CN105802926B - 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application - Google Patents
2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application Download PDFInfo
- Publication number
- CN105802926B CN105802926B CN201610236283.9A CN201610236283A CN105802926B CN 105802926 B CN105802926 B CN 105802926B CN 201610236283 A CN201610236283 A CN 201610236283A CN 105802926 B CN105802926 B CN 105802926B
- Authority
- CN
- China
- Prior art keywords
- acid
- maa45
- sequence
- triterpene
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/06—Hydroxylating
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application.2 α of triterpene-hydroxylase MAA45 disclosed by the invention is following A1), A2) or A3): A1) amino acid sequence is the protein of sequence 1 in sequence table；A2) by amino acid sequence shown in sequence 1 in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues and protein with the same function；A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label.It is demonstrated experimentally that MAA45 can prepare hawthorn acid by substrate of oleanolic acid, Corosolic acid can also be prepared by substrate of malol, can use MAA45 and its encoding gene preparation hawthorn acid and Corosolic acid, 2 α-hydroxylations of triterpene can also be catalyzed using MAA45.
Description
Technical field
The present invention relates to 2 α of triterpene-hydroxylase MAA45 and its relevant biological material in field of biotechnology and they
Prepare the application in hawthorn acid and Corosolic acid.
Background technique
Hawthorn acid (Maslinic acid) (formula 1), Corosolic acid (Corosolic acid) (formula 2) and asiatic acid
(Asiatic acid) (formula 3) etc. is that the medicinal triterpene active component of 2 α-hydroxylations of representative is hawthorn (Crataegus
Pinnatifida Bunge), loquat (Eriobotrya japonica), banaba (Lagerstroemia speciosa
(L.) Pers.) and medicinal plants itself synthesis such as centella (Centella asiatica (L.) Urb.) micro secondary metabolism
Object, hawthorn acid and Corosolic acid are Pentacyclic triterpenic acid, belong to β-botany bar gum type or α-botany bar gum type pentacyclic triterpene chemical combination
Object, hawthorn acid and Corosolic acid are isomer, and in plant, the two usually exists jointly.Hawthorn acid, Corosolic acid and
Asiatic acid is widely used in anticancer, anti AIDS virus, the fields such as beauty and liver protecting, has been used as nutritional supplement or change
Cosmetic circulates on the market.The current this kind of compound mainly separation and Extraction from hawthorn, the plants such as banaba, loquat obtains
It arrives, but this method has the shortcomings that more, including content is low and difference is big, and purifying products are difficult, and plant growing cycle is long, to biology
Resource especially wild resource does great damage.
Currently with the principle of synthetic biology, design and transformation microbial strains are recognized to produce the world natural products Yi Bei
To be a kind of most potential method, the precursor Japanese yew diene that taxol is produced such as in Escherichia coli has reached 1000mg/L
(Parayil Kumaran Ajikumar et al.,2010,Science,330:70-74)；Bilobalide-like
(Ginkgolides) precursor sinistral corean pine diene (Levopimaradiene) reaches in improved colibacillus engineering
The yield (Effendi Leonard et al., 2010, PNAS, 107 (31): 13654-13659) of 700mg/L；In yeast work
The precursor Arteannuic acid (Artemisinic acid) that qinghaosu (Artemisinin) is produced in journey bacterium is up to 25g/L
(Paddon CJ et al.,2013,Nature,2013,496:528-532)；The country is in qinghaosu, taxol, ginseng at present
There is correlative study in terms of the biosynthesis of the drug molecules such as saponin(e and tanshinone.
However, clearly natural drug biosynthetic process is to create artificial cell factory hair using synthetic biology technology
The premise of ferment productive target compound.Have related developments, packet in terms of the biosynthesis pathway research of triterpenoid at present
It includes the cyclization enzyme to form each triterpene basic framework and carries out 6-, 11-, 16- on basic framework, 22-, 23-, 24-, 28- oxidation
P450 enzyme, but do not excavated also in a kind of 2 generation α-hydroxylation enzymes (P450 enzyme).
Summary of the invention
The technical problem to be solved by the present invention is to how prepare hawthorn acid and/or Corosolic acid.
In order to solve the above technical problems, present invention firstly provides a kind of protein with hydroxylase function, title
For hawthorn acid/Corosolic acid GAP-associated protein GAP (MAA45), MAA45 is following A1), A2) or A3):
A1) amino acid sequence is the protein of sequence 1 in sequence table；
A2) by amino acid sequence shown in sequence 1 in sequence table by one or several amino acid residues substitution and/or
Deletion and/or addition and protein with the same function；
A3) in A1) or the obtained fused protein of N-terminal A2) or/and C-terminal connection label.
Wherein, sequence 1 is made of 476 amino acid residues.
In order to make A1) in protein convenient for purifying, amino acid sequence shown in sequence 1 can be formed in by sequence table
The amino terminal or carboxyl terminal of protein connect upper label as shown in Table 1.
The sequence of table 1, label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned A2) in MAA45 protein, the substitution of one or several amino acid residues and/or missing and/or add
Add as the substitution and/or deletion and/or addition no more than 10 amino acid residues.
Above-mentioned A2) in MAA45 protein can be artificial synthesized, can also first synthesize its encoding gene, then carry out biological expression
It obtains.
Above-mentioned A2) in the encoding gene of MAA45 protein can be by by DNA shown in 795-2225 of sequence 2
The codon of one or several amino acid residues is lacked in sequence, and/or carries out the missense mutation of one or several base-pairs,
And/or it is obtained in the coded sequence that its 5 ' end and/or 3 ' ends connect label shown in table 1.
