CN116731886A

CN116731886A - Engineering bacterium for producing glycosylated astaxanthin as well as construction method and application thereof

Info

Publication number: CN116731886A
Application number: CN202211577714.XA
Authority: CN
Inventors: 刘振; 陈静; 毛相; 朝姜宏
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2022-12-09
Filing date: 2022-12-09
Publication date: 2023-09-12

Abstract

The invention relates to engineering bacteria for producing glycosylated astaxanthin, a construction method and application thereof, and belongs to the technical field of fermentation engineering. The invention discloses an engineering bacterium for producing glycosylated astaxanthin, which is named OUC-AdGHB1-7CJ and is preserved in China general microbiological culture Collection center (CGMCC) No.25446 in the year 08 and 01 of 2022, and is classified as yarrowia lipolytica Yarrowia lipolytica. The engineering bacteria are applied to the preparation of glycosylated astaxanthin. The invention also discloses a construction method of the engineering bacteria. The engineering bacteria for producing glycosylated astaxanthin can achieve the yield of glycosylated astaxanthin of 27.274mg/L. The invention provides feasibility for the high-efficiency synthesis of other glycosylated carotenoids in microorganisms, and lays a foundation for the industrial production of glycosylated astaxanthin.

Description

Engineering bacterium for producing glycosylated astaxanthin as well as construction method and application thereof

Technical Field

The invention relates to engineering bacteria for producing glycosylated astaxanthin, a construction method and application thereof, and belongs to the technical field of fermentation engineering.

Background

The glycosylated astaxanthin, also called astaxanthin glucoside, is a rare natural carotenoid, and is formed by dehydrating and condensing astaxanthin and two molecules of glucose under the catalysis of glycosyltransferase CrtX. Astaxanthin has strong oxidation resistance and red color-imparting property, is the only carotenoid which can penetrate the blood brain and blood retina barrier and has positive effects on the central nerve and brain function, and has wide application in the industries of food, feed, pharmacy and cosmetics. However, since astaxanthin has hydrophobicity, it is limited in application, and glycosylated astaxanthin can enhance molecular polarity through glycosylation, has reduced hydrophobicity, and is more easily absorbed by human body as food additives and drugs. In addition, glycosylation of carotenoids also results in structural diversity and other benefits such as increased bioavailability, increased efficacy as food supplements and pharmaceuticals, improved photostability and bioactivity (e.g., antioxidant activity) of carotenoids.

The distribution of glycosylated astaxanthin in nature is rare (mainly in some bacteria), and there is still a lack of research on the properties of glycosylated astaxanthin, and little is known about the health effects of human or animals. Naturally occurring synthetic glycosylated astaxanthin is present in nature in very low levels and is difficult to extract and isolate. Biosynthesis is an effective way to obtain glycosylated astaxanthin by metabolic engineering, but to date, biosynthesis of carotenoid glycosides in E.coli and several natural microorganisms has been achieved only in a few studies which have produced detectable carotenoid glycosides far from the minimum requirements for industrial use.

Yarrowia lipolytica (Yarrowia lipolytica) is an unconventional yeast, which has been approved by the U.S. FDA as strain GRAS (generally recognized as safe), which has a broad substrate spectrum, tolerance to various environmental stresses, sufficient intracellular acetyl-CoA supply, high density fermentation, safety to humans, and other characteristics, and has recently received much attention in the field of synthetic biology.

Disclosure of Invention

Aiming at the prior art, in order to realize the industrial production of the glycosylated astaxanthin, the invention constructs engineering bacteria for producing the glycosylated astaxanthin, and provides a construction method and application thereof in preparing the glycosylated astaxanthin. The invention also obtains the engineering bacteria for producing glycosylated astaxanthin through screening the engineering bacteria.

The invention is realized by the following technical scheme:

the engineering bacteria for producing glycosylated astaxanthin are named OUC-AdGHB1-7CJ, and are preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of No.25446 in the year 2022 and classified as yarrowia lipolytica Yarrowia lipolytica.

The biological characteristics of the engineering bacteria for producing glycosylated astaxanthin are as follows: YPD solid medium is cultured at 30deg.C for 24 hr, and the colony is round, brick red, wrinkled, edge hairy, and dry, and exists in both yeast and mycelium forms.

The engineering bacteria for producing glycosylated astaxanthin are applied to the preparation of glycosylated astaxanthin. The engineering bacteria for producing glycosylated astaxanthin can efficiently prepare glycosylated astaxanthin, is far superior to other transformants, and has great advantages and application prospects when used for preparing glycosylated astaxanthin.

Further, in specific application, the engineering bacteria for producing the glycosylated astaxanthin are cultured, and the glycosylated astaxanthin is obtained by extraction. The specific mode of the culture can be as follows: selecting a colony of engineering bacteria producing glycosylated astaxanthin, inoculating the colony into YPD culture medium, and culturing to obtain seed culture solution; inoculating the seed culture solution into YPD culture medium, and culturing to obtain fermentation liquor; and (3) taking fermentation liquor, centrifuging to obtain bacterial precipitate and fermentation supernatant, and extracting the bacterial precipitate to obtain the glycosylated astaxanthin.

Further, the culture conditions of the seed culture solution are as follows: culturing at 30℃for 24 hours at 200 rpm.

Further, the seed culture solution was inoculated in an amount of 2% (volume ratio).

Further, the culture conditions of the fermentation broth are as follows: culturing at 30℃for 84 hours at 200 rpm.

The YPD medium is a commercial medium existing in the prior art, and comprises the following components: 1% of yeast extract, 2% of peptone, 2% of glucose and the balance of water.

An engineering bacterium for producing glycosylated astaxanthin, the host is yarrowia lipolytica for producing beta-carotene, and the genome of the engineering bacterium comprises the following genes (1) (2) (5) or (3) (4) (5):

(1) the nucleotide sequence of the coding gene HBFD of carotenoid 4-hydroxy-beta-ring 4-dehydrogenase (HBFD) is shown as SEQ ID NO. 2;

(2) the coding gene tr53-CBFD of carotenoid beta-ring 4-dehydrogenase (tr 53-CBFD) with chloroplast transit peptide removed has a nucleotide sequence shown in SEQ ID NO. 3; the promoter is an hp4d promoter, and the nucleotide sequence is shown in SEQ ID NO. 7;

(3) the nucleotide sequence of the coding gene crtZ of beta-carotene hydroxylase (crtZ) is shown in SEQ ID NO. 10;

(4) the nucleotide sequence of the coding gene crtW of beta-carotene ketolase (crtW) is shown as SEQ ID NO. 9;

(5) the nucleotide sequence of the coding gene crtX of glycosyltransferase (crtX) is shown in SEQ ID NO. 8.

Wherein CBFD and HBFD are derived from calendula officinalis (Adonis aestivali), crtW is derived from Brucella (Brevundimonas sp.SD212), crtZ and crtX are derived from Pantoea ananatis. The process for producing glycosylated astaxanthin comprises the following steps: beta-carotene is converted to astaxanthin by CBFD and HBFD or CrtW and CrtZ, and then converted to glycosylated astaxanthin by CrtX.

The construction method of the engineering bacteria for producing glycosylated astaxanthin comprises the following steps:

(1) Constructing a recombinant plasmid containing the following nucleotide fragments: the hp4d promoter; tr53-CBFD-RIDD fragment; an HBFD-RIAD fragment;

wherein RIDD is the coding gene of short peptide RIDD, and the nucleotide sequence is shown as SEQ ID NO. 5; RIAD is the coding gene of short peptide RIAD, and the nucleotide sequence is shown as SEQ ID NO. 6;

or: constructing a recombinant plasmid containing the following nucleotide fragments: crtZ, crtW;

(2) Constructing a recombinant plasmid containing crtX;

(3) Transforming the recombinant plasmid constructed in the step (1) into yarrowia lipolytica producing beta-carotene to obtain a transformant; and (3) transforming the transformant by using the recombinant plasmid constructed in the step (2) to obtain the engineering bacteria for producing glycosylated astaxanthin.

SEQ ID NO.3：

5’-ATGTCTGTGGCTGGAAGAACTCGAAATCTGGACATCCCCCAAATCGAGGAGGAGGAGGAGAACGTGGAGGAG CTGATTGAGCAGACCGACTCTGACATCGTGCACATCAAGAAGACCCTGGGCGGCAAGCAGTCTAAGCGACCCACTGGATCTATCGTGGCCCCTGTGTCTTGCCTGGGCATTCTGTCTATGATCGGCCCCGCCGTTTATTTCAAGTTCTCTCGACTGATGGAGGGCGGCGACATCCCCGTTGCAGAGATGGGCATTACTTTTGCTACCTTTGTGGCCGCCGCCGTGGGCACTGAATTTCTGTCTGCTTGGGTGCACAAGGAGCTGTGGCACGAGTCTCTGTGGTACATCCACAAGTCTCACCACCGATCTCGAAAGGGCCGATTCGAGTTCAACGACGTGTTCGCCATCATCAACGCCCTGCCCGCTATTGCCCTTATCAACTACGGCTTCTCTAACGAGGGCCTGCTGCCCGGAGCTTGTTTTGGAGTTGGACTGGGAACCACTGTGTGTGGCATGGCTTATATCTTTCTGCACAACGGCCTGTCTCACCGACGATTCCCCGTGTGGCTGATTGCCAATGTGCCCTATTTCCACAAGCTGGCCGCCGCCCATCAAATCCATCATTCTGGAAAGTTTCAGGGCGTGCCCTTTGGCCTGTTTCTGGGCCCTAAAGAGCTGGAGGAGGTGCGAGGAGGAACTGAGGAGCTGGAAAGAGTGATTTCTAGAACCACCAAGCGAACCCAGCCCTCTACCTAA-3’。

SEQ ID NO.4：

5’-ATGGGCGGAACTGGCAAAGTGGGAGGATCTACTGCCCTGGCTCTGTCTAAATTCTCTCCCGACCTGCGACTG GTGATCGGCGGAAGAAATCGAGAGAAAGGCGACGCCGTGGTGTCTAAGCTGGGCGAAAATTCTGAGTTCGTGGAGGTGAACGTGGACTCTGTGCGATCTCTGGAGTCTGCCCTGGAGGACGTGGATCTGGTGGTGCATGCTGCTGGACCTTTTCAACAAGCTGAGAAGTGTACCGTGCTGGAGGCTGCCATTTCTACCCGAACTGCCTACGTGGACGTGTGCGACAATACCTCTTACTCTATGCAGGCCAAGTCTTTCCACGACAAGGCCGTGGCCGCCAATGTGCCTGCCATTACTACTGCCGGAATCTTCCCTGGCGTGTCTAACGTGATCGCCGCCGAACTGGTGAGATCTGCTCGAGATGAAAACACCGAGCCCCAGAGACTGAGATTTTCTTACTTCACCGCCGGCTCTGGCGGCGCTGGACCTACTTCTCTGGTGACTTCTTTTCTGCTGCTGGGCGAGGAGGTGGTGGCCTATTCTGAAGGAGAGAAAGTGGAGCTGAAACCCTACACCGGCAAGCTGAACATCGACTTCGGCAAGGGCGTGGGCAAACGAGATGTGTATCTGTGGAACCTGCCCGAGGTGCGATCTGGCCATGAAATTCTGGGCGTGCCTACCGTGTCTGCCAGATTTGGCA CTGCCCCCTTTTTTTGGAACTGGGCCATGGTGGCCATGACCACCCTGCTGCCTCCTGGAATTCTGCGAGATAGAAATAAAATCGGCATGCTGGCCAACTTCGTGTACCCCTCTGTGCAGATCTTCGACGGCATCGCCGGAGAGTGTCTGGCCATGAGAGTGGATCTGGAGTGCGCCAATGGAAGAAACACCTTCGGCATCCTGTCTCACGAGCGACTGTCTGTGCTGGTGGGCACTTCTACTGCCGTGTTTGCCATGGCCATCCTGGAGGGATCTACCCAGCCTGGCGTTTGGTTTCCTGAAGAACCCGGCGGAATTGCCATCTCTGATCGAGAGCTGCTGCTGCAGAGAGCCTCTCAGGGAGCTATTAATTTCATCATGAAGCAG-3’。

SEQ ID NO.5：

5’-GGAGGAGGCGGATCTGGAGGAGGAGGATCTGGAGGAGGAGGATGCGGATCTCTGAGAGAATGTGAACTGTAT GTGCAGAAGCACAACATCCAGGCCCTGCTGAAGGACTCTATCGTGCAGCTGTGCACCGCCCGACCTGAAAGACCTATGGCTTTTCTGAGAGAGTACTTCGAGCGACTGGAGAAGGAGGAGGCCAAGTAA-3’。

SEQ ID NO.6：

5’-GGAGGAGGAGGATCTGGAGGAGGAGGATCTGGAGGAGGAGGATGCGGACTGGAACAATATGCTAATCAGCTG GCTGATCAGATTATCAAGGAGGCCACCGAGGGCTGCTAA-3’。

SEQ ID NO.7：

5’-GCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTA CATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCTGAGGTGTCTCACAAGTGCCGTGCAGTCCCGCCCCCACTTGCTTCTCTTTGTGTGTAGTGTACGTACATTATCGAGACCGTTGTTCCCGCCCACCTCGATCCGGCATGCACTGATCACGGGCAAAAGTGCGTATATATACAAGAGCGTTTGCCAGCCACAGATTTTCACTCCACACACCACATCACACATACAACCACACACATCCACGATG-3’。

SEQ ID NO.8：

5’-ATGAGCCATTTCGCGGCGATCGCACCGCCTTTTTACAGCCATGTTCGCGCATTACAGAATCTCGCTCAGGAA CTGGTCGCGCGCGGTCATCGGGTGACCTTTATTCAGCAATACGATATTAAACACTTGATCGATAGCGAAACCATTGGATTTCATTCCGTCGGGACAGACAGCCATCCCCCCGGCGCGTTAACGCGCGTGCTACACCTGGCGGCTCATCCTCTGGGGCCGTCAATGCTGAAGCTCATCAATGAAATGGCGCGCACCACCGATATGCTGTGCCGCGAACTCCCCCAGGCATTTAACGATCTGGCCGTCGATGGCGTCATTGTTGATCAAATGGAACCGGCAGGCGCGCTCGTTGCTGAAGCACTGGGACTGCCGTTTATCTCTGTCGCCTGCGCGCTGCCTCTCAATCGTGAACCGGATATGCCCCTGGCGGTTATGCCTTTCGAATACGGGACCAGCGACGCGGCTCGCGAACGTTATGCCGCCAGTGAAAAAATTTATGACTGGCTAATGCGTCGTCATGACCGTGTCATTGCCGAACACAGCCACAGAATGGGCTTAGCCCCCCGGCAAAAGCTTCACCAGTGTTTTTCGCCACTGGCGCAAATCAGCCAGCTTGTTCC TGAACTGGATTTTCCCCGCAAAGCGTTACCGGCTTGTTTTCATGCCGTCGGGCCTCTGCGCGAAACGCACGCACCGTCAACGTCTTCATCCCGTTATTTTACATCCTCAGAAAAACCCCGGATTTTCGCCTCGCTGGGCACGCTTCAGGGACACCGTTATGGGCTGTTTAAAACGATAGTGAAAGCCTGTGAAGAAATTGACGGTCAGCTCCTGTTAGCCCACTGTGGTCGTCTTACGGACTCTCAGTGTGAAGAGCTGGCGCGAAGCCGTCATACACAGGTGGTGGATTTTGCCGATCAGTCAGCCGCGCTGTCTCAGGCGCAGCTGGCGATCACCCACGGCGGCATGAATACGGTACTGGACGCGATTAATTACCGGACGCCCCTTTTAGCGCTTCCGCTGGCCTTTGATCAGCCCGGCGTCGCGTCACGCATCGTTTATCACGGCATCGGCAAGCGTGCTTCCCGCTTTACCACCAGCCATGCTTTGGCTCGTCAGATGCGTTCATTGCTGACCAACGTCGACTTTCAGCAGCGCATGGCGAAAATCCAGACAGCCCTTCGTTTGGCAGGGGGCACCATGGCCGCTGCCGATATCATTGAGCAGGTTATGTGCACCGGTCAGCCTGTCTTAAGTGGGAGCGGCTATGCAACCGCATTATGA-3’。

SEQ ID NO.9：

5’-ATGACCGCCGCCGTCGCCGAGCCCCGAATCGTCCCCCGACAGACCTGGATTGGCCTGACCCTGGCCGGCATG ATTGTGGCCGGCTGGGGCTCCCTCCACGTCTACGGTGTCTACTTCCACCGATGGGGCACCTCTTCCCTCGTGATTGTTCCCGCTATTGTCGCTGTTCAAACCTGGCTGTCTGTTGGACTTTTTATTGTCGCTCACGACGCCATGCATGGTTCTCTGGCTCCTGGTAGACCCCGACTTAACGCTGCCGTTGGTAGATTGACCTTGGGTCTCTACGCTGGCTTTAGATTTGATAGGCTGAAAACCGCACACCATGCCCATCACGCCGCTCCTGGTACTGCTGATGATCCTGATTTTTATGCTCCTGCACCTCGTGCTTTTCTCCCTTGGTTCCTCAACTTCTTCCGAACCTACTTCGGCTGGCGAGAGATGGCCGTCCTGACCGCTCTCGTGCTGATCGCCCTGTTCGGCCTCGGCGCCCGACCCGCCAACCTGCTGACCTTCTGGGCCGCCCCCGCCCTCCTGTCCGCCCTGCAGCTGTTCACCTTCGGCACCTGGCTCCCCCACCGACACACCGACCAGCCCTTCGCCGACGCTCACCACGCCCGATCCTCTGGTTACGGCCCCGTCCTGTCGCTGCTGACCTGCTTCCACTTCGGCCGACACCACGAGCACCACCTGACCCCCTGGCGACCCTGGTGGCGACTGTGGCGAGGTGAGTCGTAA-3’。

SEQ ID NO.10：

5’-ATGCTGTGGATTTGGAACGCCCTGATTGTCTTTGTTACTGTTATCGGTATGGAAGTGATTGCTGCTCTCGCT CACAAGTACATTATGCACGGCTGGGGCTGGGGCTGGCACCTGTCCCACCACGAGCCCCGAAAGGGCGCCTTCGAGGTCAACGACCTGTACGCCGTCGTCTTCGCCGCCCTGTCCATCCTGCTGATCTACCTGGGCTCCACCGGCATGTGGCCACTGCAGTGGATCGGTGCCGGAATGACCGCCTACGGCCTGCTGTACTTCATGGTCCACGACGGCCTGGTCCACCAGCGATGGCCCTTCCGATACATCCCCCGAAAGGGCTACCTGAAGCGACTGTACATGGCCCACCGAATGCACCACGCCGTCCGAGGCAAGGAGGGCTGCGTCTCTTTCGGCTTCCTGTACGCCCCCCCCCTGTCCAAGCTGCAGGCCACCCTGCGAGAGCGACATGGTGCTAGAGCTGGCGCCGCCCGAGACGCTCAGGGAGGTGAGGATGAGCCTGCTTCCGGAAAGTAA-3’。

The engineering bacteria for producing glycosylated astaxanthin are applied to the preparation of glycosylated astaxanthin. In specific application, engineering bacteria for producing glycosylated astaxanthin are cultured, and the glycosylated astaxanthin is obtained by extraction.

A method of preparing glycosylated astaxanthin: culturing the engineering bacteria for producing glycosylated astaxanthin or engineering bacteria for producing glycosylated astaxanthin constructed by the method, and extracting to obtain glycosylated astaxanthin.

Further, the method for preparing the glycosylated astaxanthin comprises the following steps: inoculating engineering bacteria producing glycosylated astaxanthin into a culture medium, and culturing to obtain seed culture solution; inoculating the seed culture solution into a culture medium, and culturing to obtain a fermentation broth; and (3) taking fermentation liquor, centrifuging to obtain bacterial precipitate and fermentation supernatant, and extracting the bacterial precipitate to obtain the glycosylated astaxanthin. The conditions for the culture of the seed culture solution may be: culturing at 30 ℃ for 24 hours at 200 rpm; the seed culture solution may be inoculated in an amount of 2%; the medium may be YPD medium; the culture conditions of the fermentation broth may be: culturing at 30℃for 84 hours at 200 rpm.

The invention synthesizes carotenoid by taking yarrowia lipolytica as a host, and has the unique advantages: first, yarrowia lipolytica can synthesize large amounts of acetyl-CoA as a precursor to the MVA pathway, which is more conducive to carotenoid accumulation. Second, large amounts of oil accumulate in yeast cells, forming a good hydrophobic space, which can potentially store lipophilic carotene. Again, yarrowia lipolytica has low requirements on the growth environment, can use a variety of low cost carbon sources as its culture medium, has high osmotic pressure and has very strong tolerance to various pH values. In addition, the genetic background of the strain is clear, relatively perfect genetic metabolism reconstruction tools are correspondingly developed in recent years, and the strain is an ideal industrial host strain for accumulating carotenoid such as glycosylated astaxanthin.

The present invention produces glycosylated astaxanthin for the first time in yarrowia lipolytica. Under the combined action of CBFD and HBFD or CrtW and CrtZ, beta-carotene can be synthesized into astaxanthin, and the synthesis path is unique compared with the synthesis path of astaxanthin in microorganisms and algae, and is only verified in escherichia coli at present. HBFD acts only on carotenoids with 4-hydroxy-beta ring, while CBFD does not hydroxylate carbon number 3 of unmodified beta ring or 4-hydroxy-beta ring, which property enables strict control of the order of catalytic reaction, which contributes to efficient synthesis of astaxanthin, and no intermediate product with hydroxyl group is produced, which is very beneficial for production and extraction purification of glycosylated astaxanthin.

The invention introduces the gene needed by synthesizing glycosylated astaxanthin into yarrowia lipolytica producing beta-carotene by means of synthetic biology technology, obtains the strain for producing the glycosylated astaxanthin, regulates and controls the yield of the astaxanthin in the engineering strain by metabolic engineering strategies, finally improves the yield of the glycosylated astaxanthin produced by yeast fermentation, and the screened glycosylated astaxanthin yield of the engineering strain OUC-AdGHB1-7CJ for producing the glycosylated astaxanthin reaches 27.274mg/L, is the engineering strain with the highest yield of the glycosylated astaxanthin, provides feasibility for the efficient synthesis of other glycosylated carotenoids in microorganisms and lays a foundation for industrial production.

The various terms and phrases used herein have the ordinary meaning known to those skilled in the art.

Drawings

The invention relates to an engineering bacterium for producing glycosylated astaxanthin, which is named OUC-AdGHB1-7CJ, the preservation date is 2022, 08 and 01, the preservation unit is China general microbiological culture Collection center, the preservation number is CGMCC No.25446, the classification is named yarrowia lipolytica Yarrowia lipolytica, and the preservation address is the national institute of microbiology, national academy of sciences, national institute of sciences, no.3, beijing, chaoyang, and the post code is 100101.

Fig. 1: liquid phase detection diagrams of fermentation samples of F-A1 and F-A2 strains.

Fig. 2: F-A3, F-A4, F-A5, F-X1, F-X2 and F-X3 strain fermentation sample liquid phase detection diagram.

Fig. 3: the astaxanthin yield measurement results of F-A2, F-A3 and F-A4 strains are shown schematically.

Fig. 4: the astaxanthin yield measurement result of the F-A5 strain is schematically shown.

Fig. 5: the result of the F-X3 strain glycosylation astaxanthin yield measurement is schematically shown.

Fig. 6: the results of the measurement of the glycosylated astaxanthin yield of F-X1, F-X2 and F-X3 strains are schematically shown.

Detailed Description

The invention is further illustrated below with reference to examples. However, the scope of the present invention is not limited to the following examples. Those skilled in the art will appreciate that various changes and modifications can be made to the invention without departing from the spirit and scope thereof.

The instruments, reagents and materials used in the examples below are conventional instruments, reagents and materials known in the art and are commercially available. The experimental methods, detection methods, and the like in the examples described below are conventional experimental methods and detection methods known in the prior art unless otherwise specified.

The yarrowia lipolytica strain Polh related by the invention relates to a pMT015 plasmid which is given away by Qingdao bioenergy and engineering institute Wang Shian of China academy of sciences.

The strain F0 of the present invention is obtained by introducing carB (phytoene dehydrogenase) and carRP (tomato red cyclase/phytoene synthase) genes into yarrowia lipolytica Polh, and the beta-carotene yield is 21.2mg/L, and the specific construction method is as follows: the method comprises the steps of carrying out total gene synthesis of carB and carRP gene principal biological engineering (Shanghai) and taking the synthesized genes as templates, carrying out PCR amplification to obtain carB and carRP gene fragments, taking pMT015 plasmids as templates, carrying out PCR amplification to obtain plasmid frameworks, connecting by adopting a homologous recombination seamless splicing technology, transforming the recombinant plasmids into E.coli DH5 alpha competent cells, and extracting plasmids by using a rapid plasmid miniextraction kit. The plasmid was linearized by PCR and the linear DNA fragments were integrated into the yarrowia lipolytica genome by random insertion using chemical transformation. And (3) detecting and screening out the strain with the highest beta-carotene yield by high performance liquid chromatography, namely F0. Specific method references involved in constructing strain F0: zhang Guilin construction and control of the beta-carotene synthesis pathway in yarrowia lipolytica [ Shuoshi thesis ]. Qingdao: china university of ocean 2022.

The strain F1 is obtained by transforming an ERG12S gene, a modularized IDI-GGS1 gene, a modularized ERG20Y-GGS1 gene and an mvaE-mvaSMT gene derived from enterococcus faecalis (Enterococcus faecalis) into a strain F0, and detecting and screening the strain with the highest beta-carotene yield by high performance liquid chromatography, wherein the beta-carotene yield is 607.1mg/L. Specific construction method reference: zhang Guilin construction and control of the beta-carotene synthesis pathway in yarrowia lipolytica [ Shuoshi thesis ]. Qingdao: china university of ocean 2022.

The relevant strains and the constructed strains used in the present invention are substantially described in Table 1. Specific primers used in the present invention are shown in Table 2.

TABLE 1

Strain	Genotype description or purpose	Source
			E.coli DH5α	Clone plasmid	TsingKe
F0(Y.lipolytica PO1h-β)	carB-carRP	Laboratory construction
			F-A1-1	CBFD-HBFD-URA	Construction of the invention
F-A1-2	tr53-CBFD-tr45-HBFD-URA	Construction of the invention
			F-A2	tr53-CBFD-HBFD-URA	Construction of the invention
F-A3	tr53-CBFD-RIDD-HBFD-RIAD-URA	Construction of the invention
			F-A4	P _hp4d -tr53-CBFD-RIDD-HBFD-RIAD-URA	Construction of the invention
F-A5	crtW-crtZ-URA	Construction of the invention
			F-X1	tr53-CBFD-HBFD+crtX-URA	Construction of the invention
F-X2	P _hp4d -tr53-CBFD-RIDD-HBFD-RIAD+crtX-URA	Construction of the invention
			F-X3	crtW-crtZ-URA+crtX-URA	Construction of the invention
Pub4-cre	Cre plasmid	Laboratory construction

TABLE 2

EXAMPLE 1 construction of astaxanthin-producing Strain F-A1

The CBFD and the HBFD both catalyze the beta-carotene reaction to generate astaxanthin, so the embodiment further integrates CBFD and HBFD genes on the basis of engineering bacteria F0 for producing beta-carotene to construct a chassis strain for producing astaxanthin.

Construction of the pMT-1 plasmid

(1) CBFD gene from Marigold in summer performs codon optimization according to yarrowia lipolytica preference, and the optimized nucleotide sequence is shown as SEQ ID NO.1, and the gene fragment is artificially synthesized by Beijing Liuhua big Gene technology Co. The synthesized gene fragment is used as a template, and primers CBFD-1-F/CBFD-1-R and P525 are used for PCR amplification to obtain 921bp CBFD fragment.

The plasmid pMT015 is used as a template, a primer PMT-1-F/PMT-1-R is used for carrying out PCR amplification to obtain a 8422bp plasmid skeleton 1, a PCR recovery kit is used for recovery, and the recovered CBFD fragment and the plasmid skeleton 1 are connected by adopting a homologous recombination seamless splicing technology to obtain the plasmid pMT-a.

(2) HBFD gene from Marigold in summer is codon optimized according to yarrowia lipolytica preference, the optimized nucleotide sequence is shown as SEQ ID NO.2, and Beijing Liuhua big gene science and technology Co Ltd is entrusted to artificially synthesize the gene fragment. The synthesized gene fragment is used as a template, and primers HBFD-1-F/HBFD-1-R and P525 are used for PCR amplification to obtain a 1221bp HBFD fragment.

And (3) carrying out PCR amplification by using the plasmid pMT-a as a template and using a primer PMT-2-F/PMT-2-R to obtain a 9187bp plasmid skeleton 2, recovering by using a PCR recovery kit, and connecting the recovered HBFD fragment with the plasmid skeleton 2 by adopting a homologous recombination seamless splicing technology to obtain the plasmid pMT-1.

SEQ ID NO.1：

5’-ATGGCAATTTCAGTGTTCAGTTCAGGTTATTCTTTCTACAAGAATCTCTTGTTGGACTCAAAACCAAATATT CTCAAACCCCCATGCCTGCTATTCTCTCCAGTTGTGATCATGTCGCCTATGAGAAAGAAAAAGAAACATGGTGATCCATGTATCTGCTCCGTTGCAGGGAGAACAAGGAACCTTGATATTCCTCAAATTGAAGAAGAGGAAGAGAATGTGGAAGAACTAA TAGAACAGACCGATTCTGACATAGTGCATATAAAGAAAACACTAGGGGGGAAACAATCAAAACGGCCCACTGGCTCCATTGTCGCACCCGTATCTTGTCTTGGGATCCTTTCAATGATTGGACCTGCTGTTTACTTCAAGTTTTCACGGCTAATGGAGGGTGGAGATATACCTGTAGCAGAAATGGGGATTACGTTTGCCACCTTTGTTGCTGCTGCTGTTGGCACGGAGTTTTTGTCAGCATGGGTTCACAAAGAACTCTGGCACGAGTCTTTGTGGTACATTCACAAGTCTCACCATCGGTCACGAAAAGGCCGCTTCGAGTTCAATGATGTGTTTGCTATTATTAACGCGCTTCCCGCTATTGCTCTTATCAATTATGGATTCTCCAATGAAGGCCTCCTTCCTGGAGCGTGCTTTGGTGTCGGTCTTGGAACAACAGTCTGTGGTATGGCTTACATTTTTCTTCACAATGGCCTATCACACCGAAGGTTCCCAGTATGGCTTATTGCGAACGTCCCTTATTTCCACAAGCTGGCTGCAGCTCACCAAATACACCACTCAGGAAAATTTCAGGGTGTACCATTTGGCCTGTTCCTTGGACCCAAGGAATTGGAAGAAGTAAGAGGAGGCACTGAAGAGTTGGAGAGGGTAATCAGTCGTACAACTAAACGAACGCAACCATCTACC-3’。

SEQ ID NO.2：

5’-ATGGCTCCTGTGCTGCTGGGACTGAAGCCTACTCTGTCTACTGGCTCTGTGGTGAAGGAGACTAACGTGGGC TCTACCCTGGCCTCTCCTCTGAATAAAACCCAGAACTCTCGAGTGCTGGTGCTGGGCGGAACTGGCAAAGTGGGAGGATCTACTGCCCTGGCTCTGTCTAAATTCTCTCCCGACCTGCGACTGGTGATCGGCGGAAGAAATCGAGAGAAAGGCGACGCCGTGGTGTCTAAGCTGGGCGAAAATTCTGAGTTCGTGGAGGTGAACGTGGACTCTGTGCGATCTCTGGAGTCTGCCCTGGAGGACGTGGATCTGGTGGTGCATGCTGCTGGACCTTTTCAACAAGCTGAGAAGTGTACCGTGCTGGAGGCTGCCATTTCTACCCGAACTGCCTACGTGGACGTGTGCGACAATACCTCTTACTCTATGCAGGCCAAGTCTTTCCACGACAAGGCCGTGGCCGCCAATGTGCCTGCCATTACTACTGCCGGAATCTTCCCTGGCGTGTCTAACGTGATCGCCGCCGAACTGGTGAGATCTGCTCGAGATGAAAACACCGAGCCCCAGAGACTGAGATTTTCTTACTTCACCGCCGGCTCTGGCGGCGCTGGACCTACTTCTCTGGTGACTTCTTTTCTGCTGCTGGGCGAGGAGGTGGTGGCCTATTCTGAAGGAGAGAAAGTGGAGCTGAAACCCTACACCGGCAAGCTGAACATCGACTTCGGCAAGGGCGTGGGCAAACGAGATGTGTATCTGTGGAACCTGCCCGAGGTGCGATCTGGCCATGAAATTCTGGGCGTGCCTACCGTGTCTGCCAGATTTGGCACTGCCCCCTTTTTTTGGAACTGGGCCATGGTGGCCATGACCACCCTGCTGCCTCCTGGAATTCTGCGAGATAGAAATAAAATCGGCATGCTGGCCAACTTCGTGTACCCCTCTGTGCAGATCTTCGACGGCATCGCCGGAGAGTGTCTGGCCATGAGAGTGGATCTGGAGTGCGCCAATGGAAGAAACACCTTCGGCATCCTGTCTCACGAGCGACTGTCTGTGCTGGTGGGCACTTCTACTGCCGTGTTTGCCATGGCCATCCTGGAGGGATCTACCCAGCCTGGCGTTTGGTTTCCTGAAGAACCCGGCGGAATTGCCATCTCTGATCGAGAGCTGCTGCTGCAGAGAGCCTCTCAGGGAGCTATTAATTTCATCATGAAGCAG-3’。

Construction of astaxanthin-producing Strain F-A1

Linearizing pMT-1 plasmid by PCR, transforming the linearized target fragment into strain F0, obtaining engineering bacterium F-A1, fermenting, and measuring the yields of astaxanthin and other carotenoids, wherein the method comprises the following specific steps:

(A) Plasmid linearization

The target fragment was linearized by PCR using the pMT-1 plasmid as a template and the primer 1-F/1-R, and recovered using a PCR recovery kit to obtain the linearized target fragment.

(B) Transformation

The recovered linearized fragment was chemically transformed into a beta-carotene producing yarrowia lipolytica strain F0 by the following steps:

(1) F0 was inoculated into YPD medium (10 mL) and cultured in a temperature-controlled shaking table at 30℃and 200rpm for 36h;

(2) Collecting a proper amount of thalli, re-suspending with about l of 1 xTE buffer, centrifuging for 2min, discarding the supernatant, re-suspending with about 1mL of 0.1M LiAc solution, standing and culturing at 30 ℃ for 1h, centrifuging for 2min at 3000g, and discarding the supernatant;

(3) About 200. Mu.L of 0.1M LiAc solution was added to the solution and the solution was resuspended to a suitable concentration (see e.coli DH 5. Alpha. Et al competent concentration) and dispensed in 40. Mu.L/tube;

(4) 3 mu L of fish sperm DNA and 3 mu g of linear target fragment are added into each tube in a competent way, the mixture is blown and evenly mixed, and the mixture is subjected to stationary culture at 30 ℃ for 15min;

(5) Add 350. Mu.L of PEG-LiAc (315. Mu.L of 50% PEG and 35. Mu.L of 1M LiAc) and 16. Mu.L of 1M DTT, and incubate at 30℃for 1h;

(6) Adding 40 μl of DMSO, heat-shocking at 39deg.C for 10min, adding 600 μl of LiAc, and standing at room temperature for 30min;

(7) Centrifuging at 3000g for 2min, discarding part of supernatant, mixing the rest bacterial liquid about 100 μl, spreading on SD-URA plate, and culturing in 30 deg.C incubator for 3 days;

(8) And (3) picking 20 single colonies with darker red color from the long fungus URA plate, and inoculating the single colonies into a new SD-URA plate, and culturing the single colonies in an incubator at 30 ℃ for 24 hours in an inverted mode.

(C) Determination of bacterial Strain fermentation and cell Dry weight

10 colonies were picked from the SD-URA plate of (8) above and inoculated into 10mL of YPD medium, respectively, and cultured at 30℃and 200rpm for 24 hours to obtain seed culture solutions. 1mL of the seed culture was added to YPD medium (50 mL), and the mixture was cultured at 30℃and 200rpm for 84 hours.

And (3) taking 1mL of bacterial liquid from the fermented engineering strain, preserving the bacterial liquid in a bacteria-preserving tube containing 500 mu L of 50% glycerol at the temperature of minus 20 ℃, adding 2mL of bacterial liquid into 2mL of weighed EP tube, centrifuging at 12000rpm for 2min, discarding the supernatant, uncapping, placing the bacterial liquid in an oven at the temperature of 80 ℃ for 24h, weighing, continuing placing for 1h, weighing again until the weight is unchanged, taking out the bacterial liquid, and calculating the dry weight of the cells according to the weight change.

(D) Extraction and detection of fermentation products

Adding 500 mu L of the residual bacterial liquid into a 2mL grinding tube, centrifuging at 12000rpm for 3min, discarding the supernatant, adding 1mL of methyl tertiary butyl ether, uniformly mixing, grinding in a grinding machine according to the procedures of 65Hz,120s/0Hz,10s and 10 cycles, centrifuging at 12000rpm for 3min after the grinding is finished, taking a supernatant solution into a 5mL centrifuge tube, drying the supernatant by adopting a nitrogen blowing method, re-dissolving the supernatant by using 500 mu L of acetone solution, and filtering the re-dissolved liquid by using a 0.22 mu m organic filter membrane for detection.

The fermentation product is detected by high performance liquid chromatography. The detection conditions are chromatographic columns: c18 liquid chromatography column; column temperature: 35 ℃; flow rate: 0.9mL/min; sample injection volume: 20. Mu.L; detection wavelength: 470nm; detection time: 45min; mobile phase: water a, acetonitrile B, tetrahydrofuran (1:1), elution gradient as follows (min-%) a: 0-95;5-95;15-20 parts; 24-20;25-0;35-0;40-95;45-95.

The peak-out time of glycosylated astaxanthin, beta-carotene and lycopene is 18.4min, 23.2 min, 34.0 min and 33.3min respectively.

Accurately weighing a certain amount of astaxanthin standard substances, dissolving with acetone, diluting with different times, measuring peak areas of different concentration standard substances by high performance liquid chromatography with the method, and drawing standard curve according to standard substance concentration and peak areas. Substituting the peak area of the extracted sample of the bacteria to be detected, which is measured by HPLC, into a standard curve to obtain the astaxanthin content (mg/L, specifically the astaxanthin content in each liter of bacteria liquid) of the bacteria to be detected.

The liquid phase detection result shows that 10 strains do not produce astaxanthin, and the liquid phase detection diagram of the fermentation liquid of one strain F-A1 is shown in figure 1. Considering that CBFD and HBFD were derived from plants, the complete protein sequence was analyzed using TargetP-2.0, the sequence of the chloroplast transit peptide of CBFD and HBFD was predicted, and CBFD and HBFD may exist in the chloroplast transit peptide to affect enzyme expression. Thus, in order to obtain astaxanthin-producing strains, the chloroplast transit peptide sequences of CBFD and HBFD were removed in the following experiments.

EXAMPLE 2 construction of astaxanthin-producing Strain F-A2 with chloroplast transit peptide removed

Construction of CBFD and HBFD plasmid pMT-2 with chloroplast transit peptide removed

The amino acid sequences of CBFD and HBFD are predicted by using a TargetP-2.0 website, the chloroplast transit peptide sequences of the CBFD and the HBFD are removed respectively according to the prediction result, a tr53-CBFD fragment of 768bp is obtained by using a primer CBFD-2-F/CBFD-2-R to amplify by taking a CBFD gene as a template (the nucleotide sequence with the chloroplast transit peptide sequence removed is shown as SEQ ID NO. 3), and a tr45-HBFD fragment is obtained by using a primer HBFD-2-F/HBFD-2-R to amplify by taking the HBFD gene as a template (the nucleotide sequence with the chloroplast transit peptide sequence removed is shown as SEQ ID NO. 4).

The primer PMT-3-F/PMT-3-R is used for amplifying by taking the plasmid pMT-1 as a template to obtain a 9507bp plasmid skeleton 3, the amplified tr53-CBFD fragment and the plasmid skeleton 3 are subjected to PCR recovery, and the PMT-2-1 is constructed by adopting a homologous recombination seamless splicing technology for connection. The primer PMT-10-F/PMT-10-R is used for amplifying the plasmid pMT-2-1 as a template to obtain a plasmid skeleton 10, the amplified tr45-HBFD fragment and the plasmid skeleton 10 are subjected to PCR recovery, and the PMT-2-2 is constructed by adopting a homologous recombination seamless splicing technology for connection.

(II) removal of the influence of the yield of the chloroplast transit peptides of CBFD and HBFD on the astaxanthin production

The plasmids pMT-2-1 and pMT-2-2 were linearized by PCR using the primer 1-F/1-R, the linearized target fragment was transformed into the strain F0 to obtain the engineering bacteria F-A2-1 and F-A2-2 (note: after the transformed strain F0 of pMT-2-1, SD-URA deficient medium was applied, 20 transformants having the deepest red color were picked up after 3 days and transferred to new SD-URA deficient medium, 10 transformants having the deepest red color were picked up after 24 hours and transferred to 50mL of liquid YPD medium, and cultured at 200rpm and 30℃for 84 hours, and the strains having the highest astaxanthin yield were designated as F-A2-1) (similarly, F-A2-2 and the strains in the following examples, all were selected and obtained by screening), and fermentation were performed to determine the astaxanthin and other carotenoid yields.

The liquid phase detection diagrams of the fermentation broths of the F-A2-1 and F-A2-2 strains are shown in FIG. 1, and the F-A2-1 strain produces astaxanthin. As shown in FIG. 3, the astaxanthin content was measured, and it was found that the strain F-A2-1 produced 0.597mg/L (0.054 mg/g DCW) of astaxanthin, and that the strain F-A2-2 did not produce astaxanthin, indicating that CBFD was active in removing the predicted chloroplast transit peptide, and that HBFD was inactive in removing the predicted chloroplast transit peptide. The strain F-A2-1 also has more beta-carotene accumulation, the conversion rate of beta-carotene is lower, the expression level of CBFD and HBFD is possibly low, and the CBFD and HBFD need to be modified to improve the astaxanthin yield.

Example 3 construction of astaxanthin-production-enhancing Strain F-A3, F-A4

Constructing the multi-enzyme complex can prevent intermediate product diffusion, improve the yield of the final product, and control the flux of the metabolite. The assembly of the modules of CBFD and HBFD can be achieved by a pair of short peptide tags (RIAD and RIDD). The tr53-CBFD-RIDD-HBFD-RIAD enzyme complex is expressed in a strain F0 for producing beta-carotene, so that the yield of astaxanthin can be improved; the increase of the promoter strength can increase the transcription level of the gene, so that the expression of the enzyme is improved, and the promoter of the CBFD is replaced by hp4d with higher strength, so that the astaxanthin yield can be improved, and the specific method is as follows:

construction of (one) CBFD and HBFD modular Assembly plasmid pMT-3

Synthesizing the gene sequence of the short peptide RIDD (the nucleotide sequence of which is shown as SEQ ID NO. 5) and the gene sequence of the RIAD (the nucleotide sequence of which is shown as SEQ ID NO. 6) together with tr53-CBFD and HBFD (entrusted to artificial synthesis of Beijing Liuhua big Gene technology Co., ltd.) respectively, and carrying out PCR amplification by using the primers CBFD-3-F/CBFD-3-R and P525 enzyme as templates to obtain a tr53-CBFD-RIDD fragment of 1032 bp; the 1374bp HBFD-RIAD fragment was obtained by PCR amplification with primers HBFD-3-F/HBFD-3-R and P525 enzyme.

The primer PMT-4-F/PMT-4-R is used for amplifying the plasmid pMT015 serving as a template to obtain a plasmid skeleton 4, the amplified tr53-CBFD-RIDD fragment and the plasmid skeleton 4 are subjected to PCR recovery, and the plasmid pMT-b is constructed by adopting a homologous recombination seamless splicing technology for connection.

The primer PMT-5-F/PMT-5-R is used for amplifying the plasmid pMT-b as a template to obtain a plasmid skeleton 5, the amplified HBFD-RIAD fragment and the plasmid skeleton 5 are subjected to PCR recovery, and the PMT-3 is constructed by adopting a homologous recombination seamless splicing technology for connection.

Construction of plasmid pMT-4 in which the promoter is replaced with (II) CBFD

The hp4d fragment was amplified using primers hp4d-1-F/hp4d-1-R as templates by synthesis of the hp4d sequence (the nucleotide sequence of which is shown in SEQ ID NO. 7) by Beijing Liuhua macrogene technologies Co.

The primer PMT-6-F/PMT-6-R is used for amplifying by taking the plasmid pMT-3 as a template to obtain a plasmid skeleton 6, the amplified hp4d fragment and the plasmid skeleton 6 are subjected to PCR recovery, and the PMT-4 is constructed by adopting a homologous recombination seamless splicing technology for connection.

(III) Modular Assembly of CBFF and HBFD and Effect of CBFD replacement promoter on astaxanthin production

Linearizing pMT-3 plasmid with primer 1-F/1-R by PCR, transforming the linearized target fragment into strain F0 to obtain engineering bacterium F-A3, fermenting, and measuring astaxanthin and other carotenoid yield.

Linearizing pMT-4 plasmid with primer 1-F/1-R by PCR, transforming the linearized target fragment into strain F0 to obtain engineering bacterium F-A4, fermenting, and measuring astaxanthin and other carotenoid yield.

The above was carried out in accordance with the method in example 1.

Liquid phase detection diagrams of fermentation broths of F-A3 and F-A4 strains are shown in FIG. 2A, and astaxanthin is produced by each of the F-A3 and F-A4 strains. As shown in FIG. 3, the astaxanthin yields of the F-A3 and F-A4 strains were 1.112mg/L and 1.480mg/L, respectively, which were 86.3% and 1.48-fold higher than those of the F-A2-1 strain, respectively, wherein the astaxanthin yield of the F-A4 strain was 1.480mg/L at the maximum and the DCW cell yield was 0.142 mg/g.

EXAMPLE 4 construction of glycosylated astaxanthin-producing strains F-X1, F-X2

The crtX gene from Pantoea ananatis ATCC 19321, which was enzymatically verified in vitro to be capable of synthesizing glycosylated astaxanthin using UDP-glucose and astaxanthin, was transferred into astaxanthin-producing yarrowia lipolytica F-A2-1 and F-A4 to produce glycosylated astaxanthin by the following method:

construction of the pMT-5 plasmid

The crtX gene from Pantoea ananatis ATCC 19321 is subjected to codon, the optimized nucleotide sequence is shown as SEQ ID NO.8, the Beijing Liuhua big gene technology Co., ltd is entrusted to synthesize the gene fragment, the synthesized gene fragment is used as a template, and the primer crtX-1-F/crtX-1-R is used for amplification to obtain the 1296bp crtX fragment.

The primer PMT-9-F/PMT-9-R is used for amplifying by taking the plasmid pMT015 as a template to obtain a 8275bp plasmid skeleton 9, the amplified crtX fragment and the plasmid skeleton 9 are subjected to PCR recovery, and the homologous recombination seamless splicing technology is adopted for connection to construct pMT-5.

Construction of (II) glycosylated astaxanthin-producing strains F-X1, F-X2

Linearizing pMT-5 plasmid by using primer 2-F/2-R, transforming the linearized target fragment into strain F-A2-1 to obtain engineering bacterium F-X1, transforming the linearized target fragment into strain F-A4 to obtain engineering bacterium F-X2, fermenting, and measuring the yield of glycosylated astaxanthin and other carotenoid.

The above was carried out in accordance with the method in example 1.

The liquid phase detection diagrams of the fermentation broths of the F-X1 and F-X2 strains are shown in FIG. 2B, and at 18.4min, the F-X1 and F-X2 strains both produce glycosylated astaxanthin. As a result of measuring the content of the glycosylated astaxanthin, as shown in FIG. 6, the yield of the glycosylated astaxanthin in the F-X1 strain was 0.741mg/L, and the yield of the glycosylated astaxanthin in the F-X2 strain was 1.157mg/L, which was 56.2% higher than that in the F-X1 strain.

EXAMPLE 5 construction of astaxanthin-producing Strain F-A5 from bacterial origin CrtW, crtZ

Construction of crtW and crtZ plasmids pMT-6

The crtW gene from Brevundimonas sp.SD212 and the crtZ gene from Pantoea ananatis are subjected to codon, the optimized nucleotide sequences are respectively shown as SEQ ID NO.9 and SEQ ID NO.10, beijing Liuhua big gene technology Co., ltd is entrusted to synthesize the gene fragment, the synthesized gene fragment is used as a template, the primers crtW-1-F/crtW-1-R and crtZ-1-F/crtZ-1-R are respectively used for amplifying crtW and crtZ fragments, the primer PMT-7-F/PMT-7-R is used for amplifying the plasmid pMT015 as the template to obtain a plasmid skeleton 7, and the crtW fragment and the skeleton 7 are connected by adopting a homologous recombination seamless splicing technology to construct a plasmid pMT-c;

the primer PMT-8-F/PMT-8-R is used for amplifying the plasmid pMT-c as a template to obtain a plasmid skeleton 8, the amplified crtZ fragment and the plasmid skeleton 8 are subjected to PCR recovery, and the PMT-6 is constructed by adopting a homologous recombination seamless splicing technology for connection.

(II) construction of astaxanthin-producing strains derived from CrtW and CrtZ of bacteria

The pMT-6 plasmid was linearized by PCR using the primer 1-F/1-R, the linearized target fragment was transformed into the strain F1 to obtain the engineering strain F-A5 (10 strains were obtained in total, designated as F-A5-1 to F-A5-10, respectively), which was fermented, and the yields of astaxanthin and other carotenoids were determined.

The above was carried out in accordance with the method in example 1.

Liquid phase detection of the strain fermentation broth is shown in FIG. 2A, the F-A5 strain produces astaxanthin (F-A5 strain in FIG. 2A, specifically F-A5-8), and the strain F-A5-8 with the highest astaxanthin yield produces 79.077mg/L (7.567 mg/g DCW) astaxanthin as shown in FIG. 4.

EXAMPLE 6 construction of bacterial Source pathway glycosylated astaxanthin-producing Strain F-X3

The crtX gene from Pantoea ananatis ATCC 19321, which was enzymatically verified in vitro to be capable of synthesizing glycosylated astaxanthin using UDP-glucose and astaxanthin, was transferred into astaxanthin-producing yarrowia lipolytica F-A5 to produce glycosylated astaxanthin by the following method:

linearizing pMT-6 plasmid by PCR using primer 2-F/2-R, transforming linearized target fragment into strain F-A5-8 to obtain engineering bacteria F-X3 (10 strains are obtained, which are temporarily named as F-X3-1-F-X3-10), fermenting (10 colonies are picked up and respectively inoculated into 10mL YPD medium at 30 ℃ C., cultured at 200rpm for 24 hours to obtain seed culture solution, 1mL seed culture solution is taken and added into 50mL YPD medium at 30 ℃ C., cultured at 200rpm for 84 hours), and the yield of glycosylated astaxanthin and other carotenoids is measured.

The above was carried out in accordance with the method in example 1.

The liquid phase assay of the strain broth is shown in FIG. 2B, which shows that strain F-X3 has glycosylated astaxanthin production. The measurement results of the content of the glycosylated astaxanthin of the F-X3 strain are shown in the figures 5 and 6 (F-X3 in the figure 6 is the F-X3-7 strain), wherein the glycosylated astaxanthin of the F-X3-7 strain has the highest yield of 27.274mg/L and is obviously higher than that of other strains (the yields of the other 9 strains F-X3-1, 2, 3, 4, 5, 6, 8, 9 and 10 are respectively 8.079mg/L, 7.975mg/L, 7.445mg/L, 7.066mg/L, 6.909mg/L, 6.666mg/L, 7.035mg/L, 9.044mg/L and 7.514mg/L, the glycosylated astaxanthin of the F-X3-7 strain is formally named OUC-AdGHB1-7CJ, the date of preservation of 2022 is the ordinary microorganism center of China general microbiological culture Collection center, the preservation number is CGMCC No.25446, the Yeast is the Beijing No. Yarrowia lipolytica, and the national institute of Beijing-national institute of China is assigned to the national institute of biological sciences of Beijing No.3, and the national institute of Beijing, and the national institute of biological sciences of China are assigned to be 100.101.

The foregoing examples are provided to fully disclose and describe how to make and use the claimed embodiments by those skilled in the art, and are not intended to limit the scope of the disclosure herein. Modifications that are obvious to a person skilled in the art will be within the scope of the appended claims.

Claims

1. An engineering bacterium for producing glycosylated astaxanthin, which is characterized in that: the strain is named OUC-AdGHB1-7CJ, and is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC NO.25446 in the year 08 and 01, and is named yarrowia lipolytica Yarrowia lipolytica in a classification.

2. Use of the engineered bacterium for producing glycosylated astaxanthin according to claim 1 for the preparation of glycosylated astaxanthin.

3. The use according to claim 2, characterized in that: in specific application, engineering bacteria for producing glycosylated astaxanthin are cultured, and the glycosylated astaxanthin is obtained by extraction.

4. The use according to claim 3, wherein the culturing is performed in the following manner: inoculating engineering bacteria producing glycosylated astaxanthin into a culture medium, and culturing to obtain seed culture solution; inoculating the seed culture solution into a culture medium, and culturing to obtain a fermentation broth; and (3) taking fermentation liquor, centrifuging to obtain bacterial precipitate and fermentation supernatant, and extracting the bacterial precipitate to obtain the glycosylated astaxanthin.

5. The use according to claim 3, wherein the conditions of the culture of the seed culture are: culturing at 30 ℃ for 24 hours at 200 rpm; the inoculation amount of the seed culture solution is 2%; the culture conditions of the fermentation broth are as follows: culturing at 30℃for 84 hours at 200 rpm.

6. An engineering bacterium for producing glycosylated astaxanthin, which is characterized in that: the host is yarrowia lipolytica producing beta-carotene, and the genome of the host comprises the following genes (1) (2) (5) or (3) (4) (5):

(1) the nucleotide sequence of the coding gene HBFD of carotenoid 4-hydroxy-beta-ring 4-dehydrogenase is shown as SEQ ID NO. 2;

(2) the coding gene tr53-CBFD of carotenoid beta-ring 4-dehydrogenase with chloroplast transit peptide removed has a nucleotide sequence shown as SEQ ID NO. 3; the promoter is an hp4d promoter, and the nucleotide sequence is shown in SEQ ID NO. 7;

(3) the nucleotide sequence of the coding gene crtZ of the beta-carotene hydroxylase is shown as SEQ ID NO. 10;

(4) the nucleotide sequence of the coding gene crtW of the beta-carotene ketolase is shown as SEQ ID NO. 9;

(5) the coding gene crtX of glycosyltransferase has a nucleotide sequence shown in SEQ ID NO. 8.

7. The method for constructing the engineering bacterium for producing glycosylated astaxanthin according to claim 1 or 6, comprising the steps of:

(2) Constructing a recombinant plasmid containing crtX;

8. The use of the engineered bacterium for producing glycosylated astaxanthin according to claim 6 for the preparation of glycosylated astaxanthin.

9. The use according to claim 8, characterized in that: in specific application, engineering bacteria for producing glycosylated astaxanthin are cultured, and the glycosylated astaxanthin is obtained by extraction.

10. A method of preparing glycosylated astaxanthin, characterized by: culturing the engineering bacterium for producing glycosylated astaxanthin according to claim 1 or the engineering bacterium for producing glycosylated astaxanthin according to claim 6, and extracting to obtain glycosylated astaxanthin.