CN105802926A - Triterpene-2-alpha-hydroxylase MAA45, related biological materials thereof and application of triterpene two-bit alpha-hydroxylase MAA45 and related biological materials in preparing maslinic acid and corosolic acid - Google Patents
Triterpene-2-alpha-hydroxylase MAA45, related biological materials thereof and application of triterpene two-bit alpha-hydroxylase MAA45 and related biological materials in preparing maslinic acid and corosolic acid Download PDFInfo
- Publication number
- CN105802926A CN105802926A CN201610236283.9A CN201610236283A CN105802926A CN 105802926 A CN105802926 A CN 105802926A CN 201610236283 A CN201610236283 A CN 201610236283A CN 105802926 A CN105802926 A CN 105802926A
- Authority
- CN
- China
- Prior art keywords
- acid
- protein
- maa45
- sequence
- hydroxylase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/06—Hydroxylating
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses triterpene-2-alpha-hydroxylase MAA45, related biological materials thereof and application of the triterpene two-bit alpha-hydroxylase MAA45 and the related biological materials in preparing maslinic acid and corosolic acid. The triterpene two-bit alpha-hydroxylase MAA45 is the following protein shown as A1), or A2) or A3), wherein A1) represents protein with an amino acid sequence being the sequence 1 in a sequence table, A2) represents protein which has the same function and is obtained by substituting or missing or adding one or more amino acid residues to the amino acid sequence shown in the sequence 1, and A3) represents fused protein obtained by connecting labels to the N terminal or/and C terminal of A1) or A2). It is proved through experiments that maslinic acid can be prepared from MAA45 with oleanolic acid as a substrate, corosolic acid can be prepared from MAA45 with ursonic acid as a substrate, MAA45 and coding genes thereof can be used for preparing maslinic acid and corosolic acid, and MAA45 can be used for catalyzing triterpene two-bit alpha-hydroxylation.
Description
Technical field
The present invention relates in biological technical field 2 α of triterpene-hydroxylase MAA45 and relevant biological material thereof and they
Application in preparing Crataegolic acid and Corosolic acid.
Background technology
Crataegolic acid (Maslinic acid) (formula 1), Corosolic acid (Corosolic acid) (formula 2) and Herba Centellae
Acid (Asiatic acid) (formula 3) etc. be 2 α-be hydroxylated medicinal triterpenes active component of representative be all Fructus Crataegi
(Crataegus pinnatifida Bunge), Folium Eriobotryae (Eriobotrya japonica), Flos Caryophylli Lagerstroemia indica L.
(Lagerstroemia speciosa (L.) Pers.) and Herba Centellae (Centella asiatica (L.) Urb.)
Etc. the trace secondary metabolites of medicinal plants self synthesis, Crataegolic acid and Corosolic acid are Pentacyclic triterpenic acid, belong to
β-XIANGSHU epoxy-type or α-XIANGSHU epoxy-type pentacyclic triterpenoid, Crataegolic acid and Corosolic acid are isomers, are planting
In object, the two exists the most jointly.Crataegolic acid, Corosolic acid and asiatic acid anticancer, anti AIDS virus, beautiful
The fields such as appearance and liver protecting are widely used, and commercially circulate as supplementary or cosmetics.At present this
Compounds is mainly separation and Extraction from Fructus Crataegi, the plant such as Flos Caryophylli Lagerstroemia indica L., Folium Eriobotryae and obtains, but this method has more
Shortcoming, including content is low and difference big, purifying products is difficult, and plant growing cycle is long, the wildest to living resources
Resource does great damage.
Currently with the principle of synthetic biology, design and transform microbial strains and recognize to produce the natural product Yi Bei world
For being a kind of most potential method, reach as produced the precursor Ramulus et folium taxi cuspidatae diene of paclitaxel in escherichia coli
1000mg/L(Parayil Kumaran Ajikumar et al.,2010,Science,330:70-74)；Semen Ginkgo
Lactone (Ginkgolides) precursor sinistral corean pine diene (Levopimaradiene), improved escherichia coli
Engineering bacteria reaches 700mg/L yield (Effendi Leonard et al., 2010, PNAS, 107 (31):
13654–13659)；The precursor artelinic acid of arteannuin (Artemisinin) is produced in Yeast engineering bacteria
(Artemisinic acid) up to 25g/L (Paddon CJ et al., 2013, Nature, 2013,496:
528-532)；The most domestic in arteannuin, paclitaxel, the biosynthesis side of the drug molecule such as ginsenoside and TANSHINONES
There is correlational study in face.
But, natural drug biosynthetic process is that the application synthesising biological founder's work cell factory that learns a skill is sent out clearly
The premise of ferment productive target compound.Existing related developments in terms of the biosynthesis pathway research of triterpenoid at present,
Including forming the cyclization enzyme of each triterpene basic framework and carrying out 6-, 11-, 16-, 22-, 23-on basic framework,
The P450 enzyme of 24-, 28-oxidation, but also do not excavate at 2 enzymes (a kind of P450 enzyme) that α-hydroxylation occurs.
Summary of the invention
The technical problem to be solved is how to prepare Crataegolic acid and/or Corosolic acid.
For solving above-mentioned technical problem, present invention firstly provides a kind of protein with hydroxylase function, its title
For Crataegolic acid/Corosolic acid associated protein (MAA45), MAA45 is following A1), A2) or A3):
A1) protein of sequence 1 during aminoacid sequence is sequence table；
A2) by shown in sequence in sequence table 1 aminoacid sequence through one or several amino acid residue replacement and/
Or lack and/or add and have the protein of identical function；
A3) at A1) or N end A2) or/and C end connects the fused protein that label obtains.
Wherein, sequence 1 is made up of 476 amino acid residues.
In order to make A1) in protein be easy to purification, can in by sequence table the aminoacid sequence shown in sequence 1
The amino terminal of the protein of row composition or carboxyl terminal connect upper label as shown in table 1.
Table 1, the sequence of label
| Label | Residue | Sequence |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned A2) in MAA45 protein, one or the replacement of several amino acid residue and/or disappearance and/or
It is added to less than the replacement of 10 amino acid residues and/or disappearance and/or interpolation.
Above-mentioned A2) in MAA45 protein can synthetic, it is possible to first synthesize its encoding gene, then carry out biological table
Reach.
Above-mentioned A2) in the encoding gene of MAA45 protein can be by by shown in the 795-2225 position of sequence 2
DNA sequence lacks the codon of one or several amino acid residue, and/or carries out the missense of one or several base pair
Sudden change, and/or hold the coded sequence connecting the label shown in table 1 to obtain at its 5 ' end and/or 3 '.
For solving above-mentioned technical problem, present invention also offers the biomaterial relevant to MAA45, described biomaterial
For following B1) to B10) in any one:
B1) nucleic acid molecules of MAA45 is encoded；
B2) containing B1) expression cassette of described nucleic acid molecules；
B3) containing B1) recombinant vector of described nucleic acid molecules；
B4) containing B2) recombinant vector of described expression cassette；
B5) containing B1) recombinant microorganism of described nucleic acid molecules；
B6) containing B2) recombinant microorganism of described expression cassette；
B7) containing B3) recombinant microorganism of described recombinant vector；
B8) containing B4) recombinant microorganism of described recombinant vector；
B9) containing B1) transgenic cell line of described nucleic acid molecules；
B10) containing B2) transgenic cell line of described expression cassette.
In above-mentioned biomaterial, B1) described nucleic acid molecules can be for following 1) or 2) or 3) shown in nucleic acid molecules:
1) the cDNA molecule of the 795-2225 position of sequence 2 or DNA molecular during coded sequence is sequence table；
2) with 1) nucleotide sequence that limits has 75% or more than 75% homogeneity, and the cDNA of coding MAA45 divides
Son or genomic DNA molecule；
3) under strict conditions with 1) nucleotide sequence hybridization that limits, and the cDNA molecule of coding MAA45 or base
Because of group DNA molecular；
B2) described expression cassette can be for the DNA molecular shown in the 7-2450 position of sequence in sequence table 2.
Wherein, described nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；Described nucleic acid divides
Son can also be RNA, such as mRNA or hnRNA etc..
Wherein, the 1-6 position of sequence 2 and 2541-2546 position are the recognition sequence of SacII, sequence 2
7-787 position is the sequence of PGK1 promoter, the recognition sequence that 788-794 position is SexA of sequence 2, sequence
The sequence that 795-2225 position is MAA45 gene of row 2, the MAA45 shown in coded sequence 1, the of sequence 2
2226-2233 position is the recognition sequence of AscI, the sequence that 2234-2540 position is CYC1t terminator of sequence 2.
Those of ordinary skill in the art can use the side of known method, such as orthogenesis and point mutation easily
Method, the nucleotide sequence that the present invention encodes MAA45 suddenlys change.Those are through manually modified, have and this
The nucleotide sequence 75% of the MAA45 of invention isolated or the nucleotide of higher homogeneity, if coding MAA45
And there is MAA45 function, all it is derived from the nucleotide sequence of the present invention and is equal to the sequence of the present invention.
Term used herein " homogeneity " refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this
The nucleotide sequence of protein of the composition of the aminoacid sequence shown in coded sequence 1 of invention has 75% or higher, or
85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or
Computer software is evaluated.Using computer software, the homogeneity between two or more sequences can use percentage ratio
(%) representing, it can be used to the homogeneity evaluating between correlated series.
In above-mentioned biomaterial, described stringent condition is at 2 × SSC, in the solution of 0.1%SDS, miscellaneous at 68 DEG C
Hand over and wash film 2 times, each 5min, again in 0.5 × SSC, in the solution of 0.1%SDS, hybridize at 68 DEG C and wash
Film 2 times, each 15min；Or, 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution in, 65 DEG C of bars
Hybridize under part and wash film.
Above-mentioned 75% or more than 75% homogeneity, can be the homogeneity of 80%, 85%, 90% or more than 95%.
In above-mentioned biomaterial, B2) described in expression cassette (the MAA45 gene of the nucleic acid molecules containing coding MAA45
Expression cassette), refer to express the DNA of MAA45, this DNA in host cell and not only can include starting MAA45 base
Because of the promoter transcribed, may also include the terminator terminating MAA45 genetic transcription.Further, described expression cassette also may be used
Including enhancer sequence.In one embodiment of the invention, B2) described expression cassette is specially sequence 2 in sequence table
The DNA molecular shown in 7-2540 position.
Available existing vector construction contains the recombinant vector of described MAA45 expression casette.
In above-mentioned biomaterial, described carrier can be plasmid, glutinous grain, phage or viral vector.Described plasmid is concrete
Can be pRS313 or pRS314, or pRS313 or pRS314 is transformed the carrier obtained.
B3) described recombinant vector can the DNA for encoding MAA45 shown in the 795-2225 position containing sequence 2
Sequence.Recombinant vector described further concretely pRS313-TRP-PGK1-MAA45-CYC1t or
pRS313-HIS-PGK1-MAA45-CYC1t.Described pRS313-HIS-PGK1-MAA45-CYC1t is at carrier
Between the recognition sequence of the SacII of pRS313, the DNA fragmentation shown in 7-2540 position of insertion sequence 2, obtains
Recombinant vector.Described pRS313-TRP-PGK1-MAA45-CYC1t is by described
In pRS313-HIS-PGK1-MAA45-CYC1t, the DNA fragmentation containing HIS between sequence 3 and sequence 4 replaces with
The recombinant vector that in carrier pRS314, the DNA fragmentation containing TRP between sequence 5 and sequence 6 obtains.
In above-mentioned biomaterial, described microorganism can be yeast, antibacterial, algae or fungus.Wherein, yeast can be wine brewing
Yeast Saccharomyces cerevisiae, such as Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-OA
Or Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-OA-UA.
In above-mentioned biomaterial, described recombinant microorganism can be by B1) described nucleic acid molecules importing saccharomyces cerevisiae
The recombinant microorganism of the expression MAA45 that Saccharomyces cerevisiae obtains, as will be described
PRS313-TRP-PGK1-MAA45-CYC1t import Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-OA or
Recombinant bacterium BY-OA-MAA45 that Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-UA obtains or recombinant bacterium
BY-OA-UA-MAA45。
In above-mentioned biomaterial, described transgenic cell line does not include propagating materials.
For solving above-mentioned technical problem, present invention also offers the preparation method of MAA45, described method includes: cultivate
The recombinant microorganism of the expression cassette of the encoding gene containing MAA45, makes the encoding gene of MAA45 express, is expressed
The recombinant microorganism culture of MAA45；Described protein is obtained from described recombinant microorganism culture.
In the preparation method of above-mentioned MAA45, the encoding gene of described MAA45 can be B1 in above-mentioned biomaterial) described
Nucleic acid molecules.
In the preparation method of above-mentioned MAA45, the expression cassette of the described encoding gene containing MAA45 can be above-mentioned biological material
B2 in material) described expression cassette.
In the preparation method of above-mentioned MAA45, described recombinant microorganism can be recombinant microorganism described in above-mentioned biomaterial.
For solving above-mentioned technical problem, present invention also offers the preparation method of Crataegolic acid and/or Corosolic acid, described side
Method includes that carrying out catalytic reaction with oleanolic acid and/or maloic acid for substrate MAA45 obtains Crataegolic acid and/or koroso
Acid.
For solving above-mentioned technical problem, present invention also offers the preparation method of Crataegolic acid and/or Corosolic acid, by the party
The named method of method 1, described method 1 includes: is imported by the expression cassette of the encoding gene containing MAA45 and can produce together
In the receptor biological cell of pier fruit acid and/or maloic acid, obtain biological cell of recombinating；Cultivate described restructuring biological cell,
The encoding gene making MAA45 is expressed, and obtains expressing the cell culture of MAA45；Cell from described expression MAA45
Culture obtains Crataegolic acid and/or Corosolic acid；Described receptor biological cell is microbial cell, plant cell or non-
People's zooblast.
In said method 1, the encoding gene of described MAA45 can be B1 in described biomaterial) described nucleic acid molecules.
In said method 1, the expression cassette of the described encoding gene containing MAA45 can be for B2 in described biomaterial) institute
State expression cassette.
In said method 1, described receptor biological cell can be can be yeast, antibacterial, algae or fungus.Wherein, yeast
Can be Saccharomyces Cerevisiae in S accharomyces cerevisiae, such as Saccharomyces Cerevisiae in S accharomyces cerevisiae
BY-OA or described Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-UA.
In one embodiment of the invention, described restructuring biological cell is by described
PRS313-TRP-PGK1-MAA45-CYC1t imports described Saccharomyces Cerevisiae in S accharomyces cerevisiae
The recombinant bacterium that BY-OA or described Saccharomyces Cerevisiae in S accharomyces cerevisiae BY-UA obtains
BY-OA-MAA45 or recombinant bacterium BY-OA-UA-MAA45.
In said method 1, described method may also include and removes in the described mixture containing Crataegolic acid and/or Corosolic acid
Impurity obtain Crataegolic acid and/or Corosolic acid.
For solving above-mentioned technical problem, present invention also offers hydroxylase preparation or 2 α of triterpene-hydroxylase preparation, institute
State hydroxylase preparation or 2 α of described triterpene-hydroxylase preparation contains MAA45 or described biomaterial.
Described hydroxylase preparation or 2 α of described triterpene-hydroxylase preparation can only using MAA45 or described biomaterial as
Its active component, it is also possible to MAA45 or described biomaterial has hydroxylase with other or 2 α of triterpene-hydroxylase is lived
The material of property is collectively as its active component.
For solving above-mentioned technical problem, present invention also offers following arbitrary application:
X1, MAA45 are as the application in hydroxylase or 2 α-hydroxylases of triterpene；
X2, MAA45 application in preparing hydroxylase product or 2 α of triterpene-hydroxylase product；
X3, MAA45 application in producing Crataegolic acid and/or Corosolic acid；
X4, MAA45 application in degraded oleanolic acid and/or maloic acid；
The application in preparing hydroxylase or 2 α-hydroxylases of triterpene of X5, described biomaterial；
The application in preparing hydroxylase product or 2 α of triterpene-hydroxylase product of X6, described biomaterial；
The application in producing Crataegolic acid and/or Corosolic acid of X7, described biomaterial；
The application in degraded oleanolic acid and/or maloic acid of X8, described biomaterial；
X9, the preparation method application in preparing hydroxylase or 2 α-hydroxylases of triterpene of described MAA45；
X10, preparation method the answering in preparing hydroxylase product or 2 α of triterpene-hydroxylase product of described MAA45
With；
The application in degraded oleanolic acid and/or maloic acid of the preparation method of X11, described Crataegolic acid and/or Corosolic acid；
X12, described hydroxylase preparation or 2 α of described triterpene-hydroxylase preparation are producing Crataegolic acid and/or Corosolic acid
In application；
X13, described hydroxylase preparation or 2 α of described triterpene-hydroxylase preparation are at degraded oleanolic acid and/or maloic acid
In application.
The present invention can produce the saccharomyces cerevisiae of oleanolic acid (OA) by cloning the MAA45 channel genes obtained from Fructus Crataegi
After, recombinant bacterium can produce Crataegolic acid；MAA45 channel genes can be produced oleanolic acid (OA) and maloic acid (UA)
After in saccharomyces cerevisiae, recombinant bacterium can produce Crataegolic acid and Corosolic acid, and the bacterial strain not importing this gene all can not
To produce Crataegolic acid and Corosolic acid, showing, MAA45 can prepare Crataegolic acid with oleanolic acid for substrate, it is also possible to
Corosolic acid is prepared for substrate with maloic acid.Owing to oleanolic acid (formula 4) and maloic acid (formula 5) are triterpenoid,
Oleanolic acid is β-balsam (β-Amyrin) type, and maloic acid is α-balsam (α-Amyrin) type, and together
Pier fruit acid is compared, and Crataegolic acid is the product only occurring α-hydroxylation to obtain oleanolic acid 2, compared with maloic acid,
Corosolic acid is the product only occurring α-hydroxylation to obtain maloic acid 2, shows, MAA45 is 2 α-hydroxyls of triterpene
Change enzyme.It is demonstrated experimentally that MAA45 and encoding gene thereof can be utilized to prepare Crataegolic acid and Corosolic acid, it is also possible to profit
It is catalyzed 2 α-hydroxylations of triterpene with MAA45.
Accompanying drawing explanation
Fig. 1 is the LC-MS analysis result of BY-OA-MAA45 solution.
Fig. 2 is the LC-MS analysis result of BY-OA-UA-MAA45 solution.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention is further described in detail, the embodiment be given only for
Illustrate the present invention rather than in order to limit the scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
PRS313 in following embodiment (Sikorski, R.S.and Hieter, P.1989, Genetics 122
(1): 19-27), the public can obtain from Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences.
PRS314 in following embodiment (Sikorski, R.S.and Hieter, P.1989, Genetics 122
(1): 19-27), the public can obtain from Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences.
Embodiment 1, MAA45 can be used to prepare Crataegolic acid and Corosolic acid
The invention provides one and come from Fructus Crataegi (Crataegus pinnatifida Bunge) protein, its name
Being referred to as Crataegolic acid/Corosolic acid associated protein (MAA45), MAA45 can be catalyzed 2 α-hydroxylations of triterpene, belong to three
2 α-hydroxylases of terpene, the aminoacid sequence of MAA45, can be by the of sequence 2 as shown in sequence 1 in sequence table
MAA45 gene code shown in 795-2225 position.
1, the preparation of recombinant vector
Utilize restricted enzyme SacII, between the recognition sequence of the SacII of carrier pRS313 the of insertion sequence 2
DNA fragmentation shown in 7-2540 position, other sequences keeping carrier pRS313 are constant, obtain recombinant vector, should
The named pRS313-HIS-PGK1-MAA45-CYC1t of recombinant vector.
Wherein, the 1-6 position of sequence 2 and 2541-2546 position are the recognition sequence of SacII, sequence 2
7-787 position is the sequence of PGK1 promoter, the recognition sequence that 788-794 position is SexA of sequence 2, sequence
The sequence that 795-2225 position is MAA45 gene of row 2, the MAA45 shown in coded sequence 1, the of sequence 2
2226-2233 position is the recognition sequence of AscI, the sequence that 2234-2540 position is CYC1t terminator of sequence 2.
With pRS313-HIS-PGK1-MAA45-CYC1t as template, utilize primer to (V313-to-R:
CTTTGCCTTCGTTTATCTTGC (sequence 3)；V313-to-F:TATATGTATACCTATGAATGTCAG (sequence
4)) PCR amplification is carried out, the named 313-PGK1-MAA45-CYC1t of PCR primer that will obtain.With carrier pRS314
For template, utilize primer to (Bsp-TRP-F:TGGCGTCCGGAT4ACAATCTTGATCCGGAGCT (sequence 5)；
Bsp-TRP-R:TGGCGTCCGGACACAAACAATACTTAAATAAATAC (sequence 6)) carry out PCR amplification, will
The named TRP of PCR primer obtained.313-PGK1-MAA45-CYC1t Yu TRP is carried out blunt end cloning, obtains
Recombinant vector, by the named pRS313-TRP-PGK1-MAA45-CYC1t of recombinant vector correct for sequence.With
PRS313-HIS-PGK1-MAA45-CYC1t compares, and pRS313-TRP-PGK1-MAA45-CYC1t is only will
In pRS313-HIS-PGK1-MAA45-CYC1t primer between (V313-to-R and V313-to-F) containing HIS's
DNA fragmentation replaces with in carrier pRS314 primer to the DNA containing TRP between (Bsp-TRP-F and Bsp-TRP-R)
The recombinant vector that fragment obtains.
With pRS313 as template, utilize primer that (V313-to-R and V313-to-F) is carried out PCR amplification, will
The PCR primer named 313 obtained.Carry out blunt end cloning by 313 with above-mentioned TRP, obtain recombinant vector,
By the named pRS313-TRP of recombinant vector correct for sequence.Compared with pRS313, pRS313-TRP is only will
In pRS313, primer replaces with carrier to the DNA fragmentation containing HIS between (V313-to-R and V313-to-F)
The restructuring that in pRS314, the DNA fragmentation containing TRP between (Bsp-TRP-F and Bsp-TRP-R) is obtained by primer
Carrier.
2, the preparation of recombinant bacterium
The pRS313-TRP-PGK1-MAA45-CYC1t of step 1 is imported the bacterium saccharomyces cerevisiae that sets out
Saccharomyces cerevisiae BY-OA (is documented in Chinese patent ZL201310399947.X)；Below
It is called for short BY-OA, BY-OA can produce in oleanolic acid (OA), obtains recombinant bacterium, by named for this recombinant bacterium
BY-OA-MAA45；The pRS313-TRP of step 1 is imported in BY-OA, obtains recombinant bacterium, this recombinant bacterium is ordered
Entitled BY-OA-pRS313-TRP.
The pRS313-TRP-PGK1-MAA45-CYC1t of step 1 is imported the bacterium saccharomyces cerevisiae that sets out
(hereinafter referred to as BY-OA-UA, BY-OA-UA can produce ursol to Saccharomyces cerevisiae BY-UA
Acid (UA)) in, obtain recombinant bacterium, by named for this recombinant bacterium BY-OA-UA-MAA45；By step 1
PRS313-TRP imports in BY-OA-UA, obtains recombinant bacterium, by named for this recombinant bacterium
BY-OA-UA-pRS313-TRP。
Wherein, BY-OA-UA is prepared according to following 2.1-2.3:
The plasmid construction of 2.1 Genetic elements
(1) structure of pM2-aAS plasmid
With SexA1 and Asc1 respectively to p-aAS (company synthesizes, and its sequence is sequence 7 in sequence table) and plasmid
PM2-tHMG1 (being documented in Chinese patent ZL201310399947.X) carries out double digestion；Rubber tapping purification mesh respectively
Gene aAS and carrier segments pM2 (about 4kb), and be simultaneously introduced linked system (each 50ng): 2 μ l 10XT4
Ligation Buffer (NEB company), 1 μ l T4 ligase (NEB company, 400,000 cohesive end
Units/ml), supplementary distilled water is to 20 μ l, and room temperature reaction obtains connecting product for 2 hours, converts, sequence verification,
By the named pM2-aAS of carrier correct for the sequence obtained.
(2)pM4-CYP15
With SexA1 and Asc1 respectively to p-CYP15 (company synthesizes, and its sequence is sequence 8 in sequence table) and matter
Grain pM11-AtCPR1 (being documented in Chinese patent ZL201310399947.X) carries out double digestion；Tap rubber respectively pure
Change genes of interest CYP15 and carrier segments pM4 (about 4kb), and be simultaneously introduced linked system (each 50ng): 2 μ l
10XT4 ligation Buffer (NEB company), 1 μ l T4 ligase (NEB company, 400,000 cohesive
End units/ml), supplementary distilled water is to 20 μ l, and room temperature reaction obtains connecting product for 2 hours, converts, order-checking
Checking, by the named pM4-CYP15 of carrier correct for the sequence that obtains.
(3)pM3-ljCPR
With SexA1 and Asc1 respectively to p-LjCPR (company synthesizes, and its sequence is sequence 9 in sequence table) and plasmid
PM3-ERG9 (being documented in Chinese patent application 201210453416.X) carries out double digestion；Tap rubber respectively purification
Genes of interest ljCPR and carrier segments pM3 (about 4kb), and it is simultaneously introduced linked system (each 50ng): 2 μ l 10XT4
Ligation Buffer (NEB company), 1 μ l T4 ligase (NEB company, 400,000 cohesive end
Units/ml), supplementary distilled water is to 20 μ l, and room temperature reaction obtains connecting product for 2 hours, converts, sequence verification,
By the named pM3-ljCPR of carrier correct for the sequence obtained.
The structure of 2.2BY-T3
Respectively with primer table 2 describe pcr template (pTrp-HIS, pEHIS-ERG20, pM11-ERG1 and
PM3-ERG9 is all documented in Chinese patent application 201210453416.X) and primer carry out PCR obtain function mould
Block: M1 (Trp-HIS-up), M2 (PPGK1-ERG20-TADH1), M3 (PTDH3-ERG1-TTPI1), M4 (PTEF1-ERG9-TCYC1),
M5(Trp-down).Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10 μ l,
DNTP (10mM each dNTP) 1 μ l, DNA profiling 20ng, each 1 μ l, the Phusion of primer (10uM)
High-Fidelity DNA Polymerase (2.5U/ μ l) 0.5 μ l, add distilled water to cumulative volume 50 μ l.
Amplification condition is 98 DEG C of denaturations 1.5 minutes (1 circulation)；98 DEG C of degeneration 10 seconds, annealing (are moved back for 10 seconds
Fire temperature 58 DEG C), 72 DEG C extend all with 2 minutes (32 circulations)；72 DEG C extend 8 minutes (1 circulation),
Product reclaims through rubber tapping and preserves.
Primer table 2
According to the preparation method of competent cell in embodiment in Chinese patent application 201210453416.X 2,
Prepare BY-T1 competent cell, in BY-T1 competent cell, then add conversion fragment: M1,
M2, M3, M4 and M5 netic module totally 5 μ g (mol ratio=1:1:1:1:1).The culture medium of screening and culturing is:
0.8% (mass percent concentration) yeast Selective agar medium SD-His, 2% (mass percent concentration) Fructus Vitis viniferae
Sugar, 0.01% (mass percent concentration) Trp, 0.01% (mass percent concentration) Ura, 0.005% (matter
Amount percent concentration) Leu；The condition of screening and culturing is: 30 degree, cultivates more than 36h.PCR identifies sequence
Arrange correct positive colony, named bacterial strain BY-T3.
The structure of 2.3BY-UA
With the pcr template of primer table 3 description, (prDNA-Leu2 is documented in Chinese patent application respectively
In 201210453416.X) and primer carry out PCR obtain functional module: M1 ' (prDNA-Leu2-up),
M2′(PPGK1-aAS-TADH1), M3 ' (PTDH3-CYP15-TTPI1), M4 ' (PTEF1-ljCPR-TCYC1), M5 '
(prDNA-Leu2-down).Amplification system is: NewEngland Biolabs Phusion 5Xbuffer 10 μ l,
DNTP (10mM each dNTP) 1 μ l, DNA profiling 20ng, each 1 μ l, the Phusion of primer (10uM)
High-Fidelity DNA Polymerase (2.5U/ μ l) 0.5 μ l, add distilled water to cumulative volume 50 μ l.
Amplification condition is 98 DEG C of denaturations 1.5 minutes (1 circulation)；98 DEG C of degeneration 10 seconds, annealing (are moved back for 10 seconds
Fire temperature 58 DEG C), 72 DEG C extend all with 2 minutes (32 circulations)；72 DEG C extend 8 minutes (1 circulation),
Product reclaims through rubber tapping and preserves.
Primer table 3
According to the preparation method of competent cell in embodiment in Chinese patent application 201210453416.X 2,
Prepare BY-T3 competent cell, in BY-T3 competent cell, then add conversion fragment: M1 ',
M2 ', M3 ', M4 ' and M5 ' netic module totally 5 μ g (mol ratio=1:1:1:1:1).The training of screening and culturing
Foster base is: 0.8% (mass percent concentration) yeast Selective agar medium SD-Leu-His, 2% (percent mass
Specific concentration) glucose, 0.01% (mass percent concentration) Trp, 0.01% (mass percent concentration) Ura；
The condition of screening and culturing is: 30 degree, cultivates more than 36h.PCR identifies the positive colony that sequence is correct, life
Entitled bacterial strain BY-OA-UA.
3, Crataegolic acid and the preparation of Corosolic acid
3.1 shake flask fermentations:
Respectively solid selection medium 1 (solid selection medium 1 is made up of solute and solvent, and solvent is water,
Solute and mass percent concentration thereof are respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, and 2%
Glucose, 0.01%Trp. and agar powder) in activated b Y-OA, be inoculated in liquid selective medium 1 the most respectively
(liquid selective medium 1 is made up of solute and solvent, and solvent is that water, solute and mass percent concentration thereof divide
Be not: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose, 0.01%Trp.) in
30 DEG C, 250rpm cultivates 16h and prepares seed liquor, seed liquor is inoculated in the inoculum concentration of 1% and selects containing 15ml liquid
Select in the 100ml triangular flask of culture medium 1,30 DEG C, 250rpm shaken cultivation 6 days, obtain BY-OA fermentation liquid.
Respectively solid selection medium 2 (solid selection medium 2 is made up of solute and solvent, and solvent is water,
Solute and mass percent concentration thereof are respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, and 2%
Glucose, 0.01%Trp., 0.01%Ura. and agar powder) in activated b Y-OA-UA, be inoculated in liquid the most respectively
(liquid selective medium 2 is made up of body Selective agar medium 2 solute and solvent, and solvent is water, solute and matter thereof
Amount percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose,
0.01%Trp. and 0.01%Ura.) in 30 DEG C, 250rpm cultivate 16h prepare seed liquor, by seed liquor with
The inoculum concentration of 1% is inoculated in the 100ml triangular flask containing 15ml liquid selective medium 2, and 30 DEG C, 250rpm shakes
Swing cultivation 6 days, obtain BY-OA-UA fermentation liquid.
Respectively solid selection medium 3 (solid selection medium 3 is made up of solute and solvent, and solvent is water,
Solute and mass percent concentration thereof are respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, and 2%
Glucose and agar powder) in BY-OA-MAA45 and BY-OA-pRS313-TRP of activation step 2, then distinguish
(liquid selective medium 3 is made up of solute and solvent, and solvent is water, solute to be inoculated in liquid selective medium 3
And mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% Fructus Vitis viniferae
Sugar) in 30 DEG C, 250rpm cultivate 16h prepare seed liquor, seed liquor is inoculated in containing 15ml with the inoculum concentration of 1%
In the 100ml triangular flask of liquid selective medium 3,30 DEG C, 250rpm shaken cultivation 6 days, respectively obtain
BY-OA-MAA45 fermentation liquid and BY-OA-pRS313-TRP fermentation liquid.
Respectively solid selection medium 4 (solid selection medium 4 is made up of solute and solvent, and solvent is water,
Solute and mass percent concentration thereof are respectively as follows: 0.8% yeast Selective agar medium SD-Trp-Leu-His, 2% Fructus Vitis viniferae
Sugar and agar powder) in BY-OA-UA-MAA45 and BY-OA-UA-pRS313-TRP of activation step 2, then divide
(liquid selective medium 4 is made up of solute and solvent, and solvent is water, molten not to be inoculated in liquid selective medium 4
Matter and mass percent concentration thereof are respectively as follows: 0.8% yeast Selective agar medium SD-Trp-Leu-His, 2% glucose)
In in 30 DEG C, 250rpm cultivate 16h prepare seed liquor, seed liquor is inoculated in containing 15ml liquid with the inoculum concentration of 1%
In the 100ml triangular flask of body Selective agar medium 4,30 DEG C, 250rpm shaken cultivation 6 days, respectively obtain
4BY-OA-UA-MAA45 fermentation liquid and BY-OA-UA-pRS313-TRP fermentation liquid.
3.2 compounds extract:
Distinguish the compound in six kinds of fermentation liquids in extraction step 3.1 as follows:
Taking the BY-OA-MAA45 fermentation liquid of 6mL step 3.1 in broken pipe, 13000rpm is centrifuged 1min, abandons
Supernatant；After precipitation sterile water wash, 13000rpm is centrifuged 1min, abandons supernatant；Glass is added in precipitation
(extract is made up of methanol and acetone, and methanol with the volume ratio of acetone is for pearl (diameter 0.5mm) and 1ml extract
1:1), the broken 5min of concussion, ultrasonication 30min, 13000rpm are centrifuged 2min, abandon precipitation, by supernatant
Cross the 0.22 organic filter membrane of μm and obtain solution to liquid phase bottle, by its named BY-OA-MAA45 solution of this solution.
According to the method described above, BY-OA-MAA45 fermentation liquid is replaced with BY-OA-UA-MAA45 fermentation liquid, other steps
Rapid the most constant, obtain solution, by its named BY-OA-UA-MAA45 solution.
According to the method described above, BY-OA-MAA45 fermentation liquid is replaced with respectively BY-OA fermentation liquid,
BY-OA-pRS313-TRP fermentation liquid, BY-OA-UA fermentation liquid and BY-OA-UA-pRS313-TRP fermentation liquid, its
His step is the most constant, respectively obtain BY-OA solution, BY-OA-pRS313-TRP solution, BY-OA-UA solution and
BY-OA-UA-pRS313-TRP solution.
3.3LC-MS qualitative analysis:
The most respectively six kinds of solution in step 3.2 being carried out LC-MS qualitative analysis, standard substance are Fructus Crataegi
Acid (Yuan Ye bio tech ltd, Shanghai) and Corosolic acid (Yuan Ye bio tech ltd, Shanghai):
Instrument: liquid chromatography-tandem mass spectrometry (LC-MS) instrument, by Agilent 1200 high performance liquid chromatograph and
Bruker-micrOTOF-II mass spectrograph forms；MicroOTOF control version 3.0/Data Anays is
Version 4.0 Data collection and precessing system.
LC condition: DAD detector, detects wavelength 203nm, WatersC18 chromatographic column (250mm × 4.6
Mm, 5 μm), mobile phase A is 0.1% ammonium acetate, and Mobile phase B is acetonitrile, gradient elution, flow velocity 1mL/min, column temperature
30℃.Type of elution is as follows:
The concentration of volume percent of 0～35min (including 35min) mobile phase A is 35%, the percent by volume of Mobile phase B
Concentration is 65%；
The concentration of volume percent of 35～36min (including 36min) Mobile phase B is 100%；
The concentration of volume percent of 36～40min (including 40min) Mobile phase B is 100%；
The concentration of volume percent of 40～41min (including 41min) mobile phase A is 35%, the volume basis of Mobile phase B
Specific concentration is 65%；
The concentration of volume percent of 41～45min mobile phase A is 35%, and the concentration of volume percent of Mobile phase B is 65%.
MS condition: electron spray ionisation source negative ion mode (ESI-), spray voltage (-4.5kV), atomization gas
Flow (6L/min), nebulizer temperature (180 DEG C), collision gas is nitrogen, and pressure is 1.0Bar, number
It is 8.0eV according to frequency acquisition 1.0HZ: collision energy.
Result (Fig. 1) finds, containing Crataegolic acid in BY-OA-MAA45 solution, BY-OA solution and
BY-OA-pRS313-TRP solution does not all contain Crataegolic acid.In Fig. 1, A figure is LC-MS result,
Standard+BY-OA is to add Crataegolic acid and the LC-MS result of Corosolic acid in BY-OA solution, and BY-OA is
The LC-MS result of BY-OA solution, BY-OA-MAA45 is the LC-MS result of BY-OA-MAA45 solution, Maslinic
Acid represents that Crataegolic acid, Corosolic acid represent Corosolic acid；B figure is under negative ion mode, sample
BY-OA-MAA45 and positive control sample Standard+BY-OA occur simultaneously identical high-resolution Crataegolic acid mass spectrum from
Sub-peak figure.
Result (Fig. 2) finds, containing Crataegolic acid and Corosolic acid in BY-OA-UA-MAA45 solution, and BY-OA-UA
Solution and BY-OA-UA-pRS313-TRP solution all do not contain Crataegolic acid and Corosolic acid.In Fig. 2, A figure is
LC-MS result, Standard+BY-OA-UA is to add Crataegolic acid and Corosolic acid in BY-OA-UA solution
LC-MS result, BY-OA-UA is the LC-MS result of BY-OA-UA solution, and BY-OA-UA-MAA45 is
The LC-MS result of BY-OA-UA-MAA45 solution, Maslinic acid represents Crataegolic acid, Corosolic acid
Represent Corosolic acid；B figure is under negative ion mode, sample BY-OA-UA-MAA45 and positive control sample
There is identical high-resolution Corosolic acid mass ions peak figure simultaneously in Standard+BY-OA-UA.
Show, the MAA45 channel genes obtained will be cloned from Fructus Crataegi can produce the saccharomyces cerevisiae of oleanolic acid (OA)
After BY-OA, recombinant bacterium can produce Crataegolic acid；MAA45 channel genes can be produced oleanolic acid (OA) and maloic acid
(UA), after in saccharomyces cerevisiae BY-OA-UA, recombinant bacterium can produce Crataegolic acid and Corosolic acid, and does not imports this base
BY-OA and BY-OA-UA of cause all cannot produce Crataegolic acid and Corosolic acid, shows, MAA45 can be with olive
Acid prepares Crataegolic acid for substrate, it is also possible to prepare Corosolic acid with maloic acid for substrate.Due to oleanolic acid (formula 4) with
Maloic acid (formula 5) is triterpenoid, and oleanolic acid is β-balsam (β-Amyrin) type, and maloic acid is
α-balsam (α-Amyrin) type, compared with oleanolic acid, Crataegolic acid be only oleanolic acid 2 occur α-
The product that hydroxylation obtains, compared with maloic acid, Corosolic acid is the product only occurring α-hydroxylation to obtain maloic acid 2
Thing, shows, MAA45 is 2 α-hydroxylases of triterpene.
Claims (10)
1. protein, is following A1), A2) or A3):
A1) protein of sequence 1 during aminoacid sequence is sequence table；
A2) by shown in sequence in sequence table 1 aminoacid sequence through one or several amino acid residue replacement and/
Or lack and/or add and have the protein of identical function；
A3) at A1) or N end A2) or/and C end connects the fused protein that label obtains.
2. the biomaterial relevant to the protein described in claim 1, described biomaterial is following B1) to B10)
In any one:
B1) nucleic acid molecules of protein described in coding claim 1；
B2) containing B1) expression cassette of described nucleic acid molecules；
B3) containing B1) recombinant vector of described nucleic acid molecules；
B4) containing B2) recombinant vector of described expression cassette；
B5) containing B1) recombinant microorganism of described nucleic acid molecules；
B6) containing B2) recombinant microorganism of described expression cassette；
B7) containing B3) recombinant microorganism of described recombinant vector；
B8) containing B4) recombinant microorganism of described recombinant vector；
B9) containing B1) transgenic cell line of described nucleic acid molecules；
B10) containing B2) transgenic cell line of described expression cassette.
Biomaterial the most according to claim 2, it is characterised in that: B1) described nucleic acid molecules is following 1)
Or 2) or 3) shown in nucleic acid molecules:
1) the cDNA molecule of the 795-2225 position of sequence 2 or DNA molecular during coded sequence is sequence table；
2) with 1) nucleotide sequence that limits has 75% or more than 75% homogeneity, and described in coding claim 1
The cDNA molecule of protein or genomic DNA molecule；
3) under strict conditions with 1) nucleotide sequence hybridization that limits, and protein described in coding claim 1
CDNA molecule or genomic DNA molecule；
B2) DNA molecular shown in 7-2540 position of sequence 2 during described expression cassette is sequence table.
4. according to the biomaterial described in Claims 2 or 3, it is characterised in that: described recombinant microorganism is by B1)
Described nucleic acid molecules imports described in the expression claim 1 that Saccharomyces Cerevisiae in S accharomyces cerevisiae obtains
The recombinant microorganism of protein.
5. the preparation method of protein described in claim 1, including: cultivate containing protein described in claim 1
The recombinant microorganism of the expression cassette of encoding gene, makes the encoding gene of protein described in claim 1 express, obtains table
Reach the recombinant microorganism culture of described protein；Described protein is obtained from described recombinant microorganism culture.
6. Crataegolic acid and/or the preparation method of Corosolic acid, including with oleanolic acid and/or maloic acid for substrate right
Require that the protein described in 1 carries out catalytic reaction and obtains Crataegolic acid and/or Corosolic acid.
7. Crataegolic acid and/or the preparation method of Corosolic acid, including: by the volume containing protein described in claim 1
The expression cassette of code gene imports in the receptor biological cell that can produce oleanolic acid and/or maloic acid, obtains restructuring biological thin
Born of the same parents；Cultivate described restructuring biological cell, make the encoding gene of protein described in claim 1 express, obtain expressing institute
State the cell culture of protein；Crataegolic acid and/or section sieve is obtained from the cell culture of the described protein of described expression
Rope acid；Described receptor biological cell is microbial cell, plant cell or non-human animal cell.
Method the most according to claim 7, it is characterised in that: the encoding gene of protein described in claim 1 is
B1 in any one in claim 2-4) described nucleic acid molecules；
And/or,
The expression cassette of the encoding gene containing protein described in claim 1 is the B2 in claim 2-4 in any one)
Described expression cassette.
9. hydroxylase preparation or 2 α of triterpene-hydroxylase preparation, comprises protein described in claim 1 or right is wanted
Seek arbitrary described biomaterial in 2-4.
The most following arbitrary application:
Protein described in X1, claim 1 is as the application in hydroxylase or 2 α-hydroxylases of triterpene；
The application in preparing hydroxylase product or 2 α of triterpene-hydroxylase product of the protein described in X2, claim 1；
The application in producing Crataegolic acid and/or Corosolic acid of the protein described in X3, claim 1；
The application in degraded oleanolic acid and/or maloic acid of the protein described in X4, claim 1；
Arbitrary described biomaterial application in preparing hydroxylase or 2 α-hydroxylases of triterpene in X5, claim 2-4；
In X6, claim 2-4, arbitrary described biomaterial is preparing hydroxylase product or 2 α of triterpene-hydroxylase product
In application；
Arbitrary described biomaterial application in producing Crataegolic acid and/or Corosolic acid in X7, claim 2-4；
Arbitrary described biomaterial application in degraded oleanolic acid and/or maloic acid in X8, claim 2-4；
The application in preparing hydroxylase or 2 α-hydroxylases of triterpene of the method described in X9, claim 5；
The application in preparing hydroxylase product or 2 α of triterpene-hydroxylase product of the method described in X10, claim 5；
Arbitrary described method application in degraded oleanolic acid and/or maloic acid in X11, claim 6-8；
The application in producing Crataegolic acid and/or Corosolic acid of the preparation described in X12, claim 9；
The application in degraded oleanolic acid and/or maloic acid of the preparation described in X13, claim 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610236283.9A CN105802926B (en) | 2016-04-14 | 2016-04-14 | 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610236283.9A CN105802926B (en) | 2016-04-14 | 2016-04-14 | 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802926A true CN105802926A (en) | 2016-07-27 |
| CN105802926B CN105802926B (en) | 2019-02-26 |
Family
ID=56460966
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610236283.9A Active CN105802926B (en) | 2016-04-14 | 2016-04-14 | 2 α of triterpene-hydroxylase MAA45 and its relevant biological material and they preparation hawthorn acid and Corosolic acid in application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802926B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109112116A (en) * | 2017-06-26 | 2019-01-01 | 中国科学院天津工业生物技术研究所 | Albumen from centella and the application in preparation hawthorn acid and Corosolic acid |
| CN110438099A (en) * | 2018-05-04 | 2019-11-12 | 中国科学院天津工业生物技术研究所 | The application of glycosyl transferase and its associated materials in the engineering bacteria that building produces ginsenoside Rb1 and Rg1 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105418721A (en) * | 2015-11-05 | 2016-03-23 | 沈阳化工大学 | Oleanolic acid chemical modifier with antitumor activity and preparation method thereof |
-
2016
- 2016-04-14 CN CN201610236283.9A patent/CN105802926B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105418721A (en) * | 2015-11-05 | 2016-03-23 | 沈阳化工大学 | Oleanolic acid chemical modifier with antitumor activity and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 屠春燕等: "应用色谱/质谱联用方法分析霉菌单加氧酶羟基化齐敦果酸体系", 《分析试验室》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109112116A (en) * | 2017-06-26 | 2019-01-01 | 中国科学院天津工业生物技术研究所 | Albumen from centella and the application in preparation hawthorn acid and Corosolic acid |
| CN110438099A (en) * | 2018-05-04 | 2019-11-12 | 中国科学院天津工业生物技术研究所 | The application of glycosyl transferase and its associated materials in the engineering bacteria that building produces ginsenoside Rb1 and Rg1 |
| CN110438099B (en) * | 2018-05-04 | 2022-04-15 | 中国科学院天津工业生物技术研究所 | Application of glycosyltransferase and related materials thereof in construction of engineering bacteria for producing ginsenosides Rb1 and Rg1 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802926B (en) | 2019-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110438099B (en) | Application of glycosyltransferase and related materials thereof in construction of engineering bacteria for producing ginsenosides Rb1 and Rg1 | |
| CN102925376B (en) | Recombinant microorganism for preparing dharma diene and protopanoxadiol and construction method thereof | |
| CN104357418B (en) | The application of a kind of glycosyl transferase and its mutant in ginseng saponin Rh 2 is synthesized | |
| CN111205993B (en) | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof | |
| CN103484389B (en) | Recombinant saccharymyces cerevisiae for producing ginsengenins as well as construction method and application of same | |
| CN113186183B (en) | Difunctional sesterterpene/diterpene synthase LcTPS2, coding gene, product and application thereof | |
| CN106318966B (en) | A method of 3-O- glucosyl group oleanolic acid and cellobiose oleanolic acid are synthesized using saccharomyces cerevisiae | |
| CN115197172B (en) | Sesterterpene compound, synthetic gene cluster and synthetic method thereof | |
| CN113416748A (en) | Expression vector for synthesizing cannabidiol, heterologous expression method and application | |
| CN112852763B (en) | Application of Pn3-32-i5 protein and coding gene thereof in production of notoginsenoside R1 | |
| CN105802926A (en) | Triterpene-2-alpha-hydroxylase MAA45, related biological materials thereof and application of triterpene two-bit alpha-hydroxylase MAA45 and related biological materials in preparing maslinic acid and corosolic acid | |
| WO2021088370A1 (en) | Highly efficient and controllable expression system for endogenous piggybacking exogeneous genes | |
| CN116987603A (en) | Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof | |
| CN109097342A (en) | Mould middle 11 B-hydroxylase of steroid of Absidia and its encoding gene and application | |
| CN116064267B (en) | Saccharomyces cerevisiae engineering bacteria for producing ginsenoside Rg3 and construction method thereof | |
| CN110305855A (en) | Rhizoma Gastrodiae GeCPR gene and its application | |
| CN109971651B (en) | Tobacco endophytic fungus and application thereof in preparation of ergosterol 5,8 peroxide | |
| CN116396876A (en) | Saccharomyces cerevisiae engineering bacteria for producing ginsenoside Rd and construction method thereof | |
| CN115161208B (en) | Saccharomyces cerevisiae genetically engineered bacterium and application thereof in production of cucurbitacin intermediate | |
| CN107903227B (en) | Succinic anhydride compound, gene and protein related to succinic anhydride compound and preparation method of succinic anhydride compound | |
| CN112574981B (en) | Taraxasterol synthase, gene for coding taraxasterol synthase and preparation and application thereof | |
| CN104450633A (en) | Fusion protein capable of increasing conversion efficiency of dammarendiol, construction method and application | |
| CN104450769B (en) | The fused protein and construction method of dammarendiol transformation efficiency can be improved | |
| CN113528365A (en) | Recombinant saccharomyces cerevisiae for producing cannabidiol, construction method and application thereof | |
| CN115044574B (en) | Vanilla alkene synthase mutant and application thereof in synthesizing valansia alkene in yeast |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |