAGTTGTATTAGCTGCTCATGCTTCTGAACCTAGTGAGGCAGAAAGATTGAAGTTCCTCTCCTCTCCTCAGGGGAAGGATGAGTACTCCAAATGGGTGGTTGGAAGCCAGAGAAGTCTCCTTGAGGTGATGGCTGAGTTTCCATCAGCAAAACCTCCACTTGGTGTGTTTTTCGCTGCCATAGCCCCTCGTTTACAGCCTCGTTATTATTCTATTTCATCCTCTCCTAGGTTTGCCTCACAAAGGGTACATGTAACTTGTGCCCTGGTGTATGGTCCAACTCCCACTGGCAGAATTCACAAAGGAGTATGCTCAACCTGGATGAAGAATGCTATTCCCTTAGAGGAAAGCCGTGACTGTGGCTGGGCTCCCATTTTTATCAGGCCATCAAATTTCAAGCTACCAGCCGATCATTCGATTCCTATTATTATGGTTGGACCTGGTACTGGTTTGGCACCTTTTAGGGGATTTTTACAGGAAAGATTTGCCCTCAAAGAGGATGGTGTTCAACTTGGTCCTTCATTACTCTTCTTTGGATGCAGGAACCGTCAAATGGATTTTATTTATGAGGATGAGCTAAAGAATTTTGTGGAACAAGGTTCTCTGTCAGAGTTGATAGTTGCATTCTCTAGAGAGGGGCCTGAAAAGGAGTATGTTCAACACAAGATGATGGATAAAGCAGCATACCTGTGGAGTCTGATTTCTCAGGGAGGTTATCTTTATGTCTGTGGTGATGCCAAGGGTATGGCCAGAGATGTTCATCGAATTCTTCATACCATTGTCCAGCAGCAGGAAAATGTGGAGTCGTCAAAGGCGGAGGCTATAGTGAAAAAACTCCAGATGGATGGACGTTACCTCAGGGATGTCTGGTGA。

in some embodiments, the second gene encoding lupeol synthase is selected from the group consisting of: GgLUS1 (Glycyrrhiza lupeol synthase gene), AtLUP1 (Arabidopsis thaliana lupeol synthase gene), and KdLUS (Fameella macrophylla synthase gene). Preferably, the second gene is GgLUS 1.

In some embodiments, the method comprises introducing the first gene, the second gene, and the third gene into the cell by transfection of a plasmid or integration into the genome of the cell. The method of transfection or integration of the plasmid into the genome of the cell can be performed by the conventional techniques, and is not limited thereto, and any method that can achieve the introduction of the first to third genes into the yeast cell is included in the scope of the present application.

Preferably, the means of introduction into the cell is transfection of a plasmid or integration into the genome of the cell.

Preferably, the cell is selected from: yeast cells and tobacco.

Preferably, the yeast is selected from any one of Saccharomyces cerevisiae, Kluyveromyces lactis, Pichia pastoris, Schizosaccharomyces africana, and Hansenula polymorpha.

Preferably, when the method of introducing into the cell is plasmid transfection, the method comprises transfecting by ligating the first gene and the third gene into the same vector. The inventor researches and discovers that the catalytic efficiency of a CPR enzyme gene-CYP 450 enzyme gene system is influenced when a third gene for coding CPR enzyme and a first gene for coding CYP450 enzyme are connected. When the first gene and the third gene are located in the same vector for transfection, the catalytic efficiency is higher.

Specifically, linking the first gene and the third gene to the same vector means: on the basis of the constructed vector containing the first gene (the gene is inserted into the multi-cloning site MCS1 of the vector) for encoding the CYP450 enzyme, the third gene for encoding the CPR enzyme is inserted into the multi-cloning site MCS2 of the vector, and the vector with the first gene and the third gene is constructed. In other embodiments, the order of insertion of the first gene and the third gene on the vector may be swapped.

Preferably, when the enzyme encoded by the first gene is CYP88D6, the third gene encoding CPR enzyme is GgCPR 1. When the catalyst is assembled in such a way, the catalytic efficiency is high.

In some embodiments, the method comprises fermenting the cell into which the first, second, and third genes are introduced, or culturing a plant transfected with the first, second, and third genes, after the introduction.

Preferably, the method comprises the steps of transfecting saccharomyces cerevisiae by adopting galactose-induced expression plasmids, and fermenting by means of carbon source limitation and segmented feeding;

preferably, the conditions of the fermentation are: culturing yeast cells in a liquid culture medium with 1% -3% of glucose as a unique carbon source, and fermenting by using galactose as the unique carbon source in a segmented feeding manner after carbon consumption in the culture medium is finished for 44-52 hours.

In some embodiments, the lupeol derivative comprises: at least one of 11 α -Hydroxy-lupeol, 16 β -Hydroxy-lupeol, 24-Hydroxy-lupeol, Betulin and Betulinic acid.

Specifically, with reference to FIG. 1, when the first gene encodes CYP51H10, lupeol can be catalytically synthesized into 16 β -Hydroxy-lupeol; when the first gene encodes CYP93E3 and/or CYP93E2, 24-Hydroxy-lupeol can be catalytically synthesized; when the first gene encodes CYP88D6, it catalyzes the synthesis of 11 alpha-Hydroxy-lupeol. When the first gene encodes CYP716A83, 2 steps of continuous catalytic reaction occur, firstly lupeol is catalyzed into beta ulin, and then Betulinic acid is further catalyzed.

Embodiments of the present invention also provide a lupeol derivative, which includes: at least one of 11 alpha-Hydroxy-lupeol, 16 beta-Hydroxy-lupeol, 24-Hydroxy-lupeol, 11 alpha-Hydroxy-lupeol derivatives, 16 beta-Hydroxy-lupeol derivatives, and 24-Hydroxy-lupeol derivatives;

preferably, the 11 α -Hydroxy-lupeol derivative has a parent nucleus of formula 1:

formula 1:

formula 2:

formula 3:

in the formulas 1 to 3, R1 and R2 are both selected from any one of hydroxyl and carbonyl, and R1 and R2 are not hydroxyl at the same time, in the formula 1, when R1 and R2 are hydroxyl at the same time, the formula 1 is a structural formula of 11 alpha-Hydroxy-lupeol, in the formula 2, when R1 and R2 are hydroxyl at the same time, the formula 1 is a structural formula of 16 beta-Hydroxy-lupeol, in the formula 3, when R1 and R2 are hydroxyl at the same time, the formula 1 is a structural formula of 24-Hydroxy-lupeol.

The embodiment of the invention also provides the application of the lupeol derivative synthesized by the method for synthesizing the lupeol derivative according to any one of the embodiments or the lupeol derivative according to any one of the embodiments in the preparation of antitumor drugs, anti-inflammatory drugs or antiviral drugs.

In addition, the embodiment of the present invention also provides an anti-tumor, anti-inflammatory or anti-viral drug, which comprises the lupeol derivative synthesized by the method for synthesizing a lupeol derivative according to any one of the preceding embodiments or the lupeol derivative according to any one of the preceding embodiments.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example provides a method for synthesizing lupeol, as follows.

In this example, the second gene encoding lupeol synthase is the GgLUS1 gene, and the first gene encoding CYP450 enzyme is selected from the group consisting of: CYP51H10, CYP716a83 and CYP88D 6; the third gene encoding CPR reductase is selected from: GgCPR1 and AaCPR.

(1) Obtaining of genes

The nucleotide sequence required for constructing the recombinant organism was searched for at the NCBI, the CDS sequence of the target sequence was searched for, and the primers shown in Table 1 were designed. The primer comprises a sequence of the candidate gene, a homologous arm sequence on a yeast expression vector pESC-tHMGR-Ura or pESC-His or pESC-Leu, a lower case letter identification vector homologous sequence, and an upper case letter identification gene sequence.

TABLE 1 primer sequences

In Table 1, F is the forward primer and R is the reverse primer. Two insertion sites (GAL1 and GAL10) are present in the pESC-Leu vector to which the GgCPR1 gene is ligated, primer set 4 is a primer sequence for inserting the GAL1 site in the gene, and primer set 7 is a primer sequence for inserting the GAL10 site in the gene.

And (3) performing RT-PCR amplification on the total RNA of the plant tissue part expressed by the target gene as a template by using the primer pairs 1-6, as follows.

1. Extraction of Total RNA

Total RNA of plant tissue parts expressed by a target gene in the mature stage is extracted by a Trizol method (all reagents are purchased from Takara, Inc., the product number is 9752Q), and the specific method comprises the following steps: collecting 100mg of cleaned plant tissue part material expressed by the target gene, immediately placing the material in liquid nitrogen for grinding, adding 1mL of Trizol reagent, fully and uniformly mixing, and placing the mixture for 5 minutes at room temperature; adding 0.2mL of chloroform, shaking vigorously for 15 seconds, and incubating at room temperature for 3 minutes; centrifuging at 12000g for 15min at 4 ℃; transferring the supernatant into a new 1.5mL centrifuge tube, and adding 0.5mL isopropanol to precipitate RNA; finally, the RNA precipitate is washed by 1mL of 75% ethanol and then dissolved in proper amount of double distilled water treated by DEPC, and the RNA precipitate is stored at the temperature of-70 ℃ for later use.

2. Synthesis of cDNA

PrimeScript from Takara was used^TM1st Strand cDNA Synthesis Kit (cat # 6210A) and operating according to the Kit instructions: 1-5. mu.g of total RNA of the plant tissue site expressed by the target gene extracted in step 1 was put into an inactivated RNase-free PCR tube, 1. mu.L of Oligo (dT)12-18(500mg/mL) and 1. mu.L of a dNTP mixture (each 10mM) were added, and 12. mu.L of double distilled water treated with DEPC was replenished, mixed well, heated at 65 ℃ for 5 minutes, and then quickly placed on ice for 1 minute. After brief centrifugation, 4. mu.L of 5 Xfirst strand synthesis buffer, 2. mu.L of 0.1M DTT and 1. mu.L of RNaseO M T (40. mu.L/. mu.L) were added thereto, and after gentle mixing, incubation was carried out at 42 ℃ for 2 minutes, followed by addition of 1. mu.L of Superscript II reverse transcriptase (200. mu.L/. mu.L), mixing, incubation at 42 ℃ for 50 minutes, and heating at 70 ℃ for 15 minutes to inactivate the enzyme, thereby obtaining first strand cDNA.

3. Cloning of genes

The kit was used in the Phanta Max Super-Fidelity DNA Polymerase kit from Vazyme, according to the kit instructions: taking 1 μ L of the reverse transcription product obtained in the step 2, and carrying out PCR under the guide of the upstream primer and the downstream primer. The PCR reaction system is as follows: 25 μ L of 2 XPPhanta Max Buffer, 1 μ L of dNTP Mix (10mM), 2 μ L of forward primer (10 μ M), 2 μ L of reverse primer (10 μ M), 1 μ L of template DNA, 1 μ L of Phanta Max Super-Fidelity DNA Polymerase, plus 18 μ L of ddH₂Supplementing the system to a 50 mu L system by O, and slightly flicking and uniformly mixing; the PCR reaction conditions are as follows: firstly, 3 minutes at 95 ℃; then 95 ℃ for 15 seconds, 58 ℃ for 15 seconds, 72 ℃ for 1-2kb/min, for 33 cycles; finally 5 minutes at 72 ℃. After the reaction was completed, the reaction was checked with 1% agarose gel. The results show that the sizes of the obtained bands are basically consistent with the length of the sequence queried on NCBI and are consistent with the expected results.

The fragment was recovered using an agarose gel recovery kit, and then homologous ligation was performed between the recovered fragment and pESC-tHMGR-Ura (BamH I, Sma I) or pESC-His (BamH I, Sma I) or pESC-Leu (BamH I, Xho I) double-cleavage products. The Kit is operated according to the Kit instruction by using the Cloneexpress II One Step Cloning Kit, and the connecting system is as follows: mu.L of pESC-tHMGR-Ura or pESC-His or pESC-Leu double digestion product, 3. mu.L of glue recovery product, 2. mu.L of 5 XCE II Buffer, 1. mu.L of Exnase II, and 3. mu. L d of additivedH₂Supplementing the system to a 10 mu L system by O, and slightly flicking and uniformly mixing; the reaction conditions are as follows: 30 minutes at 37 ℃. According to the conventional transformation method, the homologous ligation products were transformed into E.coli DH 5. alpha. competent cells, and positive clones were selected based on the ampicillin resistance marker on pESC-tHMGR-Ura or pESC-His or pESC-Leu vectors, to obtain recombinant plasmids containing the recovered fragments. The nucleotide sequence of GAL10-F/R or GAL1-F/R sequence in the plasmid vector is used as primer for determining the nucleotide sequence. Sequencing results showed that the protein sequence was consistent with that published at NCBI.

(2) Acquisition and expression of GgLUS1 yeast cell line

1. Construction of Yeast expression vector pESC-tHMGR-Ura-GgLUS1

pESC-tHMGR-Ura was double-digested with restriction enzymes BamH I and Sma I. The enzyme cutting system is as follows: 2 μ L Smartcut Buffer, 1 μ L LBamH I, 1 μ L Sma I, 500ng pESC-tHMGR-Ura, plus ddH₂Supplementing the system to 20 mu L and mixing the system with light bullet; the reaction conditions are as follows: carrying out enzyme digestion reaction at 37 ℃ for 30-60 min. And inactivating at 80 ℃ for 5 minutes to obtain the linear empty vector.

The correct size PCR fragment was recovered using an agarose gel recovery kit and dissolved in 35. mu.L ddH₂And (4) in O. The connecting system is as follows: mu.L of pESC-tHMGR-Ura double enzyme digestion product, 3 mu.L of glue recovery product, 2 mu.L of 5 XCE II Buffer, 1 mu.L of Exnase II, and 3 mu.L of ddH2O are added to supplement the system to a 10 mu.L system, and the mixture is flickingly and uniformly mixed; the reaction conditions are as follows: 30 minutes at 37 ℃. The homologous ligation products were transformed into E.coli DH 5. alpha. competent cells according to the conventional transformation method, and screened using plates containing ampicillin (concentration 100. mu.g/mL).

PCR identification of positive clones was performed using primer pair GAL1, GAL 1: GAL1-F: 5'-ATTTTCGGTTTGTATTACTTCTTATTC-3'; GAL1-R: 5'-ATAGGGACCTAGACTTCAGGTTGTC-3'.

As a result, the GgLUS1 gene was inserted into pESC-tHMGR-Ura in the correct orientation, and the resulting recombinant plasmid was designated as pESC-tHMGR-Ura-GgLUS1, and its physical map is shown in FIG. 2.

2. Obtaining of Yeast expression cell lines

The obtained plasmid pESC-tHMGR-Ura-GgLUS1 was transformed into yeast WAT11 competent cells according to a conventional transformation method, and screened using an SD-Ura amino acid-deficient plate.

Positive clones were identified by PCR using gene-specific primer set 1 (Table 1). The method comprises the following specific steps: the positive clones were picked up in a liquid medium containing 1mLSD-Ura amino acid-deficient cells and shaken for 24 h. PCR System (10. mu.L): 3.2. mu.L of ddH2O, 0.4. mu.L of 5 '-end primer (10. mu.M), 0.4. mu.L of 3' -end primer (10. mu.M), 1. mu.L of bacterial suspension, and 5. mu.L of 2 × Rapid Taq Master Mix. The reaction conditions are that the temperature is firstly 95 ℃ for 3 minutes; then, the temperature is 95 ℃ for 15 seconds, the temperature is 57 ℃ for 15 seconds, the temperature is 72 ℃ for 1 minute and 20 seconds, and the total number is 33 cycles; finally 5 minutes at 72 ℃. The result of 1% agarose gel electrophoresis shows that pESC-tHMGR-Ura-GgLUS1 is successfully transferred into expression vector yeast (WAT11), and the obtained pESC-tHMGR-Ura-GgLUS yeast expression cell line.

3. Expression of the pESC-tHMGR-Ura-GgLUS1 Yeast cell line

The obtained positive monoclonal bacteria (dense, streaked) are reactivated to SD-Ura amino acid defective plates. Activated colonies were picked into 50mL SG-induced Ura amino acid-deficient medium dispensed from tissue culture flasks, and cultured on a shaker at 30 ℃ and 200rpm for 6 days. The cells were collected by centrifugation at 4000rpm for 10min and the supernatant was discarded. 5-10 ml of alkali lysis solution (20% potassium hydroxide and 50% ethanol) is added into the thalli, and vortex oscillation is carried out for 1min, so that the thalli is completely resuspended and is convenient for complete lysis. Boiling the suspended thallus in boiling water for 10min, standing, and cooling to room temperature. Adding n-hexane with the same volume, oscillating for 2min, and sucking the organic layer (upper layer) into a new penicillin bottle. Adding n-hexane with the same volume to the water layer (lower layer), oscillating for 2min, sucking the organic layer (upper layer) to the penicillin bottle in the last step, and mixing the two extractive solutions. Placing a penicillin bottle in a fume hood overnight, volatilizing to dry, adding 1ml ethyl acetate for elution, transferring to a 1.5ml clean centrifuge tube, volatilizing, adding 500 μ L dichloromethane for elution, centrifuging at 14000rpm for 2min, transferring all the liquid except the precipitate into an inner intubation, and placing in a centrifugal concentrator for completely volatilizing (the liquid can be volatilized for multiple times due to excessive liquid). After the evaporation, the sample was transferred to a sample bottle (before transfer, the sample was numbered). Add 50. mu.L of derivatization reagent and 50. mu.L of anhydrous pyridine to the inner cannula, screw down the vial cap and vortex, incubate it at 85 ℃ for 1h in a 700rpm constant bath, and analyze the derivatized sample with GC-MS platform after derivatization, the results are shown in FIGS. 3 and 4.

(3) Acquisition and expression of CYP450 yeast cell lines

1. Construction of Yeast expression vector pESC-His-P450 and pESC-Leu-AaCPR

pESC-His and pESC-Leu were double-digested with restriction enzymes BamH I and Sma I and BamH I and Xho I), respectively. And (3) recording the enzyme digestion system and the reaction step (2), and inactivating at 80 ℃ for 5 minutes to obtain the linearized empty vector.

The correct size PCR fragment was recovered using an agarose gel recovery kit and dissolved in 35. mu.L ddH₂And (4) in O. The gel recovery product was homologously ligated to the linearized empty vector, and the homologously ligated product was transformed into E.coli DH 5. alpha. competent cells according to a conventional transformation method, and screened using a plate containing ampicillin (concentration 100. mu.g/mL). Positive clones were identified by PCR using primer pair GAL1 (supra).

The results showed that the CYP88D6 and CYP716A83 genes inserted pESC-His, the AaCPR (opt) gene inserted pESC-Leu and the orientation was correct, the obtained recombinant plasmids were named pESC-His-CYP88D6/CYP716A83 and pESC-Leu-AaCPR (opt), and the physical maps thereof are shown in FIG. 5.

2. Obtaining of Yeast expression cell lines

The obtained plasmids pESC-His-CYP88D6/CYP716A83 and pESC-Leu-AaCPR (opt) were co-transformed into yeast WAT11 competent cells, respectively, according to a conventional transformation method, and then screened using an SD-Ura-His-Leu amino acid deficient plate. Positive clones were identified by PCR using gene-specific primer pairs (see Table 1, primer pairs 2,3 and 5). The result of 1% agarose gel electrophoresis shows that pESC-His-CYP88D6/CYP716A83 and pESC-Leu-AaCPR (opt) are successfully transferred into an expression vector yeast (WAT11) to obtain a pESC-His-CYP88D6/CYP716A83 yeast expression cell line.

3. Expression of pESC-His-CYP88D6/CYP716A83 Yeast cell line

Specifically, the expression procedure was performed in accordance with the expression procedure of pESC-tHMGR-Ura-GgLUS1 yeast cell line, and the GC-MS results of the derivatized samples are shown in FIGS. 6 to 9.

(4) Screening and expression of CYP88D6 high-yield product yeast cell line

1. And (3) constructing yeast expression vectors pESC-Leu-GgCPR1 and pESC-Leu-GgCPR1-CYP88D 6.

Separately using restriction enzyme BamH I&Sam I and Not I&Bgl II double-digested pESC-Leu-GgCPR1 and pESC-Leu. After enzyme digestion, the linear empty vector is obtained after inactivation at 80 ℃ for 5 minutes. The correct size PCR fragment was recovered using an agarose gel recovery kit and dissolved in 35. mu.L ddH₂And (4) in O. Carrying out homologous connection on 1 mu L of pESC-Leu-GgCPR1 or pESC-Leu double enzyme digestion product and a gel recovery product; the homologous ligation products were transformed into E.coli DH 5. alpha. competent cells according to the conventional transformation method, screened using plates containing 100. mu.g/mL ampicillin, and the positive clones were identified by PCR using primer set GAL1 (supra).

The results showed that pESC-Leu was inserted into the GgCPR1 gene and pESC-Leu-GgCPR1 was inserted into the CYP88D6 gene in the correct orientation, and the resulting recombinant plasmids were designated pESC-Leu-GgCPR1 and pESC-Leu-GgCPR1-CYP88D6, respectively.

2. Obtaining of Yeast expression cell lines

Plasmids pESC-Leu-GgCPR1, pESC-His-CYP88D6 and pESC-tHMGR-Ura-GgLUS1 were co-transformed into yeast WAT11 competent cells according to a conventional transformation method, and at the same time, pESC-Leu-GgCPR1-CYP88D6 and pESC-tHMGR-Ura-GgLUS1 were co-transformed into yeast SE-Met competent cells, and screening was performed using SD-Ura-His-Leu and SD-Ura-His-Leu-Trp amino acid-deficient plates, respectively.

Positive clones were identified by PCR using gene-specific primer pairs 6 and 7 (see Table 1). The results of 1% agarose gel electrophoresis show that pESC-Leu-GgCPR, pESC-His-CYP88D6, pESC-tHMGR-Ura-GgLUS1 are successfully transferred into expression vector yeast (WAT11), pESC-Leu-GgCPR1-CYP88D6 and pESC-tHMGR-Ura-GgLUS1 are successfully transferred into expression vector yeast (SE-Met), and different CYP88D6 yeast expression cell lines are obtained.

3. Expression of Yeast cells

Selecting positive monoclonal bacteria (dense, and marking bacteria) to be reactivated to SD-Ura-His-Leu or SD-Ura-His-Leu-Trp amino acid defective plates. The activated bacterial colony is picked into 50mL SG-induced Ura \ His \ Leu or Ura \ His \ Leu \ Trp amino acid defective culture medium subpackaged in tissue culture bottles. The culture was carried out at 30 ℃ for 6 days on a shaker at 200 rpm. The cells were collected by centrifugation at 4000rpm for 10min and the supernatant was discarded. 5-10 ml of alkali lysis solution (20% potassium hydroxide and 50% ethanol) is added into the thalli, and vortex oscillation is carried out for 1min, so that the thalli is completely resuspended and is convenient for complete lysis. Boiling the suspended thallus in boiling water for 10min, standing, and cooling to room temperature. Adding n-hexane with the same volume, oscillating for 2min, and sucking the organic layer (upper layer) into a new penicillin bottle. Adding n-hexane with the same volume to the water layer (lower layer), oscillating for 2min, sucking the organic layer (upper layer) to the penicillin bottle in the last step, combining the two extracts, placing the penicillin bottle in a fume hood, standing overnight, volatilizing, adding 1ml ethyl acetate for elution, transferring to a 1.5ml clean centrifuge tube, volatilizing, adding 500 μ L dichloromethane for elution, centrifuging at 14000rpm for 2min, transferring all the liquid except the precipitate to an inner insert tube, and placing in a centrifugal concentrator for completely volatilizing. After the sample is volatilized, the inner cannula is transferred to a sample injection bottle. Add 50. mu.L of derivatization reagent and 50. mu.L of anhydrous pyridine to the inner cannula, screw down the vial cap and vortex, incubate it at 85 ℃ for 1h in a 700rpm constant bath, and analyze the derivatized sample with GC-MS platform after derivatization, the results are shown in FIG. 10.

(5) Purification and identification of CYP88D6 metabolite

1. Mass fermentation of CYP88D6 metabolite

On a temporary storage yeast plate into which expression vector yeast (SE-Met) was successfully transferred from the obtained pESC-Leu-GgCPR1-CYP88D6 and pESC-tHMGR-Ura-GgLUS1 in a clean bench, yeast cells were picked up, added to 50mL SC-Ura/HIS/LEU/TRP liquid medium (2% glucose as a sole carbon source), and cultured overnight in a 30 ℃ 200rpm constant temperature shaker.

10mL of overnight-cultured bacterial liquid was transferred to a conical flask (5 flasks in total) containing 100mL of liquid medium, cultured at 30 ℃ and 200rpm for about 2 days until the OD600 value reached 5-10, and inoculated as a seed bacterium in a fermenter for 7L mass fermentation. After carbon consumption in the initial medium (about 48h), galactose is used as a sole carbon source, and a fermentation strategy of carbon limitation and segmented feeding is adopted until 168h, and the tank is stopped for bacteria harvesting.

2. CYP88D6 metabolite extraction and separation

And (4) completely centrifuging the yeasts collected in the fermentation tank by using a high-capacity centrifuge at 4000rpm for 20min, and respectively storing the thalli and culture medium supernatant. Adding 1L of 20% KOH ethanol solution into the thalli, and suspending the thalli; boiling in boiling water for 10-15min while stirring. After alkaline cracking, adding equal volume of ethyl acetate for extraction, placing the upper organic phase in a heart-shaped bottle, spin-drying on a rotary evaporator, recovering ethyl acetate, and repeatedly extracting for 6 times. The sample in the heart-shaped flask was redissolved with 10-20mL ethyl acetate, placed in a fume hood to evaporate and then stored at-20 ℃ until column purification.

3. CYP88D6 metabolite purification and identification

CYP88D6 metabolite is subjected to alkaline lysis, extraction and separation, and then purified by silica gel column chromatography. A 82-vial portion was co-inoculated using n-hexane: ethyl acetate (3:1) was used as a developing solvent, and the thin layer plate was spotted for detection, and the detection results are shown in fig. 10. According to the results of the point plates, the fractions 26, 27, 28, 35, 47, 48 and 49 are selected for GC-MS detection, the detection results are shown in FIG. 11, and finally the target compound is determined to be present in the fractions 28 to 49. According to the detection results of thin layer chromatography and GC-MS, the fraction 33 is further subjected to semi-preparative purification by liquid chromatography, and finally 95% methanol and water are determined to be used as a mobile phase solvent after exploration of mobile phase conditions. The monomer compound purified in the semi-preparative liquid phase is taken and then is spin-dried, and the final product is respectively spotted on a plate and detected by GC-MS, and the result is shown in figure 12, and the purity of the product meets the requirement of the subsequent structural identification.

The purified compound monomer is subjected to H¹NMR and C¹³NMR detection (FIGS. 13 and 14), introducing the measured carbon spectrum data into a microspectrum database query, comparing the query with the original file data, and determining that the measured carbon spectrum data are consistent with the original file data, and further performing NOESY and high-resolution mass spectrum detection (FIGS. 15 and 16) on the compound to determine that the structure of the compound is (3 beta, 11 alpha) -Lup-20(29) -ene-3,11-diol, namely 11 alpha-hydroxy-lupeol.

Example 2

This example provides a method for synthesizing Lupeol derivatives, the general procedure of which is as described in example 1, except that Lupeol is catalyzed by CYP enzyme gene CYP716a 83. With specific reference to fig. 17, in the present study, three plasmids respectively containing GgLUS1, CYP716a83 and GgCPR1 were co-transformed into a saccharomyces cerevisiae microbial host, yeast products after induced expression were separated and detected, continuous catalytic oxidation of Lupeol C-28 by CYP716a83 enzyme was determined by comparison of standards of blank controls, and two products of the combination were identified as betulin and betulinic acid.

Example 3

This example provides a method for the synthesis of Lupeol derivatives, the general procedure of which is as in example 1, except that Lupeol is catalysed by CYP93E 3. Specifically referring to fig. 18, in the present study, three plasmids respectively containing GgLUS1, CYP93E3 and GgCPR1 are co-transformed into a saccharomyces cerevisiae microbial host, yeast products after induced expression are separated and detected, CYP93E3 is found to perform oxidative modification on Lupeol by comparison with standards of a blank control, and the combined product is presumed to be 24-Hydroxy-Lupeol according to the known functions of CYP93E 3.

Example 4

This example provides a method for the synthesis of Lupeol derivatives, the general procedure of which is as in example 1, except that Lupeol is catalysed by CYP51H 10. Specifically referring to fig. 19, in the present study, 3 plasmids respectively containing GgLUS1, CYP51H10 and GgCPR1 were co-transformed into a saccharomyces cerevisiae microbial host, yeast products after induced expression were separated and detected, CYP51H10 was found to oxidatively modify Lupeol by comparison with standards of a blank control, and the product of the combination was estimated to be 16 β -Hydroxy-Lupeol according to the known function of CYP51H 10.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Guangzhou college of traditional Chinese medicine (Guangzhou institute of traditional Chinese medicine)

<120> lupeol derivative and synthesis method and application thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 2109

<212> DNA

<213> Artificial sequence

<400> 1

atgcaatcgg agacgatgaa gctctcacct ttggatctga tgatggcgat cttgaccggg 60

aagctcgggg acagcggcct acccccagag gtggcctcga tcaccgagaa ccgcgagctc 120

cttatgattc tgacgacgtc gatcgccgtc ctgattggat gcgctgttgt tttcttgtgg 180

cggcggtcga gcgggaagtc cagcaagtct gtggaacctc cgagacctct cgtgattccc 240

aaggagccgg agcctgaggt cgacgatggg aagaagaaag tcaccatctt ttttggtacc 300

cagaccggga cggctgaagg ttttgctaag tcgctggcgg aagaggccaa ggctagatat 360

gacaaggcga ccttcaaagt cgtcgatctg gatgattacg cggcggacga tgatgagtac 420

gaggagaaga tgaagaaaga aaccctagcc ctgttcttct tggcaacata tggagacggg 480

gaaccaactg ataacgctgc cagattctat aaatggttta ctgaggggaa agagagggaa 540

caatggctgg agaatcttca atatgctgtg ttcggtttgg gcaataggca gtacgagcat 600

ttcaataagg tggcaaaggt ggtggatgag gtccttgctg aacagggagc aaagcgcctt 660

gtcccagtgg gtcttgggga tgatgatcag tgcattgagg atgatttcgc cgcatggaga 720

gagctattat ggccagaatt agatcaattg ctacgagatg aagatgatgc atcgggtgca 780

tccaccacat atacagctgc tgttcctgaa taccgagttg tattgattga ctctgcaggc 840

gcatctcatt tggagaagaa ttggagtctt gcaaatggtc atgctgttca tgatattcac 900

catccatgca gagctaatgt ggctgtgcgg agggagcttc atactccagc ttctgaccgt 960

tcctgcattc atctggagtt tgatatttcg gggacaggtc ttgcatatga aacaggggat 1020

catgttggtg tatattcaga gaattgtctt gagactgtag aggaggcaga gaagttatta 1080

ggtcttccat cagacacatt tttctccatt catgctgaca atgaagatgg aactccactt 1140

ggcagctctt tgccacctcc attcccatct ccatgcactt taagaacagc actcacacgc 1200

tatgctgatc ttctgaattc tcctaaaaag gctgctttgg ttgctttagc tactcatgct 1260

tctgatccca atgaagcaga aagattgaga tttttggctt ctcctgcagg aaaggatgag 1320

tactctcaat gggtagttgc tagtcagagg agccttctgg aggttatggc tgagtttcct 1380

tcagccaagc ctccactagg agttttcttt gcagcaatag ccccccgctt gcagcctaga 1440

tattattcaa tatcatcttc accaaggatg gcaccaacta gaattcatgt cacatgcgct 1500

ctagtttatg gaccaacacc tacaggaagg attcacaaag gagtctgctc aacctggatg 1560

aagcatgcag ttccttcaga ggagagcaaa gagtgcagct gggcccctat atttgtgaga 1620

cagtcaaact tcaaactccc ttcacatccc tccacaccaa ttattatgat tggcccaggc 1680

acagggttgg cacccttcag gggcttcctg caggaaagat tggcactaaa gcaagctggc 1740

acagaacttg gccctgccat tctcttcttt ggttgccgga accgaagaat ggatttcata 1800

tacgaggatg agctgaaaaa ttttgttgag gaaggtgcac tttctgagct gattgtagcc 1860

ttttctcgtg agggtcagac caaggaatat gtgcagcata agatggctga gaaggctgtt 1920

gagctctgga atatcatctc taagggtgga tatctttatg tatgtggtga cgcgaaaggt 1980

atggctagag atgtccatag agtgctccac actatagttc aagagcaggg atcattggat 2040

agctcaaagg ctgagagcat ggtaaagagt ctacagatgg aagggagata tctgcgtgat 2100

gtgtggtaa 2109

<210> 2

<211> 2076

<212> DNA

<213> Artificial sequence

<400> 2

atgacttcga attccgattt ggttcgcacc attgagtcgg tgctgggcgt ttcactcggc 60

gattcggtct ccgattcgct cgttctgata gcgactacct ccgtcgccgt cataattggg 120

ctccttgtgt tcctgtggaa gaaatcttcg gatcggagca gggaggtgag gccggtgatt 180

gtgccgaagt cgttggtgaa ggatgaagac gatgatgtcg acgttgcctc cgggaagact 240

aaggttactg ttttcttcgg tactcagact ggtactgctg agggcttcgc taaggcattg 300

gcggacgaga tcaaggcaag atatgaaaaa gcatatgtca aagttgttga tttggatgac 360

tatgcaatgg atgatgatca atatgaggag aagctgaaga aagaaactct tgcatttttc 420

atgctggcaa cttatggaga tggagagcca actgacaatg ctgcaagatt ctacaaatgg 480

tttactgagg gtaaagagga gaggggcacc tggcttcaac agctcacaca tggagttttt 540

ggcctaggta acaagcaata tgaacatttt aataagatag gtaaagttgt tgatgaagac 600

cttagtgaac aaggtgcaaa gcgtcttgtt ccacttggac taggtgatga tgatcaatcc 660

attgaggatg atttttctgc ctggaaagaa tctctgtggc ctgagttgga tcagttgctc 720

cgagatgagg atgatgtgaa tactgtttct actccctata ctgctgctat tcctgaatat 780

cgagtagtga ttcatgactc cactgtcaca ccatcctatg ataatcaatt cagcgcagca 840

aatgggggtg ctgtatttga tattcatcat ccttgcaggg taaatgttgc tgttaaaagg 900

gagcttcaca aacctcagtc tgaccgttcc tgcatacatt tggagtttga tatatcgggg 960

actggcataa catatgaaac tggagaccat gtgggtgttt atgctgagaa ctgtgatgaa 1020

actgttgaag aagctgggaa gttgttgggt caaaatttag atttgctgtt ttctcttcac 1080

actgataacg aggatggcac ttcccttgga ggctctctgc tacctccttt ccctggtcct 1140

tgcacactgc gtacggcgtt agcacgttat gcagatctct tgaaccctcc acgaaaggct 1200

gctttagttg tattagctgc tcatgcttct gaacctagtg aggcagaaag attgaagttc 1260

ctctcctctc ctcaggggaa ggatgagtac tccaaatggg tggttggaag ccagagaagt 1320

ctccttgagg tgatggctga gtttccatca gcaaaacctc cacttggtgt gtttttcgct 1380

gccatagccc ctcgtttaca gcctcgttat tattctattt catcctctcc taggtttgcc 1440

tcacaaaggg tacatgtaac ttgtgccctg gtgtatggtc caactcccac tggcagaatt 1500

cacaaaggag tatgctcaac ctggatgaag aatgctattc ccttagagga aagccgtgac 1560

tgtggctggg ctcccatttt tatcaggcca tcaaatttca agctaccagc cgatcattcg 1620

attcctatta ttatggttgg acctggtact ggtttggcac cttttagggg atttttacag 1680

gaaagatttg ccctcaaaga ggatggtgtt caacttggtc cttcattact cttctttgga 1740

tgcaggaacc gtcaaatgga ttttatttat gaggatgagc taaagaattt tgtggaacaa 1800

ggttctctgt cagagttgat agttgcattc tctagagagg ggcctgaaaa ggagtatgtt 1860

caacacaaga tgatggataa agcagcatac ctgtggagtc tgatttctca gggaggttat 1920

ctttatgtct gtggtgatgc caagggtatg gccagagatg ttcatcgaat tcttcatacc 1980

attgtccagc agcaggaaaa tgtggagtcg tcaaaggcgg aggctatagt gaaaaaactc 2040

cagatggatg gacgttacct cagggatgtc tggtga 2076

Claims

1. A method for synthesizing a lupeol derivative comprising culturing cells; the cell is capable of producing 2, 3-oxidosqualene, and the cell contains a first gene encoding a CYP450 enzyme, a second gene encoding lupeol synthase, and a third gene encoding CPR reductase;

wherein the CYP450 enzyme is selected from: at least one of CYP51H10, CYP716A83, CYP88D6, CYP93E3, CYP93E2 and CYP716A83, or at least one of mutants having the same catalytic function as the CYP450 enzyme gene.

2. The method of synthesizing lupeol derivatives according to claim 1, wherein said third gene is selected from at least one of the following genes: AaCPR, GgCPR1 and AtCPR;

preferably, the base sequence of AaCPR is shown in SEQ ID No. 1; the sequence of the GgCPR is shown as SEQ ID No. 2.

3. The method of synthesizing lupeol derivatives according to claim 1, wherein said second gene is selected from: at least one of GgLUS1, AtLUS1, and KdLUS;

preferably, the second gene is GgLUS 1.

4. The method of synthesizing lupeol derivatives according to claim 1, comprising introducing said first gene, said second gene and said third gene into a cell by means of plasmid transfection or integration into the genome of the cell;

preferably, the cell is selected from: any one of yeast cells and tobacco;

5. The method of synthesizing lupeol derivatives according to claim 4, wherein when the means of introduction into the cell is plasmid transfection, the method comprises transfection by ligating the first gene and the third gene to the same vector.

6. The method of synthesizing lupeol derivatives according to claim 4, further comprising fermenting the cell into which the first, second and third genes are introduced or culturing the plant transfected with the first, second and third genes after the introduction.

7. The method of synthesizing lupeol derivatives according to claim 6, comprising transfecting Saccharomyces cerevisiae with galactose-induced expression plasmid, fermenting by means of carbon source limitation and staged feeding;

8. Lupeol derivatives, characterized in that they comprise: at least one of 11 alpha-Hydroxy-lupeol, 16 beta-Hydroxy-lupeol, 24-Hydroxy-lupeol, 11 alpha-Hydroxy-lupeol derivatives, 16 beta-Hydroxy-lupeol derivatives, and 24-Hydroxy-lupeol derivatives;

formula 1:

formula 2:

formula 3:

9. Use of a lupeol derivative synthesized by the method for the synthesis of a lupeol derivative according to any one of claims 1 to 7 or a lupeol derivative according to claim 8 for the preparation of an antitumor, anti-inflammatory or antiviral medicament.

10. An anti-tumor, anti-inflammatory or antiviral agent comprising the lupeol derivative synthesized by the method for synthesizing lupeol derivatives according to any one of claims 1 to 7 or the lupeol derivative according to claim 8.