In order to solve the above technical problems, the present invention also provides biomaterial relevant to MAA45, the biomaterial is
Following B1) any one of to B10):
B1 the nucleic acid molecules of MAA45) are encoded；
B2) contain B1) expression cassettes of the nucleic acid molecules；
B3) contain B1) recombinant vectors of the nucleic acid molecules；
B4) contain B2) recombinant vector of the expression cassette；
B5) contain B1) recombinant microorganisms of the nucleic acid molecules；
B6) contain B2) recombinant microorganism of the expression cassette；
B7) contain B3) recombinant microorganism of the recombinant vector；
B8) contain B4) recombinant microorganism of the recombinant vector；
B9) contain B1) transgenic cell lines of the nucleic acid molecules；
B10) contain B2) transgenic cell line of the expression cassette.
In above-mentioned biomaterial, B1) nucleic acid molecules can for it is following 1) or 2) or 3) shown in nucleic acid molecules:
1) coded sequence is the 795-2225 cDNA molecules or DNA molecular of sequence 2 in sequence table；
2) there is 75% or 75% or more identity with the nucleotide sequence 1) limited, and encodes the cDNA molecule of MAA45
Or genomic DNA molecule；
3) nucleotide sequence hybridization with 1) restriction, and the cDNA molecule or genome of coding MAA45 under strict conditions
DNA molecular；
B2) expression cassette can be DNA molecular shown in 7-2450 of sequence 2 in sequence table.
Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules can also
To be RNA, such as mRNA or hnRNA.
Wherein, 1-6 of sequence 2 are the identification sequence of SacII, the 7-787 of sequence 2 with 2541-2546
Position is the sequence of PGK1 promoter, and 788-794 of sequence 2 are the identification sequence of SexA, and 795-2225 of sequence 2 are
The sequence of MAA45 gene, MAA45 shown in coded sequence 1,2226-2233 of sequence 2 are the identification sequence of AscI, sequence
2234-2540 of column 2 are the sequence of CYC1t terminator.
Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation
Method is mutated the nucleotide sequence of coding MAA45 of the invention.Those have and the present invention point by manually modified
The nucleotide of nucleotide sequence 75% or higher identity from obtained MAA45, as long as encoding MAA45 and there is MAA45
Function is derived from nucleotide sequence of the invention and to be equal to sequence of the invention.
Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair
Amino acid sequence shown in bright coded sequence 1 composition protein nucleotide sequence have 75% or higher or 85% or
Higher or 90% or higher or 95% or higher identity nucleotide sequence.Identity can with the naked eye or computer software
It is evaluated.Using computer software, identity between two or more sequences can be indicated with percentage (%), can be with
For evaluating the identity between correlated series.
In above-mentioned biomaterial, the stringent condition is hybridized simultaneously at 68 DEG C in 2 × SSC, the solution of 0.1%SDS
It washes film 2 times, each 5min, and in 0.5 × SSC, the solution of 0.1%SDS, hybridize at 68 DEG C and washes film 2 times, every time
15min；Or, hybridizing under the conditions of 65 DEG C in the solution of 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS and washing film.
Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.
In above-mentioned biomaterial, B2) described in the nucleic acid molecules containing coding MAA45 expression cassette (MAA45 gene expression
Box), it is the DNA for referring to express MAA45 in host cell, which not only may include the starting for starting MAA45 genetic transcription
Son may also include the terminator for terminating MAA45 genetic transcription.Further, the expression cassette may also include enhancer sequence.At this
In one embodiment of invention, B2) expression cassette is specially DNA molecular shown in 7-2540 of sequence 2 in sequence table.
The recombinant vector of the MAA45 expression casette can be contained with existing vector construction.
In above-mentioned biomaterial, the carrier can be plasmid, sticking grain, bacteriophage or viral vectors.The plasmid specifically may be used
For pRS313 or pRS314, or to the carrier that pRS313 or pRS314 are transformed.
B3) for encoding the DNA sequence dna of MAA45 shown in 795-2225 containing sequence 2 of the recombinant vector.
Recombinant vector described further concretely pRS313-TRP-PGK1-MAA45-CYC1t or pRS313-HIS-PGK1-MAA45-
CYC1t.The pRS313-HIS-PGK1-MAA45-CYC1t is to be inserted into sequence between the identification sequence of the SacII of carrier pRS313
DNA fragmentation shown in 7-2540 of column 2, obtained recombinant vector.The pRS313-TRP-PGK1-MAA45-CYC1t is
The DNA fragmentation containing HIS in the pRS313-HIS-PGK1-MAA45-CYC1t between sequence 3 and sequence 4 is replaced with into carrier
The recombinant vector that the DNA fragmentation containing TRP in pRS314 between sequence 5 and sequence 6 obtains.
In above-mentioned biomaterial, the microorganism can be yeast, bacterium, algae or fungi.Wherein, yeast can be saccharomyces cerevisiae
Saccharomyces cerevisiae, such as Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-OA or saccharomyces cerevisiae
Saccharomyces cerevisiae BY-OA-UA。
In above-mentioned biomaterial, the recombinant microorganism can be that the B1) nucleic acid molecules are imported saccharomyces cerevisiae
The recombinant microorganism for the expression MAA45 that Saccharomyces cerevisiae is obtained, as will be described pRS313-TRP-PGK1-
MAA45-CYC1t imports Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-OA or Saccharomyces Cerevisiae in S accharomyces
The recombinant bacterium BY-OA-MAA45 or recombinant bacterium BY-OA-UA-MAA45 that cerevisiae BY-UA is obtained.
In above-mentioned biomaterial, the transgenic cell line does not include propagation material.
In order to solve the above technical problems, the present invention also provides the preparation methods of MAA45, which comprises culture contains
There is the recombinant microorganism of the expression cassette of the encoding gene of MAA45, express the encoding gene of MAA45, obtains the weight of expression MAA45
Group culture of microorganism；The protein is obtained from the recombinant microorganism culture.
In the preparation method of above-mentioned MAA45, the encoding gene of the MAA45 can be B1 in above-mentioned biomaterial) core
Acid molecule.
In the preparation method of above-mentioned MAA45, the expression cassette of the encoding gene containing MAA45 can be above-mentioned biomaterial
Middle B2) expression cassette.
In the preparation method of above-mentioned MAA45, the recombinant microorganism can be recombinant microorganism described in above-mentioned biomaterial.
In order to solve the above technical problems, the present invention also provides the preparation method of hawthorn acid and/or Corosolic acid, the side
Method includes carrying out catalysis reaction with MAA45 as substrate using oleanolic acid and/or malol to obtain hawthorn acid and/or Corosolic acid.
In order to solve the above technical problems, the present invention also provides the preparation methods of hawthorn acid and/or Corosolic acid, by the party
Method is named as method 1, and the method 1 includes: that the expression cassette importing of the encoding gene containing MAA45 can be generated oleanolic acid
And/or in the receptor biological cell of malol, recombination biological cell is obtained；The recombination biological cell is cultivated, the volume of MAA45 is made
Code gene expression, obtains the cell culture of expression MAA45；Hawthorn acid is obtained from the cell culture of the expression MAA45
And/or Corosolic acid；The receptor biological cell is microbial cell, plant cell or non-human animal cell.
In the above method 1, the encoding gene of the MAA45 can be B1 in the biomaterial) nucleic acid molecules.
In the above method 1, the expression cassette of the encoding gene containing MAA45 can be B2 in the biomaterial) it is described
Expression cassette.
In the above method 1, the receptor biological cell can be can be yeast, bacterium, algae or fungi.Wherein, yeast can be
Saccharomyces Cerevisiae in S accharomyces cerevisiae, such as Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-OA or institute
State Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-UA.
In one embodiment of the invention, the recombination biological cell is by the pRS313-TRP-PGK1-MAA45-
CYC1t imports the Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-OA or the saccharomyces cerevisiae
The recombinant bacterium BY-OA-MAA45 or recombinant bacterium BY-OA-UA-MAA45 that Saccharomyces cerevisiae BY-UA is obtained.
In the above method 1, the method, which may also include, to be removed in the mixture containing hawthorn acid and/or Corosolic acid
Impurity obtain hawthorn acid and/or Corosolic acid.
In order to solve the above technical problems, the present invention also provides hydroxylation enzyme preparation or triterpene 2 α-hydroxylation enzyme preparation, it is described
Hydroxylation enzyme preparation or the triterpene 2 α-hydroxylation enzyme preparation contains MAA45 or the biomaterial.
The hydroxylation enzyme preparation or the triterpene 2 α-hydroxylation enzyme preparation can only using MAA45 or the biomaterial as
Its active constituent, can with MAA45 or the biomaterial and other with 2 α-hydroxylase activity objects of hydroxylase or triterpene
Matter is collectively as its active constituent.
In order to solve the above technical problems, the present invention also provides following any applications:
X1, MAA45 are as the application in 2 α-hydroxylases of hydroxylase or triterpene；
The application of X2, MAA45 in preparation hydroxylation enzyme product or triterpene 2 α-hydroxylation enzyme product；
The application of X3, MAA45 in production hawthorn acid and/or Corosolic acid；
The application of X4, MAA45 in degradation oleanolic acid and/or malol；
X5, the biomaterial are preparing the application in 2 α-hydroxylases of hydroxylase or triterpene；
The application of X6, the biomaterial in preparation hydroxylation enzyme product or triterpene 2 α-hydroxylation enzyme product；
The application of X7, the biomaterial in production hawthorn acid and/or Corosolic acid；
The application of X8, the biomaterial in degradation oleanolic acid and/or malol；
X9, the MAA45 preparation method preparing the application in 2 α-hydroxylases of hydroxylase or triterpene；
X10, the MAA45 preparation method preparation hydroxylation enzyme product or triterpene 2 α-hydroxylation enzyme product in application；
Preparation method the answering in degradation oleanolic acid and/or malol of X11, hawthorn acid and/or Corosolic acid
With；
X12, the hydroxylation enzyme preparation or the triterpene 2 α-hydroxylation enzyme preparation are in production hawthorn acid and/or Corosolic acid
In application；
X13, the hydroxylation enzyme preparation or the triterpene 2 α-hydroxylation enzyme preparation are in degradation oleanolic acid and/or malol
In application.
The MAA45 channel genes cloned from hawthorn can produce the S. cervisiae of oleanolic acid (OA) by the present invention
Afterwards, recombinant bacterium can produce hawthorn acid；MAA45 channel genes can produce to the wine brewing ferment of oleanolic acid (OA) Yu malol (UA)
After in female bacterium, recombinant bacterium can produce hawthorn acid and Corosolic acid, and the bacterial strain for not importing the gene cannot generate hawthorn
Acid and Corosolic acid show that MAA45 can prepare hawthorn acid by substrate of oleanolic acid, can also be using malol as substrate system
Standby Corosolic acid.Since oleanolic acid (formula 4) and malol (formula 5) is triterpenoid, oleanolic acid is β-botany bar gum (β-
Amyrin) type, malol is α-botany bar gum (α-Amyrin) type, and compared with oleanolic acid, hawthorn acid is only at oleanolic acid 2
The product that α-hydroxylation obtains occurs, compared with malol, Corosolic acid is that the production that α-hydroxylation obtains only occurs at malol 2
Object shows that MAA45 is 2 α-hydroxylases of triterpene.It is demonstrated experimentally that can use MAA45 and its encoding gene preparation hawthorn acid and
Corosolic acid can also be catalyzed 2 α-hydroxylations of triterpene using MAA45.
Detailed description of the invention
Fig. 1 is that the LC-MS of BY-OA-MAA45 solution analyzes result.
Fig. 2 is that the LC-MS of BY-OA-UA-MAA45 solution analyzes result.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.
Experimental method in following embodiments is unless otherwise specified conventional method.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
In following embodiments pRS313 (Sikorski, R.S.and Hieter, P.1989, Genetics 122 (1):
19-27), the public can obtain from Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences.
In following embodiments pRS314 (Sikorski, R.S.and Hieter, P.1989, Genetics 122 (1):
19-27), the public can obtain from Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences.
Embodiment 1, MAA45 can be used to prepare hawthorn acid and Corosolic acid
The present invention provides one kind from hawthorn (Crataegus pinnatifida Bunge) protein, title
For hawthorn acid/Corosolic acid GAP-associated protein GAP (MAA45), MAA45 can be catalyzed 2 α-hydroxylations of triterpene, belong to 2 α-hydroxylations of triterpene
Enzyme, the amino acid sequence of MAA45, can the MAA45 bases as shown in 795-2225 of sequence 2 as shown in sequence 1 in sequence table
Because of coding.
1, the preparation of recombinant vector
Utilize restriction enzyme SacII, the 7- of insetion sequence 2 between the identification sequence of the SacII of carrier pRS313
DNA fragmentation shown in 2540 keeps the other sequences of carrier pRS313 constant, obtains recombinant vector, which is ordered
Entitled pRS313-HIS-PGK1-MAA45-CYC1t.
Wherein, 1-6 of sequence 2 are the identification sequence of SacII, the 7-787 of sequence 2 with 2541-2546
Position is the sequence of PGK1 promoter, and 788-794 of sequence 2 are the identification sequence of SexA, and 795-2225 of sequence 2 are
The sequence of MAA45 gene, MAA45 shown in coded sequence 1,2226-2233 of sequence 2 are the identification sequence of AscI, sequence
2234-2540 of column 2 are the sequence of CYC1t terminator.
Using pRS313-HIS-PGK1-MAA45-CYC1t as template, using primer pair (V313-to-R:
CTTTGCCTTCGTTTATCTTGC (sequence 3)；V313-to-F:TATATGTATACCTATGAATGTCAG (sequence 4)) it carries out
Obtained PCR product is named as 313-PGK1-MAA45-CYC1t by PCR amplification.Using carrier pRS314 as template, primer is utilized
To (Bsp-TRP-F:TGGCGTCCGGAT4ACAATCTTGATCCGGAGCT (sequence 5)；Bsp-TRP-R:TGGCGTCCGGACA
CAAACAATACTTAAATAAATAC (sequence 6)) PCR amplification is carried out, obtained PCR product is named as TRP.By 313-
PGK1-MAA45-CYC1t and TRP carries out blunt end cloning, obtains recombinant vector, the correct recombinant vector of sequence is named as
pRS313-TRP-PGK1-MAA45-CYC1t.Compared with pRS313-HIS-PGK1-MAA45-CYC1t, pRS313-TRP-
PGK1-MAA45-CYC1t is only by primer pair in pRS313-HIS-PGK1-MAA45-CYC1t (V313-to-R and V313-to-
F the DNA fragmentation containing HIS between) replaces with containing between primer pair in carrier pRS314 (Bsp-TRP-F and Bsp-TRP-R)
The recombinant vector that the DNA fragmentation of TRP obtains.
Using pRS313 as template, PCR amplification is carried out using primer pair (V313-to-R and V313-to-F), by what is obtained
PCR product is named as 313.Blunt end cloning is carried out with above-mentioned TRP by 313, recombinant vector is obtained, sequence is correctly recombinated to load
Body is named as pRS313-TRP.Compared with pRS313, pRS313-TRP be only by primer pair in pRS313 (V313-to-R and
V313-to-F the DNA fragmentation containing HIS between) replaces with primer pair in carrier pRS314 (Bsp-TRP-F and Bsp-TRP-R)
Between the obtained recombinant vector of the DNA fragmentation containing TRP.
2, the preparation of recombinant bacterium
The pRS313-TRP-PGK1-MAA45-CYC1t of step 1 is imported into out bacterium germination Saccharomyces Cerevisiae in S accharomyces
Cerevisiae BY-OA (is documented in Chinese patent ZL201310399947.X)；Hereinafter referred to as BY-OA, BY-OA can be produced
In raw oleanolic acid (OA), recombinant bacterium is obtained, which is named as BY-OA-MAA45；The pRS313-TRP of step 1 is led
Enter in BY-OA, obtain recombinant bacterium, which is named as BY-OA-pRS313-TRP.
The pRS313-TRP-PGK1-MAA45-CYC1t of step 1 is imported into out bacterium germination Saccharomyces Cerevisiae in S accharomyces
In cerevisiae BY-UA (hereinafter referred to as BY-OA-UA, BY-OA-UA can produce malol (UA)), recombinant bacterium is obtained, it will
The recombinant bacterium is named as BY-OA-UA-MAA45；The pRS313-TRP of step 1 is imported in BY-OA-UA, recombinant bacterium is obtained, it will
The recombinant bacterium is named as BY-OA-UA-pRS313-TRP.
Wherein, BY-OA-UA is prepared according to following 2.1-2.3:
The plasmid construction of 2.1 Genetic elements
(1) building of pM2-aAS plasmid
With SexA1 and Asc1 respectively to p-aAS (company synthesizes, and sequence is sequence 7 in sequence table) and plasmid pM2-
THMG1 (being documented in Chinese patent ZL201310399947.X) carries out double digestion；Rubber tapping purifying target gene aAS and load respectively
Body segment pM2 (about 4kb), and be added simultaneously linked system (each 50ng): (NEB is public by 2 μ l 10XT4 ligation Buffer
Department), 1 μ l T4 ligase (NEB company, 400,000 cohesive end units/ml), supplement distilled water is to 20 μ l, room
Temperature reaction obtains connection product in 2 hours, converts, and the correct carrier of obtained sequence is named as pM2-aAS by sequence verification.
(2)pM4-CYP15
With SexA1 and Asc1 respectively to p-CYP15 (company synthesizes, and sequence is sequence 8 in sequence table) and plasmid pM11-
AtCPR1 (being documented in Chinese patent ZL201310399947.X) carries out double digestion；Rubber tapping purifying target gene CYP15 respectively
It with carrier segments pM4 (about 4kb), and is added simultaneously linked system (each 50ng): 2 μ l 10XT4 ligation Buffer (NEB
Company), 1 μ l T4 ligase (NEB company, 400,000 cohesive end units/ml), supplement distilled water to 20 μ l,
Room temperature reaction obtains connection product in 2 hours, converts, and the correct carrier of obtained sequence is named as pM4- by sequence verification
CYP15。
(3)pM3-ljCPR
With SexA1 and Asc1 respectively to p-LjCPR (company synthesizes, and sequence is sequence 9 in sequence table) and plasmid pM3-
ERG9 (being documented in Chinese patent application 201210453416.X) carries out double digestion；Rubber tapping purifying target gene ljCPR respectively
It with carrier segments pM3 (about 4kb), and is added simultaneously linked system (each 50ng): 2 μ l 10XT4 ligation Buffer (NEB
Company), 1 μ l T4 ligase (NEB company, 400,000 cohesive end units/ml), supplement distilled water to 20 μ l,
Room temperature reaction obtains connection product in 2 hours, converts, and the correct carrier of obtained sequence is named as pM3- by sequence verification
ljCPR。
The building of 2.2BY-T3
With the pcr template of the description of primer table 2, (pTrp-HIS, pEHIS-ERG20, pM11-ERG1 and pM3-ERG9 are equal respectively
It is documented in Chinese patent application 201210453416.X) and primer progress PCR acquisition functional module: M1 (Trp-HIS-up),
M2(PPGK1-ERG20-TADH1), M3 (PTDH3-ERG1-TTPI1), M4 (PTEF1-ERG9-TCYC1), M5 (Trp-down).Amplification system
Are as follows: 10 μ l of NewEngland Biolabs Phusion 5Xbuffer, dNTP (10mM each dNTP) 1 μ l, DNA profiling
20ng, it each 1 μ l of primer (10uM), Phusion High-Fidelity DNA Polymerase (2.5U/ μ l) 0.5 μ l, adds
Distilled water is to 50 μ l of total volume.Amplification condition is 98 DEG C of initial denaturations 1.5 minutes (1 circulation)；98 DEG C are denaturalized 10 seconds, annealing 10 seconds
(58 DEG C of annealing temperature), 72 DEG C of extensions are with 2 minutes (32 circulations)；72 DEG C extend 8 minutes (1 circulation), and product is through tapping rubber
Recycling saves.
Primer table 2
According to the preparation method of competent cell in embodiment 2 in Chinese patent application 201210453416.X, it is prepared into
To BY-T1 competent cell, conversion segment: M1, M2, M3, M4 and M5 gene mould is then added into BY-T1 competent cell
Block totally 5 μ g (molar ratio=1:1:1:1:1).The culture medium of screening and culturing are as follows: 0.8% (mass percent concentration) yeast selection training
Support base SD-His, 2% (mass percent concentration) glucose, 0.01% (mass percent concentration) Trp, 0.01% (quality hundred
Divide specific concentration) Ura, 0.005% (mass percent concentration) Leu；The condition of screening and culturing are as follows: 30 degree, cultivate 36h or more.PCR
The correct positive colony of sequence is identified, bacterial strain BY-T3 is named as.
The building of 2.3BY-UA
With the pcr template of the description of primer table 3, (prDNA-Leu2 is documented in Chinese patent application 201210453416.X respectively
In) and primer progress PCR acquisition functional module: M1 ' (prDNA-Leu2-up), M2 ' (PPGK1-aAS-TADH1), M3 ' (PTDH3-
CYP15-TTPI1), M4 ' (PTEF1-ljCPR-TCYC1), M5 ' (prDNA-Leu2-down).Amplification system are as follows: NewEngland
10 μ l of Biolabs Phusion 5Xbuffer, dNTP (10mM each dNTP) 1 μ l, DNA profiling 20ng, primer (10uM)
Each 1 μ l, Phusion High-Fidelity DNA Polymerase (2.5U/ μ l) 0.5 μ l, distilled water is added to total volume 50
μl.Amplification condition is 98 DEG C of initial denaturations 1.5 minutes (1 circulation)；98 DEG C be denaturalized 10 seconds, annealing 10 seconds (58 DEG C of annealing temperature),
72 DEG C extend with 2 minutes (32 circulations)；72 DEG C extend 8 minutes (1 circulation), and product is tapped and recovered preservation.
Primer table 3
According to the preparation method of competent cell in embodiment 2 in Chinese patent application 201210453416.X, it is prepared into
To BY-T3 competent cell, conversion segment: M1 ', M2 ', M3 ', M4 ' and M5 ' is then added into BY-T3 competent cell
Netic module totally 5 μ g (molar ratio=1:1:1:1:1).The culture medium of screening and culturing are as follows: 0.8% (mass percent concentration) yeast
Selective agar medium SD-Leu-His, 2% (mass percent concentration) glucose, 0.01% (mass percent concentration) Trp,
0.01% (mass percent concentration) Ura；The condition of screening and culturing are as follows: 30 degree, cultivate 36h or more.It is correct that PCR identifies sequence
Positive colony, be named as bacterial strain BY-OA-UA.
3, the preparation of hawthorn acid and Corosolic acid
3.1 shake flask fermentations:
Respectively solid selection medium 1 (solid selection medium 1 is made of solute and solvent, and solvent is water, solute and
Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose, and 0.01%
Trp. and agar powder) in activated b Y-OA, being then inoculated in liquid selective medium 1 respectively, (liquid selective medium 1 is by solute
It is formed with solvent, solvent is water, and solute and its mass percent concentration are respectively as follows: 0.8% yeast Selective agar medium SD-Ura-
Trp-Leu-His, 2% glucose, 0.01%Trp.) in 30 DEG C, 250rpm cultivates 16h and prepares seed liquor, by seed liquor with
1% inoculum concentration is inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 1, and 30 DEG C, 250rpm shaken cultivation 6 days,
Obtain BY-OA fermentation liquid.
Respectively solid selection medium 2 (solid selection medium 2 is made of solute and solvent, and solvent is water, solute and
Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose, and 0.01%
Trp., 0.01%Ura. and agar powder) in activated b Y-OA-UA, be then inoculated in 2 (liquid selective of liquid selective medium respectively
Culture medium 2 is made of solute and solvent, and solvent is water, and solute and its mass percent concentration are respectively as follows: the selection training of 0.8% yeast
Support base SD-Ura-Trp-Leu-His, 2% glucose, 0.01%Trp. and 0.01%Ura.) in 30 DEG C, 250rpm culture
16h prepares seed liquor, and seed liquor is inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 2 with 1% inoculum concentration
In, 30 DEG C, 250rpm shaken cultivation 6 days, obtain BY-OA-UA fermentation liquid.
Respectively solid selection medium 3 (solid selection medium 3 is made of solute and solvent, and solvent is water, solute and
Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose and agar
Powder) in activation step 2 BY-OA-MAA45 and BY-OA-pRS313-TRP, be then inoculated in liquid selective medium 3 respectively
(liquid selective medium 3 is made of solute and solvent, and solvent is water, and solute and its mass percent concentration are respectively as follows: 0.8%
Yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose) in 30 DEG C, 250rpm cultivates 16h and prepares seed liquor,
Seed liquor is inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 3 with 1% inoculum concentration, 30 DEG C, 250rpm vibration
Culture 6 days is swung, BY-OA-MAA45 fermentation liquid and BY-OA-pRS313-TRP fermentation liquid are respectively obtained.
Respectively solid selection medium 4 (solid selection medium 4 is made of solute and solvent, and solvent is water, solute and
Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Trp-Leu-His, 2% glucose and agar powder) in
The BY-OA-UA-MAA45 and BY-OA-UA-pRS313-TRP of activation step 2, are then inoculated in liquid selective medium 4 respectively
(liquid selective medium 4 is made of solute and solvent, and solvent is water, and solute and its mass percent concentration are respectively as follows: 0.8%
Yeast Selective agar medium SD-Trp-Leu-His, 2% glucose) in 30 DEG C, 250rpm cultivates 16h and prepares seed liquor, will plant
Sub- liquid is inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 4 with 1% inoculum concentration, and 30 DEG C, 250rpm oscillation training
It supports 6 days, respectively obtains 4BY-OA-UA-MAA45 fermentation liquid and BY-OA-UA-pRS313-TRP fermentation liquid.
3.2 compounds extract:
The compound in six kinds of fermentation liquids in extraction step 3.1 is distinguished as follows:
Take the BY-OA-MAA45 fermentation liquid of 6mL step 3.1 in broken pipe, 13000rpm is centrifuged 1min, abandons supernatant；
After precipitating sterile water wash, 13000rpm is centrifuged 1min, abandons supernatant；Into precipitating be added bead (diameter 0.5mm) and
1ml extract liquor (extract liquor is made of methanol and acetone, and the volume ratio of methanol and acetone is 1:1), shakes broken 5min, ultrasound is broken
Broken 30min, 13000rpm are centrifuged 2min, abandon precipitating, supernatant is crossed 0.22 μm of organic filter membrane and obtains solution into liquid phase bottle, will
The solution its be named as BY-OA-MAA45 solution.
According to the method described above, BY-OA-MAA45 fermentation liquid is replaced with into BY-OA-UA-MAA45 fermentation liquid, other steps are equal
It is constant, solution is obtained, BY-OA-UA-MAA45 solution is named as.
According to the method described above, BY-OA-MAA45 fermentation liquid is replaced with into BY-OA fermentation liquid, BY-OA-pRS313- respectively
TRP fermentation liquid, BY-OA-UA fermentation liquid and BY-OA-UA-pRS313-TRP fermentation liquid, other steps are constant, respectively obtain
BY-OA solution, BY-OA-pRS313-TRP solution, BY-OA-UA solution and BY-OA-UA-pRS313-TRP solution.
3.3LC-MS qualitative analysis:
LC-MS qualitative analysis is carried out to six kinds of solution in step 3.2 respectively as follows, standard items are hawthorn acid
(Shanghai Yuan Ye Biotechnology Co., Ltd) and Corosolic acid (Shanghai Yuan Ye Biotechnology Co., Ltd):
Instrument: liquid chromatography-tandem mass spectrometry (LC-MS) instrument, by 1200 high performance liquid chromatograph of Agilent and Bruker-
MicrOTOF-II mass spectrograph composition；MicroOTOF control version 3.0/Data Anays is Version 4.0
Data collection and precessing system.
LC condition: DAD detector, Detection wavelength 203nm, WatersC18 chromatographic column (250mm ×
4.6mm, 5 μm), mobile phase A is 0.1% ammonium acetate, and Mobile phase B is acetonitrile, gradient elution, flow velocity 1mL/min, 30 DEG C of column temperature.
Type of elution is as follows:
The concentration of volume percent of 0~35min (including 35min) mobile phase A is 35%, the percent by volume of Mobile phase B
Concentration is 65%；
The concentration of volume percent of 35~36min (including 36min) Mobile phase B is 100%；
The concentration of volume percent of 36~40min (including 40min) Mobile phase B is 100%；
The concentration of volume percent of 40~41min (including 41min) mobile phase A is 35%, the percent by volume of Mobile phase B
Concentration is 65%；
The concentration of volume percent of 41~45min mobile phase A is 35%, and the concentration of volume percent of Mobile phase B is 65%.
MS condition: electrospray ionisation source negative ion mode (ESI-), spray voltage (- 4.5kV), atomization gas flow (6L/
Min), atomizer temperature (180 DEG C), collision gas are nitrogen, pressure 1.0Bar, data acquiring frequency 1.0HZ: collision energy is
8.0eV。
As a result (Fig. 1) has found, hawthorn acid, BY-OA solution and BY-OA-pRS313-TRP are contained in BY-OA-MAA45 solution
Without containing hawthorn acid in solution.In Fig. 1, A figure is LC-MS as a result, Standard+BY-OA is that mountain is added into BY-OA solution
The LC-MS of short, bristly hair or beard acid and Corosolic acid is as a result, BY-OA is the LC-MS of BY-OA solution as a result, BY-OA-MAA45 is BY-OA-
The LC-MS of MAA45 solution is as a result, Maslinic acid indicates that hawthorn acid, Corosolic acid indicate Corosolic acid；B figure is
Under negative ion mode, there is identical high-resolution simultaneously in sample BY-OA-MAA45 and positive control sample Standard+BY-OA
Rate hawthorn acid mass ions peak figure.
As a result (Fig. 2) has found, containing hawthorn acid and Corosolic acid in BY-OA-UA-MAA45 solution, BY-OA-UA solution and
Without containing hawthorn acid and Corosolic acid in BY-OA-UA-pRS313-TRP solution.In Fig. 2, A figure be LC-MS as a result,
Standard+BY-OA-UA is that the LC-MS of hawthorn acid and Corosolic acid is added into BY-OA-UA solution as a result, BY-OA-UA is
The LC-MS of BY-OA-UA solution as a result, BY-OA-UA-MAA45 be the LC-MS of BY-OA-UA-MAA45 solution as a result,
Maslinic acid indicates that hawthorn acid, Corosolic acid indicate Corosolic acid；B figure is sample BY- under negative ion mode
There is identical high-resolution Corosolic acid mass spectrum simultaneously in OA-UA-MAA45 and positive control sample Standard+BY-OA-UA
Ion peak figure.
Show that the MAA45 channel genes that will be cloned from hawthorn can produce the S. cervisiae of oleanolic acid (OA)
After BY-OA, recombinant bacterium can produce hawthorn acid；MAA45 channel genes be can produce into oleanolic acid (OA) and malol (UA)
After in S. cervisiae BY-OA-UA, recombinant bacterium can produce hawthorn acid and Corosolic acid, and do not import the gene BY-OA and
BY-OA-UA cannot generate hawthorn acid and Corosolic acid, show that MAA45 can prepare hawthorn by substrate of oleanolic acid
Acid can also prepare Corosolic acid by substrate of malol.Since oleanolic acid (formula 4) and malol (formula 5) is triterpene
Object is closed, oleanolic acid is β-botany bar gum (β-Amyrin) type, and malol is α-botany bar gum (α-Amyrin) type, with oleanolic acid phase
Than hawthorn acid is that the product that α-hydroxylation obtains only occurs at oleanolic acid 2, and compared with malol, Corosolic acid is only in crow
The product that α-hydroxylation obtains occurs for rope acid 2, shows that MAA45 is 2 α-hydroxylases of triterpene.
Claims (10)
1. protein is the protein that amino acid sequence is sequence 1 in sequence table.
2. biomaterial relevant to protein described in claim 1, the biomaterial is following B1) appointing into B4)
It is a kind of:
B1 the nucleic acid molecules of protein described in claim 1) are encoded；
B2) contain B1) recombinant vectors of the nucleic acid molecules；
B3) contain B1) recombinant microorganisms of the nucleic acid molecules；
B4) contain B2) recombinant microorganism of the recombinant vector.
3. biomaterial according to claim 2, it is characterised in that: the nucleic acid molecules are that coded sequence is in sequence table
795-2225 cDNA molecules of sequence 2.
4. biomaterial according to claim 2 or 3, it is characterised in that: the recombinant microorganism is by the B1) nucleic acid
Molecule imports saccharomyces cerevisiaeSaccharomyces cerevisiaeThe recombination of protein described in obtained expression claim 1 is micro-
Biology.
5. the preparation method of protein described in claim 1, comprising: coding base of the culture containing protein described in claim 1
The recombinant microorganism of the recombinant vector of cause expresses the encoding gene of protein described in claim 1, obtains expressing the albumen
The recombinant microorganism culture of matter；The protein is obtained from the recombinant microorganism culture.
6. the preparation method of hawthorn acid and/or Corosolic acid, including using oleanolic acid and/or malol as substrate claim
Protein described in 1 carries out catalysis reaction and obtains hawthorn acid and/or Corosolic acid.
7. the preparation method of hawthorn acid and/or Corosolic acid, comprising: by the encoding gene containing protein described in claim 1
Expression cassette import and can generate in the receptor biological cell of oleanolic acid and/or malol, obtain recombination biological cell；Culture institute
Recombination biological cell is stated, the encoding gene of protein described in claim 1 is expressed, obtains the cell training for expressing the protein
Support object；Hawthorn acid and/or Corosolic acid are obtained from the cell culture of the expression protein.
8. method according to claim 7, it is characterised in that: the encoding gene of protein described in claim 1 is wanted for right
B1 in asking any in 2-4) nucleic acid molecules.
9. 2 α of triterpene-hydroxylation enzyme preparation include any biology in protein or claim 2-4 described in claim 1
Material.
10. following any applications:
Protein described in X1, claim 1 is as the application in 2 α-hydroxylases of triterpene；2 α-hydroxylases of the triterpene
Reaction substrate is oleanolic acid and/or malol；
Application of the protein described in X2, claim 1 in production hawthorn acid and/or Corosolic acid；
Any biomaterial is preparing the application in 2 α-hydroxylases of triterpene in X3, claim 2-4；The triterpene 2
α-hydroxylase reaction substrate is oleanolic acid and/or malol；
Application of any biomaterial in production hawthorn acid and/or Corosolic acid in X4, claim 2-4；
X5, claim 5 the method are preparing the application in 2 α-hydroxylases of triterpene；2 α-hydroxylases of the triterpene are anti-
Answering substrate is oleanolic acid and/or malol；
Application of the preparation described in X6, claim 9 in production hawthorn acid and/or Corosolic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610236283.9A CN105802926B (en) | 2016-04-14 | 2016-04-14 | 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610236283.9A CN105802926B (en) | 2016-04-14 | 2016-04-14 | 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802926A CN105802926A (en) | 2016-07-27 |
| CN105802926B true CN105802926B (en) | 2019-02-26 |
Family
ID=56460966
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610236283.9A Active CN105802926B (en) | 2016-04-14 | 2016-04-14 | 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802926B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109112116A (en) * | 2017-06-26 | 2019-01-01 | 中国科学院天津工业生物技术研究所 | Albumen from centella and the application in preparation hawthorn acid and Corosolic acid |
| CN110438099B (en) * | 2018-05-04 | 2022-04-15 | 中国科学院天津工业生物技术研究所 | Application of glycosyltransferase and related materials thereof in construction of engineering bacteria for producing ginsenosides Rb1 and Rg1 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105418721A (en) * | 2015-11-05 | 2016-03-23 | 沈阳化工大学 | Oleanolic acid chemical modifier with antitumor activity and preparation method thereof |
-
2016
- 2016-04-14 CN CN201610236283.9A patent/CN105802926B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105418721A (en) * | 2015-11-05 | 2016-03-23 | 沈阳化工大学 | Oleanolic acid chemical modifier with antitumor activity and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 应用色谱/质谱联用方法分析霉菌单加氧酶羟基化齐敦果酸体系;屠春燕等;《分析试验室》;20071231;第26卷;第160-162页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802926A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110438099B (en) | Application of glycosyltransferase and related materials thereof in construction of engineering bacteria for producing ginsenosides Rb1 and Rg1 | |
| CN109097343B (en) | Steroid 11 beta-hydroxylase in curvularia lunata as well as coding gene and application thereof | |
| CN106148256B (en) | The genetic engineering bacterium and its construction method of production alpha-arbutin and application | |
| CN106367361A (en) | Saccharomyces cerevisiae engineering strain as well as construction method and application thereof | |
| CN106929439B (en) | Recombinant saccharomyces cerevisiae and construction method and application thereof | |
| CN102174420A (en) | Genetic engineering bacteria for producing high-purity cephalosporin C and application thereof | |
| CN107586795A (en) | A kind of method of fermentation by saccharomyces cerevisiae production phloretin | |
| CN110382684A (en) | Generate the plum surprise yeast kind of xylitol | |
| CN113755354A (en) | Recombinant saccharomyces cerevisiae for producing gastrodin by using glucose and application thereof | |
| CN105802926B (en) | 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application | |
| CN114591923B (en) | Cannabidiol synthetase mutant and construction method and application thereof | |
| CN115851810A (en) | Engineering strain for de novo synthesis of naringenin by saccharomyces cerevisiae and construction method and application thereof | |
| CN112852763B (en) | Application of Pn3-32-i5 protein and coding gene thereof in production of notoginsenoside R1 | |
| CN109097342A (en) | Mould middle 11 B-hydroxylase of steroid of Absidia and its encoding gene and application | |
| CN111334522B (en) | Recombinant saccharomyces cerevisiae for producing ambergris alcohol and construction method | |
| CN105647958B (en) | Saccharomyces cerevisiae engineering bacterium for producing 2-phenylethyl alcohol and preparation method and application thereof | |
| CN114807211B (en) | Recombinant saccharomyces cerevisiae for producing ginsenoside CK by metabolizing glycerol and construction method | |
| CN115161208B (en) | Saccharomyces cerevisiae genetically engineered bacterium and application thereof in production of cucurbitacin intermediate | |
| CN106701800B (en) | A kind of Aureobasidium pullulans polyketide synthases gene and its application | |
| CN107903227B (en) | Succinic anhydride compound, gene and protein related to succinic anhydride compound and preparation method of succinic anhydride compound | |
| CN112574981B (en) | Taraxasterol synthase, gene for coding taraxasterol synthase and preparation and application thereof | |
| US20220348691A1 (en) | Blumea Balsamifera Monoterpene Synthase BBTPS3 And Related Biological Materials Thereof and Use Thereof | |
| CN108690822B (en) | Genetically engineered bacterium for producing protopanoxadiol and method thereof | |
| CN114672510B (en) | Method for preparing L-tryptophan-L-alanine cyclic dipeptide by utilizing aspergillus oryzae | |
| CN111647589A (en) | Euphorbia dienol synthase and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |