CN113528365A - Recombinant saccharomyces cerevisiae for producing cannabidiol, construction method and application thereof - Google Patents
Recombinant saccharomyces cerevisiae for producing cannabidiol, construction method and application thereof Download PDFInfo
- Publication number
- CN113528365A CN113528365A CN202110791234.2A CN202110791234A CN113528365A CN 113528365 A CN113528365 A CN 113528365A CN 202110791234 A CN202110791234 A CN 202110791234A CN 113528365 A CN113528365 A CN 113528365A
- Authority
- CN
- China
- Prior art keywords
- cannabidiol
- saccharomyces cerevisiae
- producing
- recombinant
- aae1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
- C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Mycology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a recombinant saccharomyces cerevisiae for producing cannabidiol, which expresses AAE1, CsPT4, OAC, OLS and CBDAS genes in a cannabidiol synthesis pathway, and overexpresses tHMGR, AAE1 and CBDAS genes, and also discloses a construction method of the recombinant saccharomyces cerevisiae, which is constructed by integrating AAE1, OLS, OAC, CBDAS and CsPT4 genes into a yeast chromosome, and integrating multiple copies of tHMGR, AAE1 and CBDAS with an inducible promoter into the yeast chromosome; the invention also discloses an application of the weight-grade saccharomyces cerevisiae in producing cannabidiol by fermentation. The invention realizes the purpose of biologically synthesizing the cannabidiol by optimizing the yeast strains, relieves the problem of larger cannabidiol gaps in the current market, and can be widely applied to the production process of the cannabidiol.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and relates to saccharomyces cerevisiae, in particular to recombinant saccharomyces cerevisiae for producing cannabidiol, a construction method and application thereof.
Background
The production and application of industrial hemp and cannabidiol are gradually legalized in the world, the pharmacological effect is obvious, and the market prospect is huge; the global cannabidiol industry value will reach $ 57 billion in 2019 and $ 181 billion in 2021.
Industrial Cannabis sativa (Cannabis sativa) is an annual herb plant, cannabinoids are specific functional substances in industrial Cannabis sativa, and more than 70 cannabinoids, of which Tetrahydrocannabinol (THC) and Cannabidiol (CBD) are the main components. THC is an important active ingredient of industrial hemp, has a neuroprotective effect, but is banned by many countries because of its hallucinogenic effect; CBD is a non-hallucinogenic ingredient in industrial cannabis sativa and shows great medicinal potential in the aspects of tranquilization, anti-epilepsy, anti-inflammation and anti-depression. In addition to the active ingredients, the seeds of industrial hemp can be used as a traditional Chinese medicine fructus cannabis, and the fibers thereof are widely used in the textile industry. In 6 months 2018, the U.S. FDA announced approval of pharmaceutical company GW epididolex oral liquid on the market, before 2016 where the U.S. FDA granted the company epididolex (cannabidiol, CBD) its orphan drug status for treatment of rare hereditary Tuberous Sclerosis (TSC). Axim (r) Biotech, currently the major investment in american companies, is entering clinical trials for the treatment of irritable bowel syndrome using cannabidiol-containing chewing gum. In addition, the CBD can also relieve various diseases, such as muscle spasm, anxiety, nausea, chronic pain, inflammation, insomnia and the like, and has certain effects on the aspects of schizophrenia and the like, but the CBD is not reported in clinical tests.
The CBD raw material is divided into two grades, namely a raw material medicine grade and a food or cosmetic grade, wherein the purity of the raw material medicine CBD is required to be more than 99%, the food and cosmetic grade is different from 5-95%, the CBD raw material medicine is mainly produced in Europe and America, and a small amount of CBD raw material medicine is supplied at home. CBD feedstocks are sold primarily to the united states, while europe has temporarily disallowed import of CBD feedstocks. The CBD capacity in China is far lower than that in the US and European markets, the Chinese with the largest capacity is called that the CBD can be produced by 2 tons every year, and other companies are few; enterprises such as kang En Bei, Zi Xin pharmacy, Longjin pharmacy, cis-tertiary world shares, Ken and pharmacy, Fang Sheng pharmacy and the like declare investment to enter the industrial hemp market, and carry out the planting, extraction and product deep processing businesses of the industrial hemp in Yunnan and Heilongjiang provinces. Compared with the integral treatment starting stage of the industrial hemp industry in America and Europe, the main problems are no variety, backward extraction and separation technology, low productivity, no deep processing products, no policy restrictions and the like.
In terms of preparing CBD raw materials, chemical synthesis is also a thought, and by integrating the research results of the prior literatures, the chemical synthesis method has the problems of long steps, harsh reaction conditions, unavailable mass raw materials, small reaction scale and the like. The industrialization of the cannabidiol raw material medicament is difficult to realize by truly relying on chemical synthesis.
In addition to chemical synthesis, the synthesis of cannabinoids by yeast fermentation was pioneered by professor Keasling in berkeling laboratory, university of california, 2019. The Chinese patent with patent number CN201880046655.9 relates to the production of cannabinoids in yeast, and provides a genetically modified yeast, which not only utilizes the generation gene and synthesis pathway gene of cannabinoids, but also needs to add other auxiliary gene segments and other auxiliary materials; chinese patent No. CN201880042884.3, relating to "microorganism and method for producing cannabinoid and cannabinoid derivatives", discloses a genetically modified host cell producing cannabinoid and its derivatives and a specific polypeptide sequence, which modifies the host cell using a polypeptide and a nucleic acid sequence encoding the polypeptide, but does not disclose in detail specific construction methods and processes for producing cannabinoid and its derivatives.
Disclosure of Invention
The invention aims to provide a recombinant saccharomyces cerevisiae strain for producing cannabidiol, which realizes the aim of biologically synthesizing the cannabidiol by optimizing the yeast strain;
the invention also aims to provide a construction method of the recombinant saccharomyces cerevisiae strain for producing cannabidiol, so as to achieve the aim of simply, quickly, effectively and accurately constructing the strain;
it is a further object of the present invention to provide an application of the above recombinant strain of saccharomyces cerevisiae producing cannabidiol to alleviate the problem of the limited cannabidiol resources leading to larger gaps in the current market of applications.
In order to achieve the purpose, the invention adopts the following technical scheme:
a recombinant Saccharomyces cerevisiae for producing cannabidiol is preserved in China general microbiological culture Collection center at 19.3.2021, wherein the preservation address is No. 3 of Xilu No. 1 of Beijing Kogyo area, the north Chen, the preservation number is CGMCC No.22040, and the Latin name is Saccharomyces cerevisiae.
As a limitation, the recombinant saccharomyces cerevisiae for producing the cannabidiol expresses AAE1, CsPT4, OAC, OLS and CBDAS in a cannabidiol synthetic pathway, and the recombinant saccharomyces cerevisiae for producing the cannabidiol heterologously expresses tHMGR and expresses AAE1 and CBDAS genes in multiple copies.
As another limitation, the CsPT4 gene is codon optimized, and the codon optimized CsPT4 sequence is as follows:
AAGCTTATGGGTTTGTCCCTAGTATGCACCTTCTCTTTCCAAACTAACTACCACACTTTGCTAA ACCCTCACAACAAGAACCCAAAGAACTCTTTATTGTCTTACCAACACCCAAAGACTCCAATTATAAAA TCTTCCTACGATAACTTCCCATCTAAGTACTGTTTGACAAAGAATTTCCATTTGTTGGGTTTGAACTC CCACAACAGAATCTCTTCTCAATCCCGTTCCATCAGAGCTGGTTCCGACCAAATCGAAGGTTCTCCAC ATCACGAATCTGACAACAGTATTGCCACCAAAATCTTAAATTTCGGTCACACTTGTTGGAAATTGCAA AGACCATACGTTGTCAAGGGTATGATCTCTATTGCTTGTGGTTTGTTCGGTAGAGAATTATTCAACAA CAGACACTTGTTTTCTTGGGGTTTGATGTGGAAGGCTTTCTTTGCTTTGGTCCCAATCTTGTCTTTCA ACTTCTTCGCCGCTATCATGAACCAAATCTACGATGTTGACATTGACAGAATCAACAAGCCAGACTTG CCATTGGTTTCTGGTGAAATGTCTATTGAAACTGCTTGGATTCTTTCAATTATCGTTGCTTTGACCGG TTTGATTGTCACCATCAAGTTGAAGTCTGCCCCATTATTTGTCTTCATTTACATTTTCGGTATATTTG CCGGTTTCGCTTACTCTGTTCCACCAATCAGATGGAAGCAATACCCATTCACCAACTTCTTGATCACT ATTTCATCTCACGTTGGTTTAGCCTTCACTTCTTATTCCGCTACCACCTCTGCTTTAGGTCTGCCTTT CGTCTGGAGACCAGCTTTCTCCTTCATTATTGCTTTCATGACTGTTATGGGTATGACCATCGCTTTCG CCAAGGATATCAGTGACATTGAAGGTGATGCTAAGTACGGTGTCTCCACCGTCGCTACTAAGTTAGGT GCTAGAAACATGACTTTCGTTGTTTCTGGCGTTTTGTTGTTGAATTACTTGGTTTCCATCTCCATTGG TATCATCTGGCCACAAGTTTTTAAGTCCAACATTATGATTTTGTCCCATGCCATCTTGGCTTTCTGTT TGATTTTCCAAACCCGTGAATTGGCTTTGGCCAACTATGCTTCTGCTCCATCCAGACAATTCTTCGAA TTCATCTGGTTATTGTACTACGCTGAATACTTCGTCTACGTCTTTATCCTCGAG。
the invention also provides a construction method of the recombinant saccharomyces cerevisiae for producing cannabidiol, which comprises the following steps of:
a) obtaining AAE1, OLS, OAC and CBDAS genes participating in a cannabidiol synthesis pathway from industrial cannabis sativa plants, and synthesizing a saccharomyces cerevisiae codon preference CspT4 gene;
b) constructing P respectively from the AAE1, OLS, OAC, CBDAS and CspT4 gene segments obtained in the step a)tef1-AAE1-Tpgk1，PTEF2-OLS-TCYC1，PPGK1-OAC-Tadh1，PTDH3-CBDAS-TCYC1，PTDH3-PT4-Ttdh3Integrating the five gene expression clusters to a Delta locus of a yeast chromosome Cen.pk2-1D;
c) p is respectively constructed by tHMGR, AAE1 and CBDAS gene segments stored in a laboratoryGAL10-tHMGR-Tadh1，PGAL1-AAE1-TCYC1，PGAL1The CBDAS-Tcyc1 gene expression cluster, topThe three gene expression clusters are integrated to GAL80 locus of yeast chromosome Cen.pk2-1D to obtain recombinant yeast D-1;
d) and (3) carrying out lithium acetate conversion treatment on the recombinant yeast D-1 to obtain the cannabidiol-producing yeast strain D-1-1, namely the cannabidiol-producing recombinant saccharomyces cerevisiae.
