CN109112116A

CN109112116A - Albumen from centella and the application in preparation hawthorn acid and Corosolic acid

Info

Publication number: CN109112116A
Application number: CN201710494460.8A
Authority: CN
Inventors: 张学礼; 戴住波; 马晓琳; 王冬
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2017-06-26
Filing date: 2017-06-26
Publication date: 2019-01-01

Abstract

The invention discloses a kind of albumen from centella and the applications in preparation hawthorn acid and Corosolic acid.Albumen provided by the present invention is following any: A1) amino acid sequence is the albumen of sequence 1；A2) by amino acid sequence shown in sequence 1 by the substitution and/or deletion and/or addition of one or several amino acid residues and albumen with the same function；A3) there is 99%, 95%, 90%, 85% or 80% or more homology and albumen with the same function with amino acid sequence defined above；A4) N-terminal of the protein defined by any of the above and/or C-terminal connect the fusion protein obtained after label.It is demonstrated experimentally that CaMAA45 can prepare hawthorn acid and/or Corosolic acid using oleanolic acid and/or malol as substrate, it can use CaMAA45 and its encoding gene preparation hawthorn acid and Corosolic acid, 2 α-hydroxylations of triterpene can also be catalyzed using CaMAA45.

Description

Albumen from centella and the application in preparation hawthorn acid and Corosolic acid

Technical field

The invention belongs to field of biotechnology, it is related to a kind of albumen from centella and in preparation hawthorn acid and section sieve Application in rope acid.

Background technique

Hawthorn acid (Maslinic acid) (formula 1), Corosolic acid (Corosolic acid) (formula 2) and asiatic acid (Asiatic acid) (formula 3) etc. is that the medicinal triterpene active component of 2 α-hydroxylations of representative is hawthorn (Crataegus Pinnatifida Bunge), loquat (Eriobotrya japonica), banaba (Lagerstroemia speciosa (L.) Pers.) and medicinal plants itself synthesis such as centella (Centella asiatica (L.) Urb.) micro secondary metabolism Object, hawthorn acid and Corosolic acid are Pentacyclic triterpenic acid, belong to β-botany bar gum type or α-botany bar gum type pentacyclic triterpene chemical combination Object, hawthorn acid and Corosolic acid are isomer, and in plant, the two usually exists jointly.Hawthorn acid, Corosolic acid and Asiatic acid is widely used in anticancer, anti AIDS virus, the fields such as beauty and liver protecting, has been used as nutritional supplement or change Cosmetic circulates on the market.The current this kind of compound mainly separation and Extraction from hawthorn, the plants such as banaba, loquat obtains It arrives, but this method has the shortcomings that more, including content is low and difference is big, and purifying products are difficult, and plant growing cycle is long, to biology Resource especially wild resource does great damage.

Using the principle of synthetic biology, design and transformation microbial strains are considered to produce the world natural products Yi Bei A kind of most potential method, the precursor Japanese yew diene that taxol is produced such as in Escherichia coli have reached 1000mg/L (Parayil Kumaran Ajikumar et al.,2010,Science,330:70-74)；Bilobalide-like (Ginkgolides) precursor sinistral corean pine diene (Levopimaradiene) reaches in improved colibacillus engineering The yield (Effendi Leonard et al., 2010, PNAS, 107 (31): 13654-13659) of 700mg/L；In yeast work The precursor Arteannuic acid (Artemisinic acid) that qinghaosu (Artemisinin) is produced in journey bacterium is up to 25g/L (Paddon CJ et al.,2013,Nature,2013,496:528-532)；The country is in qinghaosu, taxol, ginseng at present There is correlative study in terms of the biosynthesis of the drug molecules such as saponin(e and tanshinone.

Summary of the invention

The object of the present invention is to provide a kind of albumen from centella and in preparation hawthorn acid and Corosolic acid Using.

Protein provided by the present invention from centella has the function of hydroxylase, entitled hawthorn acid/section sieve Rope acid GAP-associated protein GAP (CaMAA45), concretely following any:

(A1) amino acid sequence is the protein of the sequence 1 in sequence table；

(A2) by amino acid sequence shown in sequence 1 in sequence table by one or several amino acid residues substitution and/ Or deletion and/or addition and protein with the same function；

(A3) there is 99% or more, 95% or more, 90% or more, 85% with amino acid sequence defined by (A1) or (A2) Above or 80% or more homology and protein with the same function；

(A4) fusion obtained after N-terminal and/or C-terminal the connection label of protein defined by any in (A1)-(A3) Albumen.

For the ease of the purifying of the protein, can be connected in the amino terminal or carboxyl terminal of the protein upper as follows Label shown in table.

Table: the sequence of label

Label	Residue	Sequence
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The nucleic acid molecules of code for said proteins also belong to protection scope of the present invention.

The nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules are also possible to RNA, such as mRNA, hnRNA or tRNA.

In the present invention, the nucleic acid molecules are concretely following any:

(B1) coded sequence is DNA molecular shown in 444-1871 of sequence 2 in sequence table；

(B2) hybridize and the DNA molecular of code for said proteins with (B1) DNA molecular limited under strict conditions；

(B3) DNA sequence dna limited with (B1) or (B2) has 99% or more, 95% or more, 90% or more, 85% or more Or 80% or more homology, and the DNA molecular of code for said proteins.

Above-mentioned stringent condition can for 6 × SSC, the solution of 0.5%SDS hybridizes at 65 DEG C, then with 2 × SSC, It is primary that 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film.

Recombinant vector, expression cassette, transgenic cell line or recombinant microorganism containing above-mentioned nucleic acid molecules also belong to the present invention Protection scope.

The carrier can be plasmid, sticking grain, bacteriophage or viral vectors.The plasmid concretely pRS313 or PRS314, or to the carrier that pRS313 or pRS314 are transformed.In the present invention, the recombinant vector is specially pRS313-TRP-TEF1-SynCaMAA45-CYC1t.The pRS313-TRP-TEF1-SynCaMAA45-CYC1t is will Small fragment between pRS313-TRP-TEF1-MAA45-CYC1t carrier restriction enzyme site SexA1 and Asc1 replaces in sequence table The recombinant plasmid obtained after DNA fragmentation shown in sequence 2 438-1871.

The promoter that the expression cassette is expressed by that can start the nucleic acid molecules, the nucleic acid molecules, and transcription are eventually Only sequence forms.In the present invention, the sequence of the expression cassette is sequence 2 in sequence table.Wherein, 1-430 of sequence 2 are TEF1 promoter sequence, the 444-1871 coded sequences for SynCaMAA45 gene, 1880-2186 terminate for CYC1 Son.

The microorganism can be yeast, bacterium, algae or fungi.Wherein, yeast can be saccharomyces cerevisiae (Saccharomyces Cerevisiae), such as saccharomyces cerevisiae (Saccharomyces cerevisiae) BY-OA or saccharomyces cerevisiae (Saccharomyces cerevisiae)BY-UA7.In the present invention, saccharomyces cerevisiae (Saccharomyces cerevisiae) BY-UA7 be to DNA fragmentation 1, DNA fragmentation 2, DNA fragmentation 3, DNA piece are imported in saccharomyces cerevisiae (Saccharomyces cerevisiae) BY-T3 The recombinant Saccharomyces cerevisiae obtained after section 4 and DNA fragmentation 5.The DNA fragmentation 1 is using prDNA-Leu2 plasmid as template, using drawing 5 '-CTTGCAAATGCCTATTGTGCAGATGTTATAATATCTGTGCGTTTAATTAAGGCTC of object GTATGTTGTGTGGAATTGT-3 ' and 5 '-CTCACTATTTTTTACTGCGGAAGCGG-3 ' carries out DNA piece obtained by PCR amplification Section.The DNA fragmentation 2 is VvCPR expression casette, and the sequence of the VvCPR gene is sequence 3 in sequence table.The DNA piece Section 3 is SEjaAS expression casette, and the sequence of the SEjaAS gene is sequence 4 in sequence table.The DNA fragmentation 4 is CYP15 Expression casette, the sequence of the CYP15 gene are sequence 5 in sequence table.The DNA fragmentation 5 is with prDNA-Leu2 plasmid For template, using primer 5 '-GAACTGGGTTACCCGGGGCACCTGTC-3 ' and 5 '- CGAAGGCTTTAATTTGCAAGCTGCGGCCCTGCATTAATGAATCGGCCAACGCGCCAGGGTTTTCCCAGTCACGACGT TG-3 ' carries out DNA fragmentation obtained by PCR amplification.

The transgenic cell line does not include propagation material.

The present invention also provides hydroxylation enzyme preparation or triterpene 2 α-hydroxylation enzyme preparations, include the protein or described heavy Group carrier, expression cassette, transgenic cell line or recombinant microorganism.

It applies and all belongs to the scope of protection of the present invention shown in (C) or (D) or (E) as follows:

(C) protein it is following it is any in application:

C1) it is used as 2 α-hydroxylases of hydroxylase or triterpene, or preparation that there are 2 α-hydroxylase activities of hydroxylase or triterpene Product；

C2) production hawthorn acid and/or Corosolic acid, or preparation is for producing the product of hawthorn acid and/or Corosolic acid；

C3) degradation oleanolic acid and/or malol, or prepare the product for degrade oleanolic acid and/or malol.

(D) nucleic acid molecules or the recombinant vector, expression cassette, transgenic cell line or recombinant microorganism are being appointed as follows Application in one:

D1 the protein) is prepared；

D2) preparation has 2 α-hydroxylase activity products of hydroxylase or triterpene；

D3) production hawthorn acid and/or Corosolic acid, or preparation is for producing the product of hawthorn acid and/or Corosolic acid；

D4) degradation oleanolic acid and/or malol, or prepare the product for degrade oleanolic acid and/or malol.

(E) hydroxylation enzyme preparation or the triterpene 2 α-hydroxylation enzyme preparation it is following it is any in application:

E1) production hawthorn acid and/or Corosolic acid, or preparation is for producing the product of hawthorn acid and/or Corosolic acid；

E2) degradation oleanolic acid and/or malol, or prepare the product for degrade oleanolic acid and/or malol.

The present invention also provides the preparation methods of the protein.

The preparation method of the protein provided by the present invention, specifically may include following steps: culture is previously described Recombinant microorganism enables the nucleic acid molecules to express, and obtains the recombinant microorganism culture containing the protein；From described The isolated protein in recombinant microorganism culture.

The present invention also provides the preparation methods of hawthorn acid and/or Corosolic acid.

The preparation method of hawthorn acid and/or Corosolic acid provided by the present invention, is to be with oleanolic acid and/or malol Substrate carries out catalysis reaction with the protein and obtains hawthorn acid and/or Corosolic acid.

Specifically, the preparation method of hawthorn acid provided by the present invention and/or Corosolic acid, it may include following steps: The expression cassette (specific such as sequence 2 in sequence table) of encoding gene (nucleic acid molecules i.e. described previously) containing the protein is led Enter in the receptor biological cell that can generate oleanolic acid and/or malol, obtains recombination biological cell；Cultivate the recombination biology Cell expresses the encoding gene of the protein, obtains the cell culture for expressing the protein；Described in the expression Hawthorn acid and/or Corosolic acid are obtained in the cell culture of protein；The receptor biological cell is microbial cell, plant Cell or non-human animal cell.

Further, the receptor biological cell can be yeast, bacterium, algae or fungi.Wherein, yeast can be saccharomyces cerevisiae (Saccharomyces cerevisiae), such as saccharomyces cerevisiae (Saccharomyces cerevisiae) BY-OA or wine brewing ferment Mother (Saccharomyces cerevisiae) BY-UA7.

The encoding gene for the CaMAA45 albumen cloned from centella is conducted into and can produce neat pier by the present invention After the S. cervisiae of tartaric acid (OA), recombinant bacterium can produce hawthorn acid；It is conducted into and can produce oleanolic acid (OA) and ursol After in the S. cervisiae of sour (UA), recombinant bacterium can produce hawthorn acid and Corosolic acid, and the bacterial strain for not importing the gene is equal Hawthorn acid and Corosolic acid cannot be generated.Show that CaMAA45 can prepare hawthorn acid by substrate of oleanolic acid, it can be with Corosolic acid is prepared by substrate of malol.It is demonstrated experimentally that can use CaMAA45 and its encoding gene preparation hawthorn acid and section Roseau acid can also be catalyzed 2 α-hydroxylations of triterpene using CaMAA45.

Detailed description of the invention

Fig. 1 is the HPLC test map of hawthorn acid and BY-OA-SynCaMAA45.MA is hawthorn acid standard items, corresponding guarantor Staying the time is 36.31min.

Fig. 2 is the HPLC test map of hawthorn acid and Corosolic acid standard items and BY-UA7-SynCaMAA45.MA and CA is respectively the standard items of hawthorn acid and Corosolic acid, and corresponding retention time is respectively 36.31 and 37.10min.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative test involved in following embodiments is provided with repetition at least more than three times, as a result takes mean value.

Plasmid pRS313-TRP-TEF1-MAA45-CYC1t (is documented in Chinese patent 201611037629.9), specifically Construction method is as follows: with pM3-ERG9 (be documented in Chinese patent application 201210453416.X, can be from Chinese Academy of Sciences Tianjin Industrial biotechnology research institute obtains) it is template, with primer amplification TEF1 (450bp) in primer table 1.Amplification system are as follows: 5 × 10 μ L of Phusion HF Buffer, dNTP (every kind of dNTP of 10mM) 1 μ L, DNA profiling 20ng, each 1 μ L of primer (10 μM), Phusion High-Fidelity DNA Polymerase (2.5U/ μ L) 0.5 μ L, distilled water is added to 50 μ L of total volume.Expand Increasing condition is 98 DEG C of initial denaturations 2 minutes (1 circulation)；98 DEG C are denaturalized 10 seconds, annealing 10 seconds (58 DEG C of annealing temperature), 72 DEG C of extensions 1 minute (32 circulations)；72 DEG C extend 8 minutes (1 circulation).With Pac1 and SexA1 to amplified fragments TEF1 and plasmid PRS313-TRP-PGK1-MAA45-CYC1t (is documented in Chinese patent 201610236283.9, the public can be from Chinese science Obtained in Tianjin Institute of Industrial Biotechnology of institute) double digestion is carried out, glue recycles segment TEF1 and pRS313-TRP-MAA45- Linked system is added in each 50ng of gained segment by CYC1t: (NEB is public by 2 μ L 10 × T4DNA Ligase Reaction Buffer Department), 1 μ L T4ligase (NEB company, 400,000cohesive end units/ml), supplement distilled water is to 20 μ L, room temperature Reaction obtains connection product in 2 hours, is transferred in Trans10 competent cell, sequence verification is correctly obtained pRS313-TRP- TEF1-MAA45-CYC1t plasmid.

PRS313-TRP-TEF1-GFP-CYC1t (is documented in Chinese patent 201611037629.9), specific building side Method is as follows: with pYM-N9 (Carsten Janke, Maria M.Magiera and Nicole Rathfelder, et al., Yeast 2004；21:947-962. can be obtained from Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences) it is template, use primer Primer amplification GFP (828bp) in table 1.Amplification system are as follows: 5 × Phusion HF Buffer, 10 μ L, dNTP (every kind of 10mM DNTP) 1 μ L, DNA profiling 20ng, each 1 μ L of primer (10 μM), Phusion High-Fidelity DNA Polymerase (2.5U/ μ L) 0.5 μ L, distilled water is added to 50 μ L of total volume.Amplification condition is 98 DEG C of initial denaturations 2 minutes (1 circulation)；98℃ It is denaturalized 10 seconds, annealing 10 seconds (58 DEG C of annealing temperature), 72 DEG C extension 1 minute (32 circulations)；(1 is followed within 8 minutes for 72 DEG C of extensions Ring).Double digestion, glue are carried out to amplified fragments GFP and plasmid pRS313-TRP-TEF1-MAA45-CYC1t with SexA1 and Asc1 Segment GFP and pRS313-TRP-TEF1- ...-CYC1t are recycled, each 50ng of gained segment is added linked system: 2 μ L 10 × T4DNA Ligase

Reaction Buffer (NEB company), 1 μ L T4ligase (NEB company, 400,000cohesive end Units/ml), distilled water is supplemented to 20 μ L, room temperature reaction obtains connection product in 2 hours, is transferred in Trans10 competent cell, Sequence verification is correctly obtained pRS313-TRP-TEF1-GFP-CYC1t plasmid.

Primer table 1

Embodiment 1, SynCaMAA45 can be used to prepare hawthorn acid and Corosolic acid

The present invention provides one kind from centella (Centella asiatica) protein, and entitled hawthorn acid/ Corosolic acid GAP-associated protein GAP (CaMAA45), CaMAA45 can be catalyzed 2 α-hydroxylations of triterpene, belong to 2 α-hydroxylases of triterpene, The amino acid sequence of CaMAA45, can be as shown in 444-1871 of sequence 2 as shown in sequence 1 in sequence table SynCaMAA45 gene coding.

1, the preparation of pRS313-TRP-TEF1-SynCaMAA45-CYC1t recombinant vector

With SexA1 and Asc1, to p-SynCaMAA45, (company is synthesized, such as the 431-1879 of sequence 2 in sequence table respectively Shown in position) and plasmid pRS313-TRP-TEF1-MAA45-CYC1t (being documented in Chinese patent 201611037629.9) progress Double digestion；Rubber tapping purifying target gene SynCaMAA45 and carrier framework large fragment pRS313-TRP-TEF1-/- CYC1t respectively, And it is added simultaneously linked system (each 50ng): 2 μ 10 × T4ligation of l Buffer (NEB company), 1 μ l T4ligase (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ l, room temperature reaction are connected for 2 hours The correct carrier of obtained sequence is named as pRS313-TRP-TEF1-SynCaMAA45- by product, conversion, sequence verification CYC1t。

Wherein, 1-430 of sequence 2 are TEF1 promoter sequence, the 431-437 identification sequences for SexA1, the The 444-1871 coded sequences for SynCaMAA45 gene, the 1872-1879 identification sequences for Asc1,1880- 2186 are CYC1 terminator.

2, the preparation of recombinant bacterium

The pRS313-TRP-TEF1-SynCaMAA45-CYC1t of step 1 is imported into out bacterium germination saccharomyces cerevisiae Saccharomyces cerevisiae BY-OA (is documented in Chinese patent ZL201310399947.X, hereinafter referred to as BY- OA, BY-OA can produce oleanolic acid (OA)) in, recombinant bacterium is obtained, which is named as BY-OA-SYNCAMAA45； Control plasmid pRS313-TRP-TEF1-GFP-CYC1t (being documented in Chinese patent 201611037629.9) is imported into BY-OA In, recombinant bacterium is obtained, which is named as BY-OA-CK.

The pRS313-TRP-TEF1-SynCaMAA45-CYC1t of step 1 is imported into out bacterium germination saccharomyces cerevisiae (hereinafter referred to as BY-UA7, BY-UA7 can produce malol (UA) He Qidun to Saccharomyces cerevisiae BY-UA7 Tartaric acid (OA)) in, recombinant bacterium is obtained, which is named as BY-UA7-SynCaMAA45；By control plasmid pRS313- TRP-TEF1-GFP-CYC1t (being documented in Chinese patent 201611037629.9) is imported in BY-UA7, obtains recombinant bacterium, will The recombinant bacterium is named as BY-UA7-CK.

Wherein, BY-UA7 is prepared according to following 2.1-2.3:

The plasmid construction of 2.1 Genetic elements

(1) building of pM2-VvCPR plasmid

With SexA1 and Asc1 respectively to p-VvCPR (company synthesizes, and sequence is sequence 3 in sequence table) and plasmid pM2- THMG1 (being documented in Chinese patent ZL201310399947.X) carries out double digestion；Respectively rubber tapping purifying target gene VvCPR and Carrier framework large fragment pM2, and be added simultaneously linked system (each 50ng): (NEB is public by 2 μ l 10XT4ligation Buffer Department), 1 μ l T4ligase (NEB company, 400,000cohesive end units/ml), supplement distilled water is to 20 μ l, room temperature Reaction obtains connection product in 2 hours, converts, and the correct carrier of obtained sequence is named as pM2-VvCPR by sequence verification.

(2)pM4-SEjaAS

With SexA1 and Asc1 respectively to p-SEjaAS (company synthesizes, and sequence is sequence 4 in sequence table) and plasmid PM11-AtCPR1 (being documented in Chinese patent ZL201310399947.X) carries out double digestion；Rubber tapping purifying target gene respectively SEjaAS and carrier framework large fragment pM4, and be added simultaneously linked system (each 50ng): 2 μ l10XT4ligation Buffer (NEB company), 1 μ l T4 ligase (NEB company, 400,000cohesive end units/ml), supplement distilled water to 20 μ L, room temperature reaction obtain connection product in 2 hours, convert, and the correct carrier of obtained sequence is named as pM4- by sequence verification SEjaAS。

(3)pM3-CYP15

With SexA1 and Asc1 respectively to p-CYP15 (company synthesizes, and sequence is sequence 5 in sequence table) and plasmid pM3- ERG9 (being documented in Chinese patent application 201210453416.X) carries out double digestion；Rubber tapping purifying target gene CYP15 respectively With carrier framework large fragment pM3, and be added simultaneously linked system (each 50ng): (NEB is public by 2 μ l10XT4ligation Buffer Department), 1 μ l T4ligase (NEB company, 400,000cohesive end units/ml), supplement distilled water is to 20 μ l, room temperature Reaction obtains connection product in 2 hours, converts, and the correct carrier of obtained sequence is named as pM3-CYP15 by sequence verification.

The building of 2.2BY-UA7

With the pcr template of the description of primer table 2, (prDNA-Leu2 is documented in Chinese patent application 201210453416.X respectively In) and primer progress PCR acquisition functional module: M1 ' (prDNA-Leu2-up), M2 ' (P_PGK1-VvCPR-T_ADH1), M3 ' (P_TDH3- SEjaAS-T_TPI1), M4 ' (P_TEF1-CYP15-T_CYC1), M5 ' (prDNA-Leu2-down).Amplification system are as follows: NewEngland Biolabs Phusion 5Xbuffer10 μ l, dNTP (10mM each dNTP) 1 μ l, DNA profiling 20ng, primer (10 μM) are each 1 μ l, Phusion High-Fidelity DNA Polymerase (2.5U/ μ l) 0.5 μ l, distilled water is added to 50 μ of total volume l.Amplification condition is 98 DEG C of initial denaturations 1.5 minutes (1 circulation)；98 DEG C are denaturalized 10 seconds, annealing 10 seconds (58 DEG C of annealing temperature), 72 DEG C extend with 2 minutes (32 recycle)；72 DEG C extend 8 minutes (1 circulation), and product is tapped and recovered preservation.

Primer table 2

According to the preparation method of competent cell in embodiment 2 in Chinese patent application 201210453416.X, it is prepared into To BY-T3 competent cell (construction method of BY-T3 is documented in Chinese patent application 201610236283.9), then to In BY-T3 competent cell be added conversion segment: M1 ', M2 ', M3 ', M4 ' and M5 ' netic module totally 5 μ g (molar ratio=1: 1:1:1:1).The culture medium of screening and culturing are as follows: 0.8% (mass percent concentration) yeast Selective agar medium SD-Ura-Trp- Leu-His, 2% (mass percent concentration) glucose, 0.01% (mass percent concentration) Trp, 0.01% (mass percent Concentration) Ura；The condition of screening and culturing are as follows: 30 DEG C, cultivate 36h or more.PCR identifies the correct positive colony of sequence, is named as Bacterial strain BY-UA7.

3, the preparation of hawthorn acid and Corosolic acid

3.1 shake flask fermentation

Respectively solid selection medium 1 (solid selection medium 1 is made of solute and solvent, and solvent is water, solute and Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose, and 0.01% Trp. and agar powder) in activated b Y-OA, being then inoculated in liquid selective medium 1 respectively, (liquid selective medium 1 is by solute It is formed with solvent, solvent is water, and solute and its mass percent concentration are respectively as follows: 0.8% yeast Selective agar medium SD-Ura- Trp-Leu-His, 2% glucose, 0.01%Trp.) in 30 DEG C, 250rpm cultivates 16h and prepares seed liquor, by seed liquor with 1% inoculum concentration is inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 1, and 30 DEG C, 250rpm shaken cultivation 6 days, Obtain BY-OA fermentation liquid.

Respectively solid selection medium 2 (solid selection medium 2 is made of solute and solvent, and solvent is water, solute and Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose, and 0.01% Trp., 0.01%Ura. and agar powder) in activated b Y-UA7, be then inoculated in respectively liquid selective medium 2 (liquid selective training It supports base 2 to be made of solute and solvent, solvent is water, and solute and its mass percent concentration are respectively as follows: the selection culture of 0.8% yeast Base SD-Ura-Trp-Leu-His, 2% glucose, 0.01%Trp. and 0.01%Ura.) in 30 DEG C, 250rpm cultivates 16h Seed liquor is prepared, seed liquor is inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 2 with 1% inoculum concentration, 30 DEG C, 250rpm shaken cultivation 6 days, obtain BY-UA7 fermentation liquid.

Respectively solid selection medium 3 (solid selection medium 3 is made of solute and solvent, and solvent is water, solute and Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Ura-Trp-Leu-His, 2% glucose and agar Powder) in activation step 2 BY-OA-SynCaMAA45 and BY-OA-CK, be then inoculated in 3 (liquid of liquid selective medium respectively Selective agar medium 3 is made of solute and solvent, and solvent is water, and solute and its mass percent concentration are respectively as follows: the choosing of 0.8% yeast Select culture medium SD-Ura-Trp-Leu-His, 2% glucose) in 30 DEG C, 250rpm cultivates 16h and prepares seed liquor, by seed Liquid is inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 3 with 1% inoculum concentration, and 30 DEG C, 250rpm shaken cultivation 6 days, respectively obtain BY-OA-SynCaMAA45 fermentation liquid and BY-OA-CK fermentation liquid.

Respectively solid selection medium 4 (solid selection medium 4 is made of solute and solvent, and solvent is water, solute and Its mass percent concentration is respectively as follows: 0.8% yeast Selective agar medium SD-Trp-Leu-His, 2% glucose and agar powder) in Then the BY-UA7-SynCaMAA45 and BY-UA7-CK of activation step 2 are inoculated in (the liquid choosing of liquid selective medium 4 respectively It selects culture medium 4 to be made of solute and solvent, solvent is water, and solute and its mass percent concentration are respectively as follows: the selection of 0.8% yeast Culture medium SD-Trp-Leu-His, 2% glucose) in 30 DEG C, 250rpm cultivates 16h and prepares seed liquor, by seed liquor with 1% Inoculum concentration be inoculated in the 100ml triangular flask of liquid selective medium containing 15ml 4,30 DEG C, 250rpm shaken cultivation 6 days, point BY-UA7-SynCaMAA45 fermentation liquid and BY-UA7-CK fermentation liquid are not obtained.

The fermentation of 3.2 bioreactors

3.2.1 culture medium configures

Calcium chloride mother liquor: 19.2g/L calcium chloride dihydrate.

Trace metal salts mother liquor: 19.1g/L disodium ethylene diamine tetraacetate；10.2g/L white vitriol；Tetra- water chlorine of 0.5g/L Change manganese；0.86g/L CoCL2 6H2O；0.78g/L cupric sulfate pentahydrate；0.56g/L Sodium Molybdate Dihydrate；Seven water sulfurous acid of 5.12g/L Iron.

Vitamin mother liquor: 0.05g/L biotin；0.2g/L p-aminobenzoic acid is received；1g/L niacin；1g/L calcium pantothenate；1g/ L puridoxine hydrochloride；1g/L thiamine hydrochloride；25g/L inositol.

Seed culture medium and Batch fermentation culture medium: 25g/L glucose, 15g/L ammonium sulfate, 6.15g/L epsom salt, 0.72g/L white vitriol, 8g/L potassium dihydrogen phosphate, 2mL calcium chloride mother liquor, 10mL trace metal salts mother liquor；12mL vitamin Mother liquor (as needed, adds 1g/L Ura.).

Supplemented medium: 600g/L Dextrose Monohydrate, 5.125g/L epsom salt, 3.5g/L potassium sulfate, 0.28g/L sulphur Sour sodium, 9g/L potassium dihydrogen phosphate (as needed, add 1g/L Ura.).

3.2.2 engineering bacteria BY-OA-SynCaMAA45 ferments

Engineering bacteria BY-OA-SynCaMAA45 is activated by 3.1 methods.Monoclonal on picking plate is to being equipped with respective liquid The test tube of culture medium 3,30 DEG C, 250rpm shaken cultivation is stayed overnight；500 μ L bacterium solutions are drawn to being equipped with 50mL culture medium containing respective liquid In 3 250mL triangular flask, 30 DEG C, 250rpm shaken cultivation is for 24 hours；

Drawing 2mL bacterium solution respectively, (30 DEG C, 250rpm oscillation is trained into 3 1L triangular flasks equipped with 100mL seed culture medium Support 48h；Most seed liquor is added in the 7L fermentor of the fermentation medium containing 3L through flame inoculation ring afterwards.

Pre-set parameter is respectively as follows: 30 DEG C of temperature, pH 5.0 in fermentation process, dissolved oxygen 30%, air mass flow 3-20L/ Min, speed of agitator 300-1000rpm, dissolved oxygen and speed of agitator, ventilation cascade.Feeding strategy are as follows: when oxygen dissolving value is greater than 60, to It is 5g/L that supplemented medium concentration of glucose into fermentation liquid is added in fermentor.

3.2.3 engineering bacteria BY-UA7-SynCaMAA45 ferments

Engineering bacteria BY-UA7-SynCaMAA45 is activated by 3.1 methods.Monoclonal on picking plate is to being equipped with respective liquid The test tube of culture medium 4,30 DEG C, 250rpm shaken cultivation is stayed overnight；500 μ L bacterium solutions are drawn to being equipped with 50mL culture medium containing respective liquid In 4 250mL triangular flask, 30 DEG C, 250rpm shaken cultivation is for 24 hours；

2mL bacterium solution is drawn respectively in addition adds 1g/L ura into 3 1L triangular flasks equipped with 100mL seed culture medium), 30 DEG C, 250rpm shaken cultivation 48h；Most seed liquor is added in the 7L fermentor of the fermentation medium containing 3L through flame inoculation ring afterwards (in addition plus 1g/L Ura).

Pre-set parameter is respectively as follows: 30 DEG C of temperature, pH 5.0 in fermentation process, dissolved oxygen 30%, air mass flow 3-20L/ Min, speed of agitator 300-1000rpm, dissolved oxygen and speed of agitator, ventilation cascade.Feeding strategy are as follows: when oxygen dissolving value is greater than 60, to It is 5g/L that supplemented medium (in addition plus 1g/L Ura) concentration of glucose into fermentation liquid is added in fermentor.

3.3 compounds extract

The compound in six kinds of fermentation liquids in extraction step 3.1 is distinguished as follows:

Take the BY-OA-SynCaMAA45 fermentation liquid of 6mL step 3.1 in broken pipe, 13000rpm is centrifuged 1min, in abandoning Clear liquid；After precipitating sterile water wash, 13000rpm is centrifuged 1min, abandons supernatant；Bead (diameter is added into precipitating 0.5mm) with 1ml extract liquor (extract liquor is made of methanol and acetone, and the volume ratio of methanol and acetone is 1:1), concussion is broken 5min, ultrasonication 30min, 13000rpm are centrifuged 2min, abandon precipitating, supernatant is crossed 0.22 μm of organic filter membrane into liquid phase bottle Solution is obtained, it is named as BY-OA-SYNCAMAA45 solution by the solution.

According to the method described above, BY-OA-SYNCAMAA45 fermentation liquid is replaced with into BY-UA7-SYNCAMAA45 fermentation liquid, His step is constant, obtains solution, is named as BY-UA7-SYNCAMAA45 solution.

According to the method described above, BY-OA-SYNCAMAA45 fermentation liquid is replaced with into BY-OA fermentation liquid respectively, BY-OA-CK is sent out Zymotic fluid, BY-UA7 fermentation liquid and BY-UA7-CK fermentation liquid, other steps are constant, respectively obtain BY-OA solution, BY-OA-CK Solution, BY-UA7 solution and BY-UA7-CK solution.

Same method extracts corresponding BY-OA-SynCaMAA45 from the BY-OA-SynCaMAA45 fermentation liquid in 3.2 Solution, and corresponding BY-UA7-SynCaMAA45 solution is extracted from BY-UA7-SynCaMAA45 fermentation liquid.

3.4HPLC quantitative analysis

As follows respectively in step 3.3 each solution carry out quantitative and qualitative analysis, standard items be hawthorn acid (on Hai Yuanye Biotechnology Co., Ltd) and Corosolic acid (Shanghai Yuan Ye Biotechnology Co., Ltd).

Instrument: 1260 high performance liquid chromatograph of Agilent；Chemstation for LC 3D system version B.04.03 Data collection and precessing system.

HPLC condition: DAD detector, Detection wavelength 203nm, WatersC18 chromatographic column (250mm × 4.6mm, 5 μm), mobile phase A is+0.1% acetic acid of 10% methanol, and Mobile phase B is acetonitrile, gradient elution, flow velocity 1mL/min, column 30 DEG C of temperature.Type of elution is as follows:

It is 0% that the concentration of volume percent of 0~50min (including 50min) mobile phase A, which is from 80% linear change, flowing The concentration of volume percent of phase B is from being 100% for 20% linear change；Wherein

The concentration of volume percent of 50~60min (including 60min) Mobile phase B is 100%；

The concentration of volume percent of 60~62min (including 62min) mobile phase A is 80%, the percent by volume of Mobile phase B Concentration is 20%；

The concentration of volume percent of 62~65min (including 65min) mobile phase A is 80%, the percent by volume of Mobile phase B Concentration is 20%.

HPLC test map is as depicted in figs. 1 and 2, and calculated result is shown:

With in BY-OA-SynCaMAA45 solution when 3.1 shake flask fermentation method contain 1.60mg/L hawthorn acid, BY-OA solution Hawthorn is sour with not containing in BY-OA-CK solution.Wherein in BY-UA7-SynCaMAA45 solution containing 1.4mg/L hawthorn acid and Without containing hawthorn acid and Corosolic acid in 2.6mg/L Corosolic acid, BY-UA7 solution and BY-UA7-CK solution.

384.3mg/L hawthorn acid, work can be produced with engineering bacteria BY-OA-SynCaMAA45 when 3.2 bioreactor fermentation process Journey bacterium BY-UA7-SynCaMAA45 produces 35.8mg/L hawthorn acid and 141.0mg/L Corosolic acid.

Should the result shows that: after the S. cervisiae that SynCaMAA45 channel genes can produce to oleanolic acid (OA), recombination Bacterium can produce hawthorn acid；After being conducted into the S. cervisiae that can produce oleanolic acid (OA) and malol (UA), recombination Bacterium can produce hawthorn acid and Corosolic acid, and the bacterial strain for not importing the gene cannot generate hawthorn acid and Corosolic acid. Show that CaMAA45 can prepare hawthorn acid by substrate of oleanolic acid, Corosolic acid can also be prepared by substrate of malol. Since oleanolic acid and malol are triterpenoid, oleanolic acid is β-botany bar gum (β-Amyrin) type, and malol is α- Botany bar gum (α-Amyrin) type, compared with oleanolic acid, hawthorn acid is that the production that α-hydroxylation obtains only occurs at oleanolic acid 2 Object, compared with malol, Corosolic acid is that the product that α-hydroxylation obtains only occurs at malol 2, shows that CaMAA45 is three 2 α-hydroxylases of terpene.

<110>Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences

<120>from the albumen of centella and the application in preparation hawthorn acid and Corosolic acid

<130> GNCLN171205

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 475

<212> PRT

<213>centella (Centella asiatica (L.) Urb.)

<400> 1

Met Asp Leu Phe Leu Pro Leu Val Phe Leu Ser Val Ile Leu Ile Val

1 5 10 15

Leu Ile Phe Lys Pro Arg Ser Asp Gly Asp Lys Lys Leu Pro Pro Gly

20 25 30

Ser Phe Gly Trp Pro Ile Met Gly Glu Thr Ile Glu Phe Leu Phe Gly

35 40 45

His Pro Lys Glu Phe Val Asp Lys Arg Met Lys Lys Tyr Ser Pro Asp

50 55 60

Ile Phe Lys Ser Asn Ile Leu Gly Glu Lys Thr Ala Ile Ile Cys Gly

65 70 75 80

Pro Glu Gly His Lys Phe Leu Phe Ser Asn Glu Glu Lys Phe Phe Thr

85 90 95

Val Phe Arg Pro His Pro Ile Gln Arg Leu Phe Arg Ser Tyr Asn Asn

100 105 110

Lys Ser Ala Pro Asp Pro Pro Pro Ser Gly Ala Gly Ser Lys Asp Asp

115 120 125

Val Lys Ser Ile Lys Gln Pro Gly Phe Phe Lys Pro Glu Ala Leu Ser

130 135 140

Arg Phe Ile Gly Val Ile Glu Ala Thr Ile Gln Gln His Leu Arg Ala

145 150 155 160

His Trp Glu Gly Lys Asp Thr Val Glu Ala Tyr Pro Leu Ser Lys Ser

165 170 175

Leu Thr Leu Thr Leu Ser Cys Arg Phe Phe Leu Gly Ile Asp Asn Pro

180 185 190

Glu Arg Ile Ala Arg Leu Val His Met Phe Asp Asp Ile Thr Leu Gly

195 200 205

Met His Ser Ile Ile Ser Asn Val Pro Gly Thr Val Phe Tyr Arg Ala

210 215 220

Lys Asn Ala Ala Ala Ala Val Arg Lys Glu Leu Leu Cys Val Ile Lys

225 230 235 240

Glu Lys Lys Gln Glu Met Ala Ala Gly Lys Lys Ala Gln Asp Val Leu

245 250 255

Ser His Met Ile Ser Phe Ser Asp Pro Ser Thr Gly Lys Phe Met Pro

260 265 270

Glu Leu Glu Val Ala Asp Lys Met Met Gly Leu Ile Thr Ala Gly Tyr

275 280 285

Ser Thr Val Ala Thr Ser Met Ala Phe Leu Met Lys Phe Val Gly Glu

290 295 300

Ser Pro Ala Ile Tyr Asn Lys Ile Arg Ala Glu Gln Ile Glu Leu Ala

305 310 315 320

Glu Ser Lys Asn Pro Gly Glu Pro Leu Thr Trp Val Asp Ile Gln Lys

325 330 335

Leu Lys Tyr Ser Trp Gln Ala Met Cys Glu Thr Met Arg Leu Val Pro

340 345 350

Pro Leu Gln Gly Thr Phe Arg Glu Val Ile Asn Glu Phe Thr Tyr Ala

355 360 365

Gly Tyr Thr Val Pro Lys Gly Trp Lys Val Tyr Trp Thr Val Ser Thr

370 375 380

Val His Met Asn Pro Lys Tyr Phe Pro Asn Pro Glu Lys Phe Asp Pro

385 390 395 400

Ser Arg Tyr Glu Glu Gly Lys Ile Ser Thr Pro Tyr Thr Tyr Val Pro

405 410 415

Phe Gly Gly Gly Pro Arg Met Cys Pro Gly Lys Glu Tyr Ala Arg Ile

420 425 430

Ala Val Leu Thr Phe Leu His His Val Val Arg Lys Tyr Lys Trp Glu

435 440 445

Val Leu Phe Pro Asp Glu Lys Val Ile Gly Asp Met Met Pro Ala Pro

450 455 460

Glu Lys Gly Leu Pro Ile Arg Leu His Pro His

465 470 475

<210> 2

<211> 2186

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 2

agtgatcccc cacacaccat agcttcaaaa tgtttctact ccttttttac tcttccagat 60

tttctcggac tccgcgcatc gccgtaccac ttcaaaacac ccaagcacag catactaaat 120

ttcccctctt tcttcctcta gggtgtcgtt aattacccgt actaaaggtt tggaaaagaa 180

aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg caataaaaat ttttatcacg 240

tttctttttc ttgaaaattt ttttttttga tttttttctc tttcgatgac ctcccattga 300

tatttaagtt aataaacggt cttcaatttc tcaagtttca gtttcatttt tcttgttcta 360

ttacaacttt ttttacttct tgctcattag aaagaaagca tagcaatcta atctaagttt 420

taattacaaa acctggtaaa acaatggatt tgtttttacc attggttttc ttgtctgtta 480

ttttgatcgt tttgattttt aagccaagat ctgatggtga caagaaattg cctccaggtt 540

cttttggttg gccaatcatg ggtgaaacta tcgaattctt gttcggtcat ccaaaggaat 600

tcgttgataa gagaatgaag aaatactctc cagatatttt taagtcaaac atcttgggtg 660

aaaagactgc tatcatttgt ggtccagaag gtcataagtt cttattttct aacgaagaaa 720

agtttttcac agtttttaga ccacatccaa tccaaagatt gtttagatct tacaacaata 780

agtcagctcc agatccacca ccatctggtg caggttcaaa ggatgatgtt aagtctatta 840

aacaaccagg atttttcaaa ccagaagcat tgtcaagatt cattggtgtt attgaagcta 900

ctatccaaca acatttgaga gcacattggg agggtaaaga tacagttgaa gcatatccat 960

tgtctaaatc attaactttg acattgtctt gtagattttt cttgggtatc gataacccag 1020

aaagaatcgc aagattggtt catatgttcg atgatatcac tttgggtatg cattctatca 1080

tctcaaacgt tccaggtaca gttttctata gagctaaaaa tgctgcagct gcagttagaa 1140

aggaattgtt gtgtgttatt aaagaaaaga aacaagaaat ggctgcaggt aaaaaggcac 1200

aagatgtttt gtctcatatg atttcttttt cagatccatc aactggtaaa ttcatgccag 1260

aattggaagt tgctgataag atgatgggtt tgatcacagc aggttactct actgttgcta 1320

catcaatggc atttttgatg aagttcgttg gtgaatctcc agctatctat aataagatca 1380

gagctgaaca aatcgaattg gcagaatcta aaaatccagg tgaaccattg acttgggttg 1440

atatccaaaa attgaaatac tcttggcaag ctatgtgtga aactatgaga ttggttccac 1500

cattacaagg tacttttaga gaagttatta atgaattcac ttacgcaggt tacacagttc 1560

caaaaggttg gaaagtttat tggactgttt caacagttca tatgaaccca aagtacttcc 1620

caaacccaga aaagttcgat ccatctagat acgaagaagg taaaatctca actccataca 1680

catacgttcc atttggtggt ggtccaagaa tgtgtcctgg taaagaatac gctagaatcg 1740

cagttttgac atttttacat catgttgtta gaaagtacaa atgggaagtt ttgttcccag 1800

atgaaaaagt tattggtgac atgatgccag ctccagaaaa aggtttgcca attagattac 1860

atccacatta aggcgcgccc cgctgatcct agagggccgc atcatgtaat tagttatgtc 1920

acgcttacat tcacgccctc cccccacatc cgctctaacc gaaaaggaag gagttagaca 1980

acctgaagtc taggtcccta tttatttttt tatagttatg ttagtattaa gaacgttatt 2040

tatatttcaa atttttcttt tttttctgta cagacgcgtg tacgcatgta acattatact 2100

gaaaaccttg cttgagaagg ttttgggacg ctcgaaggct ttaatttgca agctgcggcc 2160

ctgcattaat gaatcggcca acgcgc 2186

<210> 3

<211> 2130

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 3

acctggtatg caatcatcct ccgtaaaggt atccccattc gacttaatgt cagcaatcat 60

caagggttct atggaccaat caaacgtatc atcagaatca ggtggtgctg cagccatggt 120

tttggaaaac agagaattca ttatgatctt gactacatcc attgctgttt tgatcggttg 180

tgttgtcgta ttgatatgga gaagatcagg tcaaaaacaa tccaagactc cagaaccacc 240

taaacctttg attgttaagg atttggaagt agaagttgat gacggtaaac aaaaggttac 300

aatatttttc ggtacacaaa ccggtactgc tgaaggtttc gcaaaagcct tggctgaaga 360

agcaaaggcc agatacgaaa aggcaatttt taaggttgtc gatttggatg actatgccgg 420

tgacgacgat gaatacgaag aaaaattgaa aaaggaaact ttggcctttt tctttttggc 480

tacatatggt gacggtgaac caaccgacaa tgctgcaaga ttctacaaat ggtttgctga 540

gggtaaagaa cgtggtgaat ggttgcaaaa cttaaagtat ggtgttttcg gtttgggtaa 600

cagacaatac gaacatttca acaaagttgc aaaggtagtt gacgatataa tcacagaaca 660

aggtggtaaa agaatcgtcc cagtaggttt gggtgacgat gaccaatgta ttgaagatga 720

cttcgccgct tggagagaat tattatggcc tgaattagat caattgttaa gagacgaaga 780

tgacgctacc actgtatcta caccatatac cgcagccgtt ttggaataca gagtcgtatt 840

tcatgatcct gaaggtgcat cattacaaga caagtcatgg ggttccgcca atggtcatac 900

tgttcacgat gctcaacacc catgtagagc caacgttgct gtcagaaaag aattgcatac 960

tcctgctagt gatagatctt gcacacactt ggaattcgac atttctggta ctggtttaac 1020

atatgaaacc ggtgaccatg taggtgttta ctgtgaaaat ttgccagaaa cagtcgaaga 1080

agcagaaaga ttgttaggtt tctcacctga tgtatatttt tccatacaca ccgaaagaga 1140

agacggtact ccattaagtg gttcttcatt gtctccacct tttccacctt gcactttgag 1200

aacagcatta accagatacg ccgatgtttt gtccagtcct aaaaagtctg cattggtcgc 1260

cttagctgca catgcatcag atccatccga agccgacaga ttgaaatatt tggctagtcc 1320

ttctggtaaa gatgaatacg ctcaatgggt tgtcgcaagt caaagatctt tgttagaaat 1380

tatggccgaa tttccatctg ctaagccacc tttgggtgtc ttctttgccg ctgtagctcc 1440

aagattgcaa cctagatact acagtatctc ttcatcccca aagatggttc cttctagaat 1500

acatgttacc tgtgcattgg tctgcgataa aatgccaact ggtagaatcc acaagggtat 1560

ttgttcaaca tggatgaaat atgccgttcc attagaagaa tcacaagatt gctcctgggc 1620

acctatcttc gttagacaat caaacttcaa attgccagct gatacctccg tccctatcat 1680

tatgattggt ccaggtacag gtttagctcc tttcagaggt ttcttgcaag aaagatttgc 1740

attgaaggaa gctggtgcag aattgggtag ttctatcttg ttctttggtt gtagaaacag 1800

aaagatggat tacatctacg aagacgaatt gaacggtttc gtagaaagtg gtgctttgtc 1860

tgaattgatc gttgcatttt caagagaagg tccaactaag gaatacgttc aacataagat 1920

gatggaaaag gctagtgata tctggaacgt catctctcaa ggtggttata tatacgtatg 1980

cggtgacgct aagggtatgg caagagacgt tcatagaact ttgcacacaa tcttacaaga 2040

acaaggttct ttagattcat ccaaggctga atcaatggta aagaacttac aaatgactgg 2100

tagatacttg agagatgtct aaggcgcgcc 2130

<210> 4

<211> 2304

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 4

acctggtaaa acaatgtgga gaattaaatt tggtgaaggt gctaacgatc cattgttatt 60

ttcaacaaac aattttcatg gtagacaaac ttgggaattt gatccagatg ctggtactga 120

agaagaaaga gcagaagttg aagctgcaag agaacatttc tacgaaaaca gattcaaagt 180

tcaaccatct tcagatttgt tatggagatt ccaaatcttg agagaaaaga atttcaagca 240

agaaatccca ccagttagag ttggtgaagg tgaagatatt acttacgatc aagctacagc 300

tgcttttaga agagctgcaa cattttggaa tgcattacaa tctccacatg gtcattggcc 360

agctgaaaat gcaggtccaa acttctactt cccaccattg gttatggctg catacattcc 420

aggttactta aacgttattt tctctgctga acataagaaa gaaatcttga gatacactta 480

caatcatcaa aatgaagatg gtggttgggg tttacatatt gcaggtccat ctatgatgtt 540

cactacatgt ttgaattact gtatgatgag aattttaggt gacggtccag atggtggtag 600

agataatgca tgtgctagag caagaaaatg gattttggat agaggtggtg cttattactc 660

agcatcttgg ggtaaaacat ggatggctat tttaggtgtt tatgattggg aaggttctaa 720

tccaatgcca ccagaatttt ggactggttc aacattgttg ccattccatc catctaagat 780

gttctgttac tgtagattga cttacttacc aatgtcatac ttctacgcta caagatttgt 840

tggtccaatt actccattgg ttgaagaatt gagacaagaa atctattgtg aaccatactc 900

tgaaattaat tggccaaaag ttagacattg gtgtgcaaca gaagataatt attacccaca 960

tggtagagtt caaagattca tgtgggatgg tttctacaac atcgttgaac cattgttgaa 1020

gagatggcct tttaagaaag ttagagataa cgctatccaa ttcactatcg atcaaatcca 1080

ttacgaagat gaaaactcaa gatacatcac tattggttgt gttgaaaaac cattgatgat 1140

gttagcttgt tgggcagaag atccatctgg tgaagccttt aagaaacatt tgccaagagt 1200

tactgattac atctggttgg gtgaagatgg tattaaaatg caatcatttg gttcacaatc 1260

ttgggattgt gcattggtta ttcaagcatt gttagctggt aatttgaatg ctgaaatggg 1320

tccaacattg aagaaagcac atgaattctt gaagatctct caagttagaa ttaatacttc 1380

tggtgactac ttgtctcatt tcagacatat ctcaaagggt gcttggacat tttctgatag 1440

agatcatggt tggcaagttt cagattgtac tgctgaagca ttaagatgtt gttgtatctt 1500

cgctaacatg tctccagaag ttgttggtga accaatggaa gcagaaagaa tgtacgattc 1560

agttaacgtt atcatgtcat tgcaatctcc aaatggtggt gtttctgctt gggaaccaac 1620

aggtgcacca aaatggttgg aatggttgaa cccagttgaa ttcttggaag atttggttat 1680

tgaatacgaa tacatcgaat gtacatcttc atctatccaa gcattgactt tgtttagaaa 1740

attgtatcca ggtcatagaa gaaaggaaat taataacttc atcactagag ctgcagatta 1800

catcgaagat atccaatacc cagatggttc atggtatggt aattggggta tttgttttgt 1860

ttacggttct tggtttgcta ttaaaggttt agaagctgca ggtagaacat acaacaactg 1920

tgaagctgtt agaaagggtg ttgatttctt gttgaagact caaagagcag atggtggttg 1980

gggtgaacat tacacttcat gtacaaataa gaaatacact gctcaagatt ctacaaattt 2040

ggttcaaact gcattgggtt taatgggttt aattcatggt agacaagctg aaagagatcc 2100

aacaccaatt catagagctg cagctgtttt gatgaatggt caattagatg atggtgactt 2160

tccacaacaa gaattgatgg gtgtttttat gagaaacgct atgttgcatt acgcagctta 2220

cagaaacatc ttcccattgt gggcattggg tgaatacaga actttggttt ctttaccaat 2280

taagaaaatt gcttaaggcg cgcc 2304

<210> 5

<211> 1458

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 5

acctggtatg gaagttttct ttttgagttt gttgttgatt tttgttttgt ccgtcagtat 60

cggtttacat ttgttgttct ataagcacag atcccatttt acaggtccaa acttgcctcc 120

aggtaaaatt ggttggccta tggtcggtga atccttggaa ttcttaagta ccggttggaa 180

gggtcaccca gaaaagttta ttttcgatag aatctccaag tactcttcag aagtctttaa 240

aactagtttg ttaggtgaac ctgctgcagt attcgctggt gccgctggta ataagttctt 300

gttctccaac gaaaacaaat tagttcatgc atggtggcca tccagtgtcg ataaggtatt 360

tccttcttca actcaaacat ccagtaaaga agaagccaaa aagatgagaa agttgttgcc 420

acaatttttc aagcctgaag cattgcaaag atacataggt atcatggatc atatagcaca 480

aagacacttt gccgattctt gggacaacag agatgaagta attgttttcc cattagccaa 540

aagattcact ttctggttgg cttgtagatt gtttatgtct attgaagacc cagctcatgt 600

tgcaaaattt gaaaagcctt tccacgtatt ggcttcaggt ttaatcacag ttccaattga 660

tttgccaggt accccttttc atagagccat caaggcttct aacttcatca gaaaggaatt 720

gagagctatt attaagcaaa gaaagatcga cttagcagag ggtaaagcat ctcaaaacca 780

agatatcttg tcacatatgt tgttggctac agatgaagac ggttgtcaca tgaacgaaat 840

ggaaatcgca gacaagatct tgggtttgtt gattggtggt catgataccg catcagcagc 900

catcacattt ttgattaaat acatggccga attaccacac atctatgaaa aggtatacga 960

agaacaaatg gaaatcgcta actccaaagc tccaggtgaa ttattaaatt gggatgacgt 1020

tcaaaacatg agatacagtt ggaatgttgc ttgcgaagtc atgagattgg caccaccttt 1080

acaaggtgcc tttagagaag ctataaccga ttttgttttc aacggtttct ctatcccaaa 1140

aggttggaag ttatactggt ctgctaactc aactcataag tcaccagaat gttttccaca 1200

acctgaaaac tttgatccta ctagattcga gggtaatggt ccagctcctt atacatttgt 1260

tccattcggt ggtggtccaa gaatgtgccc tggtaaagaa tacgcaagat tggaaatctt 1320

ggtctttatg cacaacgttg tcaaaagatt caagtgggac aaattgttac ctgatgaaaa 1380

gattattgtt gacccaatgc caatgccagc aaaaggttta ccagtcagat tacatccaca 1440

taagccataa ggcgcgcc 1458

Claims

1. protein is following any:

(A1) amino acid sequence is the protein of the sequence 1 in sequence table；

(A2) amino acid sequence shown in sequence 1 in sequence table by the substitution of one or several amino acid residues and/or is lacked Mistake and/or addition and protein with the same function；

(A3) have 99% or more, 95% or more, 90% or more, 85% or more with amino acid sequence defined by (A1) or (A2) Or 80% or more homology and protein with the same function；

(A4) fusion protein obtained after N-terminal and/or C-terminal the connection label of protein defined by any in (A1)-(A3).

2. encoding the nucleic acid molecules of protein described in claim 1.

3. nucleic acid molecules according to claim 2, it is characterised in that: the nucleic acid molecules are following any:

(B2) hybridize and encode DNA points of protein described in claim 1 with (B1) DNA molecular limited under strict conditions Son；

(B3) with (B1) or (B2) limit DNA sequence dna have 99% or more, 95% or more, 90% or more, 85% or more or 80% or more homology, and encode the DNA molecular of protein described in claim 1.

4. recombinant vector, expression cassette, transgenic cell line or recombinant microorganism containing nucleic acid molecules described in Claims 2 or 3.

5. recombinant vector according to claim 4, expression cassette, transgenic cell line or recombinant microorganism, it is characterised in that: The recombinant microorganism is obtained after the nucleic acid molecules are imported saccharomyces cerevisiae.

6. enzyme preparation or triterpene 2 α-hydroxylation enzyme preparation are hydroxylated, comprising in protein or claim 2-5 described in claim 1 Any recombinant vector, expression cassette, transgenic cell line or the recombinant microorganism.

7. application, for as follows (C) or (D) or (E):

(C) protein described in claim 1 it is following it is any in application:

C1) it is used as 2 α-hydroxylases of hydroxylase or triterpene, or preparation that there are the 2 α-hydroxylase activity productions of hydroxylase or triterpene Product；

C3) degradation oleanolic acid and/or malol, or prepare the product for degrade oleanolic acid and/or malol；

(D) nucleic acid molecules described in claim 2 or 3 or recombinant vector described in claim 4 or 5, expression cassette, transgenosis are thin Born of the same parents system or recombinant microorganism it is following it is any in application:

D1 protein described in claim 1) is prepared；

D4) degradation oleanolic acid and/or malol, or prepare the product for degrade oleanolic acid and/or malol；

(E) hydroxylation enzyme preparation or triterpene 2 α-hydroxylation enzyme preparation as claimed in claim 6 it is following it is any in application:

8. the preparation method of protein described in claim 1 includes the following steps: to cultivate the micro- life of recombination described in claim 5 Object enables the nucleic acid molecules to express, and obtains the recombinant microorganism culture containing protein described in claim 1；From institute State the isolated protein in recombinant microorganism culture.

9. the preparation method of hawthorn acid and/or Corosolic acid, includes the following steps: using oleanolic acid and/or malol as substrate Catalysis reaction, which is carried out, with protein described in claim 1 obtains hawthorn acid and/or Corosolic acid.

10. the preparation method of hawthorn acid and/or Corosolic acid, including the following steps: will be containing protein described in claim 1 The expression cassette of encoding gene imports in the receptor biological cell that can generate oleanolic acid and/or malol, and it is thin to obtain recombination biology Born of the same parents；The recombination biological cell is cultivated, the encoding gene of protein described in claim 1 is expressed, obtains expressing the albumen The cell culture of matter；Hawthorn acid and/or Corosolic acid are obtained from the cell culture of the expression protein；It is described Receptor biological cell is microbial cell, plant cell or non-human animal cell.