The invention also provides application of the recombinant saccharomyces cerevisiae for producing the cannabidiol, and the cannabidiol is produced by the recombinant saccharomyces cerevisiae for producing the cannabidiol in a fermentation mode.
As a limitation, the fermentation conditions are pH 4-6, temperature 30 deg.C, and culture medium for fermentation is composed of 20-30g/L glucose, 15-25g/L tryptone, and 5-15g/L yeast powder.
As another limitation, after glucose is depleted in the medium, a galactose fed-batch fermentation is used.
As a third limitation, the galactose feeding manner was to feed galactose every 24h so that the concentration of galactose became 20-30g/L while adding 1mM of hexanoic acid to the medium.
In the present invention:
the recombinant saccharomyces cerevisiae strain for producing cannabidiol is preserved in China general microbiological culture Collection center (CGMCC) at 3 months and 19 days in 2021, and has the address as follows: west road No. 1, north west of the republic of kyo, yang, institute of microbiology, academy of sciences of china, zip code: 100101, preservation number is CGMCC No. 22040; it is classified and named as Saccharomyces cerevisiae.
Due to the adoption of the technical scheme, compared with the prior art, the invention has the technical progress that:
the invention provides a construction method and application of a saccharomyces cerevisiae strain for producing cannabidiol, wherein the saccharomyces cerevisiae strain for producing cannabidiol constructs various functional gene plasmids by a seamless cloning technology, and integrates a gene expression cassette into a yeast chromosome by a yeast lithium acetate conversion method; the recombinant saccharomyces cerevisiae strain for producing the cannabidiol is synthesized by optimizing the yeast strain, and the application of the recombinant saccharomyces cerevisiae strain can realize biosynthesis of the cannabidiol.
The construction method of the invention can simply, rapidly, effectively and accurately construct the recombinant saccharomyces cerevisiae strain for producing cannabidiol; the recombinant saccharomyces cerevisiae strain for producing the cannabidiol constructed by the invention can solve the problem of large gap caused by limited cannabidiol resources in the current application market.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention.
In the drawings:
FIG. 1 is a schematic diagram of the combination of gene expression cassettes and integration sites constructed by integration, wherein FIG. 1a and FIG. 1b show the integration sequence of gene expression clusters constructed in example 3 and example 4, respectively;
FIG. 2 is an electrophoretogram of a yeast positive strain;
FIG. 3 is a GC-MS map of the product from yeast strain D-1, where 1 is a schematic representation of product OA, 2 is a schematic representation of product CBD, 3 is a schematic representation of product CBDA, and 4 is a schematic representation of product CBGA;
FIG. 4 is a graph of cannabidiol production by yeast strain D-1.
Detailed Description
The following examples are further described in detail.
It should be understood that the examples are given for the purpose of illustrating various embodiments of the invention and are not to be construed as limiting the invention in any way. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified, and the genes mentioned in the examples are all the entire coding frame regions of the genes unless otherwise specified. All are available from NCBI, and the promoter and terminator sequences mentioned are also available from NCBI download, and the specific sequence start positions can be known from primers in the primer tables.
Example 1 obtaining of genes required for cannabidiol Synthesis and Yeast self-Gene elements in Modular Regulation
Fresh industrial hemp is used as a material, and RNA is extracted and reverse transcribed to obtain cDNA by adopting a method known in the field. Primers for AAE1, CsPT4, OAC, OLS and CBDAS genes were designed according to the conventional method in the art, the above fragments were amplified, primers for tHMG gene fragment were designed using the genome of Saccharomyces cerevisiae CEN. PK2-1D as a template, and tHMG gene fragment in yeast was amplified.
Example 2 obtaining of genes required for cannabidiol Synthesis and expression clusters formed by Yeast's own genetic elements in Modular control
Specifically, the expression cluster refers to a promoter + a gene fragment sequence + a terminator. The construction of the further expression cluster is divided into two steps: the constitutive promoter and terminator sequences commonly used in yeast were first amplified, where the amplified promoters include TEF1, TDH3, PGK1, TEF2, GAL1, GAL10, and the terminators include CYC1, ADH1, PGK1, and the primers used for amplification of the above promoter and terminator sequences are shown in Table 1. The amplified promoter sequence and terminator sequence were ligated to the cloning vector pUC19L in the order promoter-functional gene-terminator to construct pUC19L-Ptef1-AAE1-Tpgk1、pUC19L-PTDH3-PT4-Ttdh3、 pUC19L-PPGK1-OAC-Tadh1、pUC19L-PTDH3-CBDAS-TCYC1、pUC19L-PTEF2-OLS-TCYC1The ligation of the vector, promoter and terminator sequences is performed in a seamless manner.
The gene amplified in example 1 was ligated to the middle of a promoter and a terminator by seamless ligation to construct expression clusters of the corresponding genes, specifically pTEF1-AAE1-tpgk1, pTDH3-PT4-tTdh3, pPGK1-OAC-tAdh1, pTDH3-CBDAS-tCYC1 and pTEF2-OLS-tCYC1, which were ligated to the middle of the promoter and the terminator by seamless ligation.
TABLE 1 primers used for the integrative construction of plasmids
Example 3 synthetic pathway for the creation of cannabidiol in recombinant Saccharomyces cerevisiae producing cannabidiol
Integrating five gene expression clusters of Ptef1-AAE1-Tpgk1, PTDH3-PT4-Ttdh3, PPGK1-OAC-Tadh1, PTDH3-CBDAS-TCYC1 and PTEF2-OLS-TCYC1 into a Delta locus integrated into a yeast chromosome in a form of homologous recombination, carrying out PCR (polymerase chain reaction) to detect positive cloning, and detecting the capacity of a positive cloning strain for producing cannabidiol to obtain the yeast strain named D-1 with the highest cannabidiol production. Wherein, the sequence of the integration of the exogenous gene expression cluster fragment is shown in FIG. 1 a.
Example 4 recombinant Saccharomyces cerevisiae producing cannabidiol
Codon optimization of CsPT4, the sequence of the codon optimized CsPT4 was:
AAGCTTATGGGTTTGTCCCTAGTATGCACCTTCTCTTTCCAAACTAACTACCACACTTTGCTAA ACCCTCACAACAAGAACCCAAAGAACTCTTTATTGTCTTACCAACACCCAAAGACTCCAATTATAAAA TCTTCCTACGATAACTTCCCATCTAAGTACTGTTTGACAAAGAATTTCCATTTGTTGGGTTTGAACTC CCACAACAGAATCTCTTCTCAATCCCGTTCCATCAGAGCTGGTTCCGACCAAATCGAAGGTTCTCCAC ATCACGAATCTGACAACAGTATTGCCACCAAAATCTTAAATTTCGGTCACACTTGTTGGAAATTGCAA AGACCATACGTTGTCAAGGGTATGATCTCTATTGCTTGTGGTTTGTTCGGTAGAGAATTATTCAACAA CAGACACTTGTTTTCTTGGGGTTTGATGTGGAAGGCTTTCTTTGCTTTGGTCCCAATCTTGTCTTTCA ACTTCTTCGCCGCTATCATGAACCAAATCTACGATGTTGACATTGACAGAATCAACAAGCCAGACTTG CCATTGGTTTCTGGTGAAATGTCTATTGAAACTGCTTGGATTCTTTCAATTATCGTTGCTTTGACCGG TTTGATTGTCACCATCAAGTTGAAGTCTGCCCCATTATTTGTCTTCATTTACATTTTCGGTATATTTG CCGGTTTCGCTTACTCTGTTCCACCAATCAGATGGAAGCAATACCCATTCACCAACTTCTTGATCACT ATTTCATCTCACGTTGGTTTAGCCTTCACTTCTTATTCCGCTACCACCTCTGCTTTAGGTCTGCCTTT CGTCTGGAGACCAGCTTTCTCCTTCATTATTGCTTTCATGACTGTTATGGGTATGACCATCGCTTTCG CCAAGGATATCAGTGACATTGAAGGTGATGCTAAGTACGGTGTCTCCACCGTCGCTACTAAGTTAGGT GCTAGAAACATGACTTTCGTTGTTTCTGGCGTTTTGTTGTTGAATTACTTGGTTTCCATCTCCATTGG TATCATCTGGCCACAAGTTTTTAAGTCCAACATTATGATTTTGTCCCATGCCATCTTGGCTTTCTGTT TGATTTTCCAAACCCGTGAATTGGCTTTGGCCAACTATGCTTCTGCTCCATCCAGACAATTCTTCGAA TTCATCTGGTTATTGTACTACGCTGAATACTTCGTCTACGTCTTTATCCTCGAG。
and connecting a promoter and a terminator to form expression clusters GAL1-CBDA-CYC1, GAL10-tHMGr-ADH1 and GAL1-AAE1-CYC1, integrating the gene expression clusters into GAL80 sites of yeast dyeing Cen.pk2-1D bodies in a homologous recombination mode, detecting positive clones by PCR (polymerase chain reaction), and detecting the capacity of the positive clone strains for producing the cannabidiol to obtain the yeast strains with the highest cannabidiol production named D-1-1, namely the recombinant saccharomyces cerevisiae for producing the cannabidiol. Wherein, the sequence of the integration of the exogenous gene expression cluster fragment is shown in FIG. 1 b. The first integration procedure for constructing the strain is shown in Table 2.
TABLE 2 first integration construction of strains
Example 5 production of cannabidiol by fermentation of recombinant Saccharomyces cerevisiae
Preparing competence and transforming by a saccharomyces cerevisiae lithium acetate transformation method, wherein the detailed steps are as follows:
s1.D-1 strain streaking (SD-Ura solid culture medium), culturing for 36h at constant temperature of 30 ℃, and obtaining a monoclonal strain A after the growth of a monoclonal;
s2, selecting the monoclonal strain A, inoculating the monoclonal strain A into a 5mLSD-Ura liquid culture medium (15mL of a shake tube), and culturing for 16h in a constant-temperature culture shaker at 30 ℃ at 200rpm to obtain a culture bacterial liquid B;
s3, inoculating 2mL of culture bacterial liquid B into 100mL of fresh SD-Ura culture medium, and culturing in a constant-temperature culture shaking table at 30 ℃ and 200rpm until the OD600 value reaches 1 to obtain culture bacterial liquid C;
s4, transferring the culture bacterium liquid C into a 50mL sterile centrifuge tube for 3000r min-1Centrifuging for 5min, removing supernatant, and collecting thallus D;
s5, resuspending the thallus D in 10mL of sterile water for 3000r min-1Centrifuging for 5min, removing supernatant, and washing thallus to obtain thallus E;
s6, transferring the thallus E into a 1.5mL sterile centrifuge tube for 3000r min-1Centrifuging for 2min, removing supernatant, and collecting thallus F;
s7, resuspending the thallus F in 1mL of 100 mmol. L-113000 r.min in LiAc-1Centrifuging for 15s, removing supernatant, and collecting to obtain thallus G;
s8, resuspending the cell G in 400. mu.L of 100 mmol/L-1Obtaining competent cell sap H in LiAc;
s9, placing salmon sperm (ssDNA) in a dry thermostat at 99 ℃ for heating for 10min for denaturation, and then placing at 4 ℃ for later use;
s10, taking 50 mu L of competent cell sap H at 13000r min-1Centrifuging for 15s in a centrifuge, removing supernatant, and sequentially adding: 240 μ L of 50% PEG3350, 36 μ L of 1 mol. L-1LiAc and 5. mu.L of 10 mg/mL-1Denaturing ssDNA, blowing and uniformly mixing by using a pipette gun, placing the mixture in a 30 ℃ condition for heat preservation for 30min, a 42 ℃ water bath for 25min, and placing the mixture at 4 ℃ for 2min to obtain a mixed solution I;
s11, centrifuging the mixed solution I in a 3000 r.min-1 centrifuge for 2min, removing supernatant, suspending in 800 μ L YPD liquid culture medium, performing shake culture at 30 deg.C and 200 r.min-1 for 2h, and performing shake culture at 3000 r.min-1Centrifuging for 2min, removing supernatant, resuspending in 800 μ L sterile water for washing, centrifuging under the same conditions, and removing supernatant to obtain bacterial solution J;
s12, coating 100 mu L of bacterial liquid J on an SD-Leu-Ura solid culture medium, and putting the solid culture medium into a constant-temperature incubator at 30 ℃ for 2-3 days to obtain the cannabidiol-producing yeast strain D-1-1.
Obtaining a cannabidiol-producing yeast strain D-1-1 through the steps, and further optimizing the fermentation conditions, wherein the specific fermentation conditions are that the pH is 5, the temperature is 30 ℃, and the culture medium comprises 20g/L glucose, 10g/L tryptone and 5g/L yeast powder;
after the glucose is exhausted, adopting a galactose feeding fermentation strategy, and feeding galactose every 24 hours to ensure that the concentration of the galactose is 20 g/L; finally, the concentration of cannabidiol produced by shake flask fermentation reaches 4.01 mu g/L through GCMS detection.
Example 6 sample and detection treatment method for recombinant Saccharomyces cerevisiae cells producing cannabidiol and intermediate metabolites
Sample treatment: taking 10mL recombinant saccharomyces cerevisiae strain producing cannabidiol, centrifuging at 8000rmp for 5min, discarding supernatant, adding pure water, cleaning for 2 times, centrifuging at 8000rmp for 10min, discarding supernatant, adding 1mL cell disruption solution (0.32M sulfuric acid), boiling with boiling water for 10min, taking out, and standing at room temperature; adding 5mL ethyl acetate, vortex shaking for 5min, ultrasonic treating for 30min, centrifuging at 12000rmp for 10min, collecting supernatant, and repeating extraction for 2 times. The collected supernatant was evaporated to dryness by nitrogen blow, 2mL of methanol was added for redissolving, and the solution was filtered through a 0.22 μm filter for further use. Taking 100ul of the liquid after passing through the membrane, adding the liquid into an inner lining pipe, blowing and drying by blowing nitrogen, adding N-methyl-N-trimethylsilyl trifluoroacetamide, performing derivatization treatment at 80 ℃ for 30min, and performing detection on a machine.
Sample detection: the instrument comprises the following steps: agilent 7890GC-7000C-MS gas chromatography-mass spectrometer.
Chromatographic conditions are as follows: a chromatographic column: agilent HP-5 quartz capillary column (30 m.times.250 μm.times.0.25 μm); temperature rising procedure: starting temperature of 120 deg.C, maintaining for 1min, increasing to 160 deg.C at 4 deg.C/min, then increasing to 280 deg.C at 10 deg.C/min, and maintaining for 10 min; the sample inlet temperature is 280 ℃; detecting the interface temperature at 300 ℃; carrier gas (He) constant pressure mode, pressure 17.5psi, sample size 2 μ L; no flow split.
Mass spectrum conditions: an Electron Impact (EI) ion source; electron energy 40 eV; the ion source temperature is 230 ℃; the temperature of a four-level bar is 150 ℃; mass spectrum MRM mode, solvent delay time 10 min.
And (3) data acquisition mode: MRM mode.
Schematic representation of GC-MS of each product of yeast strain D-1 is shown in FIG. 3, wherein 1 is a schematic representation of product OA, 2 is a schematic representation of product CBD, 3 is a schematic representation of product CBDA, and 4 is a schematic representation of product CBGA;
specific qualitative ionic results for this example are shown in table 3:
TABLE 3 MRM Collection of ion parameters and results
SEQUENCE LISTING
<110> Zhejiang shouxian Gu pharmaceutical products Co., Ltd
Zhejiang Shouxian Valley Botanical Pharmaceutical Research Institute Co.,Ltd.
<120> recombinant saccharomyces cerevisiae for producing cannabidiol, and construction method and application thereof
<130> 20210707
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 1206
<212> DNA
<213> Cannabis sativa (Cannabis sativa L)
<400> 1
aagcttatgg gtttgtccct agtatgcacc ttctctttcc aaactaacta ccacactttg 60
ctaaaccctc acaacaagaa cccaaagaac tctttattgt cttaccaaca cccaaagact 120
ccaattataa aatcttccta cgataacttc ccatctaagt actgtttgac aaagaatttc 180
catttgttgg gtttgaactc ccacaacaga atctcttctc aatcccgttc catcagagct 240
ggttccgacc aaatcgaagg ttctccacat cacgaatctg acaacagtat tgccaccaaa 300
atcttaaatt tcggtcacac ttgttggaaa ttgcaaagac catacgttgt caagggtatg 360
atctctattg cttgtggttt gttcggtaga gaattattca acaacagaca cttgttttct 420
tggggtttga tgtggaaggc tttctttgct ttggtcccaa tcttgtcttt caacttcttc 480
gccgctatca tgaaccaaat ctacgatgtt gacattgaca gaatcaacaa gccagacttg 540
ccattggttt ctggtgaaat gtctattgaa actgcttgga ttctttcaat tatcgttgct 600
ttgaccggtt tgattgtcac catcaagttg aagtctgccc cattatttgt cttcatttac 660
attttcggta tatttgccgg tttcgcttac tctgttccac caatcagatg gaagcaatac 720
ccattcacca acttcttgat cactatttca tctcacgttg gtttagcctt cacttcttat 780
tccgctacca cctctgcttt aggtctgcct ttcgtctgga gaccagcttt ctccttcatt 840
attgctttca tgactgttat gggtatgacc atcgctttcg ccaaggatat cagtgacatt 900
gaaggtgatg ctaagtacgg tgtctccacc gtcgctacta agttaggtgc tagaaacatg 960
actttcgttg tttctggcgt tttgttgttg aattacttgg tttccatctc cattggtatc 1020
atctggccac aagtttttaa gtccaacatt atgattttgt cccatgccat cttggctttc 1080
tgtttgattt tccaaacccg tgaattggct ttggccaact atgcttctgc tccatccaga 1140
caattcttcg aattcatctg gttattgtac tacgctgaat acttcgtcta cgtctttatc 1200
ctcgag 1206
Claims (8)
1. The recombinant saccharomyces cerevisiae for producing cannabidiol is characterized by being preserved in China general microbiological culture Collection center with the preservation number of CGMCC No. 22040.
2. The recombinant Saccharomyces cerevisiae producing cannabidiol according to claim 1,
in the synthetic route of the recombinant saccharomyces cerevisiae for producing the cannabidiol to express the cannabidiolAAE1、CsPT4、OAC、OLS、CBDAS，And the recombinant saccharomyces cerevisiae for producing the cannabidiol is heterologously expressedtHMGR, and multicopy expression of AAE1AndCBDASa gene.
3. Recombinant saccharomyces cerevisiae producing cannabidiol according to claim 1 or 2, wherein said recombinant saccharomyces cerevisiae is characterized byCsPT4The gene is codon-optimized, and the codon-optimizedCsPT4The sequence is as follows:
AAGCTTATGGGTTTGTCCCTAGTATGCACCTTCTCTTTCCAAACTAACTACCACACTTTGCTAAACCCTCACAACAAGAACCCAAAGAACTCTTTATTGTCTTACCAACACCCAAAGACTCCAATTATAAAATCTTCCTACGATAACTTCCCATCTAAGTACTGTTTGACAAAGAATTTCCATTTGTTGGGTTTGAACTCCCACAACAGAATCTCTTCTCAATCCCGTTCCATCAGAGCTGGTTCCGACCAAATCGAAGGTTCTCCACATCACGAATCTGACAACAGTATTGCCACCAAAATCTTAAATTTCGGTCACACTTGTTGGAAATTGCAAAGACCATACGTTGTCAAGGGTATGATCTCTATTGCTTGTGGTTTGTTCGGTAGAGAATTATTCAACAACAGACACTTGTTTTCTTGGGGTTTGATGTGGAAGGCTTTCTTTGCTTTGGTCCCAATCTTGTCTTTCAACTTCTTCGCCGCTATCATGAACCAAATCTACGATGTTGACATTGACAGAATCAACAAGCCAGACTTGCCATTGGTTTCTGGTGAAATGTCTATTGAAACTGCTTGGATTCTTTCAATTATCGTTGCTTTGACCGGTTTGATTGTCACCATCAAGTTGAAGTCTGCCCCATTATTTGTCTTCATTTACATTTTCGGTATATTTGCCGGTTTCGCTTACTCTGTTCCACCAATCAGATGGAAGCAATACCCATTCACCAACTTCTTGATCACTATTTCATCTCACGTTGGTTTAGCCTTCACTTCTTATTCCGCTACCACCTCTGCTTTAGGTCTGCCTTTCGTCTGGAGACCAGCTTTCTCCTTCATTATTGCTTTCATGACTGTTATGGGTATGACCATCGCTTTCGCCAAGGATATCAGTGACATTGAAGGTGATGCTAAGTACGGTGTCTCCACCGTCGCTACTAAGTTAGGTGCTAGAAACATGACTTTCGTTGTTTCTGGCGTTTTGTTGTTGAATTACTTGGTTTCCATCTCCATTGGTATCATCTGGCCACAAGTTTTTAAGTCCAACATTATGATTTTGTCCCATGCCATCTTGGCTTTCTGTTTGATTTTCCAAACCCGTGAATTGGCTTTGGCCAACTATGCTTCTGCTCCATCCAGACAATTCTTCGAATTCATCTGGTTATTGTACTACGCTGAATACTTCGTCTACGTCTTTATCCTCGAG。
4. a method of constructing recombinant saccharomyces cerevisiae producing cannabidiol as claimed in any of claims 1-3, comprising the following steps performed in sequence:
a) obtaining from industrial cannabis plant material involved in the cannabidiol synthesis pathwayAAE1、OLS、OAC、CBDASGene, Simultaneous Synthesis of Saccharomyces cerevisiae codon preferenceCsPT4A gene;
b) subjecting the product obtained in step a)AAE1、OLS、OAC、CBDAS、CsPT4Respective construction of Gene fragmentsP tef1 -AAE1-T pgk1， P TEF2 -OLS-T CYC1 ，P PGK1 -OAC-T adh1 ，P TDH3 -CBDAS-T CYC1 ，P TDH3 -PT4-T tdh3 Integrating the five gene expression clusters to a Delta locus of a yeast chromosome Cen.pk2-1D;
c) separately construct tHMGR, AAE1 and CBDAS gene fragments stored in a laboratoryP GAL10 -tHMGR-T adh1 ，P GAL1 - AAE1-T CYC1 ，P GAL1 -CBDAS-Tcyc1Integrating the three gene expression clusters to GAL80 locus of yeast chromosome Cen.pk2-1D to obtain recombinant yeast D-1;
d) and (3) carrying out lithium acetate conversion treatment on the recombinant yeast D-1 to obtain the cannabidiol-producing yeast strain D-1-1, namely the cannabidiol-producing recombinant saccharomyces cerevisiae.
5. Use of the recombinant cannabidiol-producing saccharomyces cerevisiae of any one of claims 1-3 wherein cannabidiol is produced by fermentation of the recombinant cannabidiol-producing saccharomyces cerevisiae.
6. Use of recombinant saccharomyces cerevisiae producing cannabidiol according to claim 5, wherein the fermentation conditions are pH =4-6, temperature is 30 ℃, and the medium for fermentation consists of 20-30g/L glucose, 15-25g/L tryptone, 5-15g/L yeast powder.
7. The use of recombinant Saccharomyces cerevisiae producing cannabidiol according to claim 6, wherein galactose feeding fermentation is used after glucose depletion in the medium.
8. The use of recombinant Saccharomyces cerevisiae producing cannabidiol according to claim 7, wherein the galactose feeding is performed by feeding galactose every 24h so that the concentration of galactose is 20-30g/L, while adding 1mM hexanoic acid to the culture medium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110791234.2A CN113528365B (en) | 2021-07-13 | 2021-07-13 | Recombinant saccharomyces cerevisiae for producing cannabidiol, construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110791234.2A CN113528365B (en) | 2021-07-13 | 2021-07-13 | Recombinant saccharomyces cerevisiae for producing cannabidiol, construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113528365A true CN113528365A (en) | 2021-10-22 |
| CN113528365B CN113528365B (en) | 2023-04-07 |
Family
ID=78098873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110791234.2A Active CN113528365B (en) | 2021-07-13 | 2021-07-13 | Recombinant saccharomyces cerevisiae for producing cannabidiol, construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113528365B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114657078A (en) * | 2022-01-27 | 2022-06-24 | 森瑞斯生物科技(深圳)有限公司 | Construction method and application of high-yield cannabidiolic acid saccharomyces cerevisiae strain |
| CN116891808A (en) * | 2023-07-12 | 2023-10-17 | 森瑞斯生物科技(深圳)有限公司 | Construction method and application of saccharomyces cerevisiae strain of cannabidiol synthase with subcellular structure positioning |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160298151A1 (en) * | 2015-04-09 | 2016-10-13 | Sher Ali Butt | Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products |
| CN109963941A (en) * | 2016-09-20 | 2019-07-02 | 22世纪公司 | For manipulating the Trichome specific promoters of the cannboid in glandular hairs He other compounds |
| US20190300888A1 (en) * | 2017-04-27 | 2019-10-03 | The Regents Of The University Of California | Microorganisms and methods for producing cannabinoids and cannabinoid derivatives |
| US20200165644A1 (en) * | 2017-07-12 | 2020-05-28 | Biomedican, Inc. | Production of cannabinoids in yeast |
| WO2020198679A1 (en) * | 2019-03-27 | 2020-10-01 | Rynetech Bio, Inc. | Biosynthetic cannabinoid production in engineered microorganisms |
| WO2021034848A1 (en) * | 2019-08-18 | 2021-02-25 | Ginkgo Bioworks, Inc. | Biosynthesis of cannabinoids and cannabinoid precursors |
| CN112410235A (en) * | 2020-11-23 | 2021-02-26 | 森瑞斯生物科技(深圳)有限公司 | Saccharomyces cerevisiae strain for high yield of cannabigerol and construction method and application thereof |
| US20210071209A1 (en) * | 2019-02-25 | 2021-03-11 | Ginkgo Bioworks, Inc. | Biosynthesis of cannabinoids and cannabinoid precursors |
-
2021
- 2021-07-13 CN CN202110791234.2A patent/CN113528365B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160298151A1 (en) * | 2015-04-09 | 2016-10-13 | Sher Ali Butt | Novel Method for the cheap, efficient, and effective production of pharmaceutical and therapeutic api's intermediates, and final products |
| CN109963941A (en) * | 2016-09-20 | 2019-07-02 | 22世纪公司 | For manipulating the Trichome specific promoters of the cannboid in glandular hairs He other compounds |
| US20190225975A1 (en) * | 2016-09-20 | 2019-07-25 | 22Nd Century Limited, Llc | Trichome specific promoters for the manipulation of cannabinoids and other compounds in grandular trichomes |
| US20190300888A1 (en) * | 2017-04-27 | 2019-10-03 | The Regents Of The University Of California | Microorganisms and methods for producing cannabinoids and cannabinoid derivatives |
| CN110914416A (en) * | 2017-04-27 | 2020-03-24 | 加州大学董事会 | Microorganisms and methods for producing cannabinoids and cannabinoid derivatives |
| US20200165644A1 (en) * | 2017-07-12 | 2020-05-28 | Biomedican, Inc. | Production of cannabinoids in yeast |
| US20210071209A1 (en) * | 2019-02-25 | 2021-03-11 | Ginkgo Bioworks, Inc. | Biosynthesis of cannabinoids and cannabinoid precursors |
| WO2020198679A1 (en) * | 2019-03-27 | 2020-10-01 | Rynetech Bio, Inc. | Biosynthetic cannabinoid production in engineered microorganisms |
| WO2021034848A1 (en) * | 2019-08-18 | 2021-02-25 | Ginkgo Bioworks, Inc. | Biosynthesis of cannabinoids and cannabinoid precursors |
| CN112410235A (en) * | 2020-11-23 | 2021-02-26 | 森瑞斯生物科技(深圳)有限公司 | Saccharomyces cerevisiae strain for high yield of cannabigerol and construction method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| THIES GÜLCK,J K: "Synthetic Biology of Cannabinoids and Cannabinoid Glucosides in Nicotiana benthamiana and Saccharomyces cerevisiae", 《JOURNAL OD NATURAL PRODUCTS》 * |
| XIAOZHOU LUO: "Complete biosynthesis of cannabinoids and their unnatural analogues in yeast", 《NATURE》 * |
| 陈璇: "大麻植物中大麻素成分研究进展", 《植物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114657078A (en) * | 2022-01-27 | 2022-06-24 | 森瑞斯生物科技(深圳)有限公司 | Construction method and application of high-yield cannabidiolic acid saccharomyces cerevisiae strain |
| CN114657078B (en) * | 2022-01-27 | 2024-04-02 | 森瑞斯生物科技(深圳)有限公司 | Construction method and application of saccharomyces cerevisiae strain for high yield of cannabidiol |
| CN116891808A (en) * | 2023-07-12 | 2023-10-17 | 森瑞斯生物科技(深圳)有限公司 | Construction method and application of saccharomyces cerevisiae strain of cannabidiol synthase with subcellular structure positioning |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113528365B (en) | 2023-04-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110747178B (en) | Application of tripterygium wilfordii cytochrome p450 oxidase in preparation of abietane-type diterpene compound | |
| CN108795789A (en) | A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application | |
| JP2020503888A (en) | Recombinant yeast and use thereof | |
| CN116987603A (en) | Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof | |
| CN114591923B (en) | Cannabidiol synthetase mutant and construction method and application thereof | |
| CN113528365B (en) | Recombinant saccharomyces cerevisiae for producing cannabidiol, construction method and application thereof | |
| WO2021088370A1 (en) | Highly efficient and controllable expression system for endogenous piggybacking exogeneous genes | |
| CN114657078B (en) | Construction method and application of saccharomyces cerevisiae strain for high yield of cannabidiol | |
| CN115786389A (en) | Saccharomyces cerevisiae engineering bacterium for high-yield santalol as well as construction method and application thereof | |
| CN112175848A (en) | Patchouli alcohol production yeast strain and construction method and application thereof | |
| CN116904412B (en) | Construction method and application of saccharomyces cerevisiae strain with optimized cannabis diphenolic acid synthetase sequence | |
| CN109097342A (en) | Mould middle 11 B-hydroxylase of steroid of Absidia and its encoding gene and application | |
| CN117229934A (en) | Genetically engineered bacterium for synthesizing carotenoid, construction method and application thereof | |
| CN116396876A (en) | Saccharomyces cerevisiae engineering bacteria for producing ginsenoside Rd and construction method thereof | |
| CN110684795A (en) | Construction method of monascus purpureus comp50904_ c4 gene overexpression strain | |
| CN116731886A (en) | Engineering bacterium for producing glycosylated astaxanthin as well as construction method and application thereof | |
| CN106893726B (en) | Promoter and recombinant yeast strain | |
| CN113846111B (en) | Construction method and application of monascus purpureus comp53355_c10 gene overexpression strain | |
| CN113005130B (en) | Tanshinone IIA synthase gene and application thereof | |
| CN113956990A (en) | Recombinant saccharomyces cerevisiae for producing dihydronilotinib as well as preparation method and application thereof | |
| CN111647589A (en) | Euphorbia dienol synthase and coding gene and application thereof | |
| CN110551702A (en) | Recombinant aspergillus tubingensis tannase and expression and application thereof | |
| CN112481290B (en) | Method for improving citric acid fermentation production level based on morphological gene co-interference | |
| CN115927280B (en) | Horse chestnut 2, 3-oxidation squalene cyclase and encoding gene and application thereof | |
| CN114717124B (en) | Saccharomyces cerevisiae engineering strain for high-yield ergosterol, construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |