CN109468287B - Hydroxylase mutant - Google Patents
Hydroxylase mutant Download PDFInfo
- Publication number
- CN109468287B CN109468287B CN201811396041.1A CN201811396041A CN109468287B CN 109468287 B CN109468287 B CN 109468287B CN 201811396041 A CN201811396041 A CN 201811396041A CN 109468287 B CN109468287 B CN 109468287B
- Authority
- CN
- China
- Prior art keywords
- leu
- val
- lys
- glu
- pro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P33/00—Preparation of steroids
- C12P33/06—Hydroxylating
Abstract
The invention obtains hydroxylase mutants SEQ ID NOs:3-4 with improved enzyme activity by a directed evolution method, and the mutants or the expression microorganisms thereof can efficiently catalyze dammarenediol to prepare protopanoxadiol through hydroxylation reaction, thereby having industrial development and application prospects.
Description
Technical Field
The invention belongs to the field of biocatalysis, and relates to a hydroxylase mutant, in particular to a dammarenediol hydroxylase mutant and application thereof in synthesizing protopanoxadiol.
Background
Ginsenoside is a general term for saponins separated from ginseng and other congeneric plants (such as panax notoginseng, American ginseng, etc.), belongs to triterpenoid saponin, and is a main effective component in ginseng. At present, at least 60 saponins have been isolated from ginseng, some of which have been shown to have a wide range of physiological functions and medicinal value: including the functions of resisting tumor, regulating immunity, resisting fatigue, protecting heart, protecting liver, etc. Ginsenosides are generally classified into three types, an oleanane type, a protopanaxadiol type (PPD type) and a protopanaxatriol type (PPT type), depending on the form of aglycone. Protopanaxadiol (PPD) is an important precursor for the synthesis of ginsenoside compounds, which is generally synthesized by the catalysis of hydroxylase by dammarenediol (DMD). The reaction formula is as follows:
hydroxylase of Ginseng Panax Ginseng which catalyzes this reaction has been cloned and identified (Han, J. -Y.,. H. -S.Hwang, S. -W.Choi, H. -J.Kim and Y.E.Choi.Cytochrome P450 CYP716A53v2 catalysis format of Protopaxatriol from Protopaxadiol During Ginsonoside biosynthesis in Panax Ginseng. plant Cell Physiol.2012,53(9): 1535. 1545.). The CYP716A47 protein derived from Panax Ginseng, also known as protopanaxadiol synthase (PPDS), or dammarenediol hydroxylase (DMD hydroxylase), can selectively catalyze DMD substrate to hydroxylate at C-12 position to generate PPD. But the catalytic efficiency of the DMD hydroxylase is low, and if the DMD hydroxylase is modified, the enzyme activity is greatly improved, so that feasibility is provided for industrial application.
Disclosure of Invention
In order to develop the dammarenediol hydroxylase (referred to as hydroxylase for short) with high catalytic efficiency, the invention establishes a hydroxylase gene mutation library by an error-prone PCR method on the basis of dammarenediol hydroxylase (Genebank: AEY75213.1, namely SEQ ID NO:1, named as DMDH) from ginseng PanaxGinseng, and then obtains the hydroxylase mutant with obviously improved enzyme activity by screening the gene mutation library.
Accordingly, a first object of the present invention is to provide a hydroxylase having an amino acid sequence of:
3, which is a mutant of SEQ ID NO. 1 with M at position 186 replaced by L and K at position 321 replaced by A, namely:
MVLFFSLSLLLLPLLLLFAYFSYTKRIPQKENDSKAPLPPGQTGWPLIGETLNYLSCVKSGVSENFVKYRKEKYSPKVFRTSLLGEPMAILCGPEGNKFLYSTEKKLVQVWFPSSVEKMFPRSHGESNADNFSKVRGKMMFLLKVDGMKKYVGLMDRVMKQFLETDWNRQQQINVHNTVKKYTVTLSCRVFMSIDDEEQVTRLGSSIQNIEAGLLAVPINIPGTAMNRAIKTVKLLTREVEAVIKQRKVDLLENKQASQPQDLLSHLLLTANQDGQFLSESDIASHLIGLMQGGYTTLNGTITFVLNYLAEFPDVYNQVLAEQVEIANSKHPKELLNWEDLRKMKYSWNVAQEVLRIIPPGVGTFREAITDFTYAGYLIPKGWKMHLIPHDTHKNPTYFPSPEKFDPTRFEGNGPAPYTFTPFGGGPRMCPGIEYARLVILIFMHNVVTNFRWEKLIPNEKILTDPIPRFAHGLPIHLHPHN (SEQ ID NO: 3); or
4, which is a mutant of SEQ ID No. 1 with F at position 120 replaced by a, M at position 186 replaced by L, and S at position 279 replaced by a, namely:
MVLFFSLSLLLLPLLLLFAYFSYTKRIPQKENDSKAPLPPGQTGWPLIGETLNYLSCVKSGVSENFVKYRKEKYSPKVFRTSLLGEPMAILCGPEGNKFLYSTEKKLVQVWFPSSVEKMAPRSHGESNADNFSKVRGKMMFLLKVDGMKKYVGLMDRVMKQFLETDWNRQQQINVHNTVKKYTVTLSCRVFMSIDDEEQVTRLGSSIQNIEAGLLAVPINIPGTAMNRAIKTVKLLTREVEAVIKQRKVDLLENKQASQPQDLLSHLLLTANQDGQFLAESDIASHLIGLMQGGYTTLNGTITFVLNYLAEFPDVYNQVLKEQVEIANSKHPKELLNWEDLRKMKYSWNVAQEVLRIIPPGVGTFREAITDFTYAGYLIPKGWKMHLIPHDTHKNPTYFPSPEKFDPTRFEGNGPAPYTFTPFGGGPRMCPGIEYARLVILIFMHNVVTNFRWEKLIPNEKILTDPIPRFAHGLPIHLHPHN(SEQ ID NO:4)。
preferably, the amino acid sequence of the hydroxylase is SEQ ID NO. 3.
The second object of the present invention is to provide a gene encoding the above hydroxylase.
The third object of the present invention is to provide a plasmid containing the above gene.
Considering that DMD hydroxylase belongs to cytochrome P450 monooxygenase, and P450 reductase is required to be present as a helper protein to perform a normal function when a catalytic reaction is performed, it is necessary to co-express the helper enzyme P450 reductase simultaneously with the expression of DMD hydroxylase. P450 reductases include, for example, but are not limited to, the Arabidopsis thaliana derived CPR2 enzyme (Genebank: NP-849472.2), SEQ ID NO: 5.
Thus, in a preferred embodiment, the plasmid comprising the above gene further comprises the gene SEQ ID NO 6 encoding P450 reductase SEQ ID NO 5 for co-expression of hydroxylase and P450 reductase.
Preferably, the backbone of the co-expression plasmid is the pYES2.1 vector.
It is a fourth object of the present invention to provide a microorganism transformed with the above-described plasmid co-expressing hydroxylase and P450 reductase.
As an alternative, the hydroxylase and the P450 reductase may be located on separate plasmids, and the transformants obtained after co-transformation of the microorganism with these two plasmids may also express the P450 reductase SEQ ID NO 5 and the hydroxylase.
When the hydroxylase and the P450 reductase may be located on different plasmids, respectively, the backbone of both plasmids may be the pUC57 vector.
Preferably, the microorganism is selected from the group consisting of Saccharomyces cerevisiae and yarrowia lipolytica. More preferably Saccharomyces cerevisiae BY4742 (EUROSCARF).
The fifth object of the present invention is to provide the use of the above hydroxylase or microorganism for the synthesis of protopanaxadiol.
In one embodiment, the application takes dammarenediol as a substrate raw material, and the protopanaxadiol is prepared through hydroxylation reaction under the catalysis of hydroxylase and P450 reductase.
Preferably, the above-mentioned enzyme-catalyzed reaction is carried out at pH7.4 and a temperature of 30 ℃.
3-4 of the hydroxylase mutant, namely SEQ ID NOs, obviously improves the catalytic activity of hydroxylation reaction, can efficiently catalyze a substrate dammarenediol to generate protopanoxadiol, has mild catalytic reaction conditions, and has industrial development and application prospects.
Detailed Description
The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.
The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.
In the examples herein, if no specific description is made about the reaction temperature or the operation temperature, the temperature is usually referred to as room temperature (15 to 30 ℃).
For the sake of brevity, the amino acid abbreviations herein may be used in either the three or single letter English, as is well known to those skilled in the art, and are set forth in the following table:
TABLE 1 amino acids Chinese and English controls and abbreviations
| Alanine | Alanine | A or Ala | Aliphatic group |
| Arginine | Arginine | R or Arg | Basic amino acids |
| Asparagine | Asparagine | N or Asn | Amides of amides |
| Aspartic acid | Aspartic acid | D or Asp | Acidic amino acids |
| Cysteine | Cysteine | C or Cys | Containing sulfur |
| Glutamine | Glutamine | Q or Gln | Amides of amides |
| Glutamic acid | Glutamic acid | E or Glu | Acidic amino acids |
| Glycine | Glycine | G or Gly | Aliphatic group |
| Histidine | Histidine | H or His | Basic amino acids |
| Isoleucine | Isoleucine | I or Ile | Aliphatic group |
| Leucine | Leucine | L or Leu | Aliphatic group |
| Lysine | Lysine | K or Lys | Basic amino acids |
| Methionine | Methionine | M or Met | Containing sulfur |
| Phenylalanine | Phenylalanine | F or Phe | Aromatic compounds |
| Proline | Proline | P or Pro | Imino acid |
| Serine | Serine | S or Ser | Hydroxy radicals |
| Threonine | Threonine | T or Thr | Hydroxy radicals |
| Tryptophan | Tryptophan | W or Trp | Aromatic compounds |
| Tyrosine | Tyrosine | Y or Tyr | Aromatic compounds |
| Valine | Valine | V or Val | Aliphatic group |
As a basic template for the construction of hydroxylase mutants, dammarenediol hydroxylase derived from Panax Ginseng (Genebank: AEY75213.1, herein designated as DMDH) has the amino acid sequence of SEQ ID NO: 1:
MVLFFSLSLLLLPLLLLFAYFSYTKRIPQKENDSKAPLPPGQTGWPLIGETLNYLSCVKSGVSENFVKYRKEKYSPKVFRTSLLGEPMAILCGPEGNKFLYSTEKKLVQVWFPSSVEKMFPRSHGESNADNFSKVRGKMMFLLKVDGMKKYVGLMDRVMKQFLETDWNRQQQINVHNTVKKYTVTMSCRVFMSIDDEEQVTRLGSSIQNIEAGLLAVPINIPGTAMNRAIKTVKLLTREVEAVIKQRKVDLLENKQASQPQDLLSHLLLTANQDGQFLSESDIASHLIGLMQGGYTTLNGTITFVLNYLAEFPDVYNQVLKEQVEIANSKHPKELLNWEDLRKMKYSWNVAQEVLRIIPPGVGTFREAITDFTYAGYLIPKGWKMHLIPHDTHKNPTYFPSPEKFDPTRFEGNGPAPYTFTPFGGGPRMCPGIEYARLVILIFMHNVVTNFRWEKLIPNEKILTDPIPRFAHGLPIHLHPHN(SEQ ID NO:1)。
the coding gene sequence of DMDH is SEQ ID NO: 2:
atggttttgttcttttctttgtctttgttgttgttgccattgttattattgtttgcttatttttcttacactaaacgtattcctcaaaaggaaaacgactctaaggctccattgccacccggtcaaactggatggccattgattggtgaaactttaaattacttgtcttgtgttaagtctggtgtttctgaaaacttcgttaagtatagaaaggaaaaatattctccaaaggttttcagaacttctttattgggtgaaccaatggctattttgtgcggtccagaaggtaataagttcttgtattcaactgaaaagaagttggtccaagtttggttcccttcttcagttgaaaaaatgttccctcgttctcacggagagtcaaacgcagataacttttctaaagttagaggtaaaatgatgttcttattaaaagttgatggtatgaaaaaatatgttggtttgatggatagagttatgaaacaattcttggagactgattggaatagacaacaacaaattaatgttcataacactgttaaaaagtacacagttactatgtcttgtagagttttcatgtcaattgacgacgaagagcaagttacaagattgggttcttcaatacaaaatattgaagctggtttgttggctgttccaattaatattcccggtactgcaatgaatagagctattaaaacagttaaattgttaactagagaagttgaagctgttataaaacaaagaaaagttgatttattggaaaacaagcaagcttcacaaccacaagatttgttatctcatttgttgttgactgctaatcaagatggtcaatttttgtcagaatcagatattgcatctcatttgattggattgatgcaaggtggttacacaacattaaacggtacaataacatttgttttaaattatttggctgaatttccagatgtttataatcaagttttgaaagaacaagttgaaattgctaattcaaaacatccaaaagaattgttaaattgggaagacttgagaaagatgaagtattcttggaacgtcgctcaagaagtcttgaggattattccacccggtgttggtactttcagagaagctataactgattttacatacgctggttacttgattccaaaaggttggaaaatgcatttgattccacatgatactcataaaaatccaacttatttcccatctccagaaaaatttgacccaactagattcgaaggtaacggaccagctccatacactttcactccattcggtggtggacctaggatgtgccccggtattgagtatgctaggttagttatattgatatttatgcataatgttgttacaaattttagatgggaaaaattgataccaaatgaaaagattttgactgacccaattccaagattcgctcacggtttgccaatacatttacatccacataattag
(SEQ ID NO:2)。
in order to obtain a hydroxylase mutant with higher enzyme activity, the gene sequence SEQ ID NO. 2 of the DMDH is subjected to point mutation. Obtaining mutant amino acid sequences substituted by one or more amino acid sites by error-prone PCR technology, screening several sites capable of improving enzyme activity, and then obtaining 2 mutants with obviously improved enzyme activity in a site-specific combination mutation mode.
Herein, the terms "hydroxylase", "DMD hydroxylase", "protopanaxadiol synthase", "PPDS", "dammarenediol hydroxylase" mean the same. The hydroxylase with the amino acid sequence of SEQ ID NO. 1 is abbreviated as 'DMDH', and is CYP716A47 protein derived from Panax Ginseng. DMD hydroxylase belongs to cytochrome P450 monooxygenase, and requires a P450 reductase such as the Arabidopsis thaliana derived CPR2 enzyme (Genebank: NP-849472.2) as a helper protease when catalyzed.
In one embodiment, the amino acid sequence of the CPR2 enzyme described above (Genebank: NP-849472.2) is SEQ ID NO: 5:
MSSSSSSSTSMIDLMAAIIKGEPVIVSDPANASAYESVAAELSSMLIENRQFAMIVTTSIAVLIGCIVMLVWRRSGSGNSKRVEPLKPLVIKPREEEIDDGRKKVTIFFGTQTGTAEGFAKALGEEAKARYEKTRFKIVDLDDYAADDDEYEEKLKKEDVAFFFLATYGDGEPTDNAARFYKWFTEGNDRGEWLKNLKYGVFGLGNRQYEHFNKVAKVVDDILVEQGAQRLVQVGLGDDDQCIEDDFTAWREALWPELDTILREEGDTAVATPYTAAVLEYRVSIHDSEDAKFNDINMANGNGYTVFDAQHPYKANVAVKRELHTPESDRSCIHLEFDIAGSGLTYETGDHVGVLCDNLSETVDEALRLLDMSPDTYFSLHAEKEDGTPISSSLPPPFPPCNLRTALTRYACLLSSPKKSALVALAAHASDPTEAERLKHLASPAGKVDEYSKWVVESQRSLLEVMAEFPSAKPPLGVFFAGVAPRLQPRFYSISSSPKIAETRIHVTCALVYEKMPTGRIHKGVCSTWMKNAVPYEKSENCSSAPIFVRQSNFKLPSDSKVPIIMIGPGTGLAPFRGFLQERLALVESGVELGPSVLFFGCRNRRMDFIYEEELQRFVESGALAELSVAFSREGPTKEYVQHKMMDKASDIWNMISQGAYLYVCGDAKGMARDVHRSLHTIAQEQGSMDSTKAEGFVKNLQTSGRYLRDVW(SEQ ID NO:5)。
the coding gene sequence is SEQ ID NO: 6:
atgtcttcttcttcatcatcttcaacttctatgattgacttgatggcagcaattattaagggagaaccagtcattgtctctgatccagctaacgcttctgcatatgagtctgtcgcagctgagttgtcttctatgttaattgaaaatagacagtttgctatgattgttactacatcaattgcagtcttgattggttgtattgttatgttggtttggaggaggtctggatctggtaattcaaagagagttgaacctttaaaacctttagttattaaaccaagagaagaagaaattgacgatggtcgtaaaaaagttactatcttttttggaactcagactggtactgctgagggtttcgctaaagctttgggtgaggaggctaaggctagatatgaaaaaactagattcaagattgttgatttggatgattacgctgcagacgacgacgaatacgaggaaaaattgaaaaaagaagatgtcgctttcttctttttagctacatatggtgacggtgaaccaacagacaatgctgcaagattttacaagtggttcacagaaggaaatgatcgtggtgagtggttgaaaaatttgaaatatggtgtttttggtttgggaaacagacaatacgagcatttcaataaagttgcaaaagtcgttgatgatattttagtcgaacaaggtgctcagagattggtccaagtcggtttgggtgacgatgatcaatgtatagaggatgacttcacagcttggagggaggctttgtggccagaattggatactattttgagagaggaaggtgatacagctgtcgctacaccatacactgctgcagtcttggagtacagagtttcaattcatgattctgaagatgcaaaatttaacgatattaacatggctaatggtaatggttatactgttttcgatgctcaacatccatacaaggcaaacgtcgcagtcaagagggagttgcacacaccagaatcagatagatcatgcattcatttagagtttgacatagctggttctggtttgacatacgaaactggtgaccacgttggtgtcttgtgcgacaacttgtcagagacagtcgatgaagctttgagattattagacatgtctccagacacttatttctctttgcatgctgagaaagaagatggtactccaatttcatcttcattgcctcctccattcccaccttgcaacttaagaactgctttgactagatacgcttgtttgttgtcttctcctaagaaatctgctttggtcgctttggctgcacatgcttctgatccaacagaggcagagaggttaaagcacttggcatcaccagctggaaaggttgatgagtactctaagtgggtcgtcgagtcacagcgttctttgttagaagttatggcagagttcccttcagctaagccaccattgggtgtcttcttcgctggagttgcaccaaggttgcaaccaagattttattctatttcttcttctccaaagattgcagaaactaggattcatgttacttgtgctttggtttacgaaaaaatgccaactggtcgtattcataaaggtgtctgttctacatggatgaagaacgctgttccttatgaaaaatctgaaaactgttcatcagctcctatattcgtcagacaatctaacttcaagttaccttcagattcaaaggttccaattattatgattggtcccggtactggattggcaccttttcgtggtttcttgcaagaaaggttggctttggttgagtctggtgtcgaattgggaccatcagtcttgtttttcggttgtaggaacagaagaatggatttcatttatgaggaggaattgcaaaggtttgttgagtctggtgctttggcagagttgtctgtcgctttctctagggagggtcctacaaaggaatacgttcaacataaaatgatggataaagcatctgatatatggaatatgatttcacaaggagcttatttgtatgtctgcggtgatgcaaagggtatggctagggacgtccatcgttctttacatactattgctcaagaacaaggttctatggattcaacaaaggctgaaggatttgttaagaacttgcaaacttctggaagatatttgagagatgtctggtag(SEQ ID NO:6)。
as used herein, the terms "wild type", "wild enzyme", "wild type enzyme" and "WT" mean the same and refer to the hydroxylase DMDH (SEQ ID NO:1) without genetic engineering.
The 2 hydroxylase mutants SEQ ID NOs 3-4 screened by the invention have the common characteristic that forward mutation M186L with one site is relative to SEQ ID NO 1, which indicates that at least the site-directed mutation of 186 th amino acid may cause the change of enzyme activity.
Since the hydroxylase mutants of the present invention (SEQ ID NOs:3-4) have a definite amino acid sequence, those skilled in the art can easily obtain the genes encoding them, expression cassettes and plasmids containing them, and transformants containing the plasmids. These genes, expression cassettes, plasmids, and transformants can be obtained by genetic engineering construction means well known to those skilled in the art.
The above-mentioned transformant host may be any microorganism, including bacteria and fungi, suitable for expressing the hydroxylase mutants of SEQ ID NOs:3-4 and the P450 reductase. Preferably the microorganism is Saccharomyces cerevisiae or yarrowia lipolytica, more preferably Saccharomyces cerevisiae BY 4742.
When used as a biocatalyst for the production of protopanaxadiol, the hydroxylase and P450 reductase of the present invention may be in the form of an enzyme or in the form of a bacterial cell. The enzyme forms comprise free enzyme and immobilized enzyme, including purified enzyme, crude enzyme, fermentation liquor, enzyme immobilized by a carrier and the like; the form of the thallus comprises a viable thallus and a dead thallus.
The separation and purification of the hydroxylase and the P450 reductase of the present invention, including immobilized enzyme preparation techniques, are also well known to those skilled in the art.
Examples
Materials and methods
The whole gene synthesis herein is performed by Suzhou Jinzhi Biotechnology, Inc.; the expression vector was subcloned by Wai Biotechnology Limited, Zhejiang. Primer synthesis and sequencing were performed by Suzhou Jinzhi Biotechnology, Inc.
The molecular biological experiments herein include plasmid construction, digestion, ligation, competent cell preparation, transformation, culture medium preparation, and the like, and are mainly performed with reference to molecular cloning, a guide to experiments (third edition), edited by j. sambrook, d.w. russell, huang peitang et al, scientific press, beijing, 2002). The specific experimental conditions can be determined by simple experiments if necessary.
PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the supplier of the plasmid or DNA template. If necessary, it can be adjusted by simple experiments.
High Performance Liquid Chromatography (HPLC) determination of DMD and PPD content
Shimadzu LC-20A liquid chromatograph, Shodex C18-120-54E column (5 μm,4.6 mm. times.250 mm) chromatographic column, column temperature 35 deg.C, mobile phase A water, mobile phase B acetonitrile, gradient elution: 0min (35% B),55min (90% B),50-55min (90% B),55-65min (35% B). Flow rate: 0.8ml/min, wavelength 203 nm.
Both DMD and PPD were purchased from ChemFaces Biotechnology, Inc., Wuhan.
2. Determination of hydroxylase Activity
And (3) preparing protein micro-bodies for enzyme activity determination reaction. A500. mu.l reaction system included: 100mM potassium phosphate, pH7.4, containing 1mM NADPH, 50 micromolar substrate DMD and 1mg protein microminiature. The reaction system was incubated at 30 ℃ for 2h and extracted twice with n-hexane. After drying the sample in vacuo, it was redissolved in 500. mu.l of methanol and analyzed in the liquid phase.
Definition of enzyme activity: the amount of enzyme required to catalyze DMD to produce 1 micromole (mol) of PPD per minute at pH7.4 at 30 ℃ is defined as 1 unit (U).
3. Culture medium
YPD medium: 10g/L yeast extract, 20g/L tryptone, 20g/L glucose. (20 g/L agar powder was additionally added to the solid medium.)
EXAMPLE 1 construction of wild-type DMDH and CPR2 Gene Co-expression plasmid
1. The DMDH gene SEQ ID NO:2 (or PgPPDS) and the CPR2 gene SEQ ID NO:6 (or AtCPR2) are synthesized by Jinweizhi Biotech., Suzhou, and the target gene is loaded on a pUC57 vector to obtain pUC57-DMDH and pUC57-CPR2 plasmids for subsequent PCR amplification of a template.
2. The construction of wild-type DMDH and CPR2 gene coexpression plasmid includes the following steps:
2.1 amplification of the vector fragment was carried out using the vector pYES2.1/V5-his-TOPO from Invitrogen as a template and the following primer pair (5 '-3').
pYES2.1-vector-F:AAGCTGCGGCCCTGCATTAA，
pYES2.1-vector-R:ACGCGCCCTGTAGCGCCCCA。
2.2 the promoter TDH3p was amplified using the genomic DNA of Saccharomyces cerevisiae BY4742 as a template, using the following primer set (5 '-3').
TDH3p-F:ctgttccagagaacccccatg gtttaaacaccctggtcgacCAGTTCGAGTTTATCATTATC，
TDH3p-cpr2-R：GATGATGAAGAAGAAGACATTTTGTTTGTTTATGTGTGTT。
2.3 amplification of the Gene AtCPR2 using the synthetic AtCPR2 gene as a template, using the following primer set.
CPR2-tdh3-F:acacacataaacaaacaaaATGTCTTCTTCTTCATCATC，
CPR2-tpi1t-R:AATTATATTAATCCTACCAGACATCTCTCAAAT。
2.4 terminator TPI1t was amplified using the genomic DNA of Saccharomyces cerevisiae BY4742 as a template using the following primer pair.
TPI1t-cpr2-F:gatatttgagagatgtctggtagGATTAATATAATTATATAAAAA，
TPI1t-tef1p-R:GTAAGGATTCGCGGTCCTCG GCTCTTCTATATAACAGTTG。
2.5 OverlapPCR was performed on the above three fragments to obtain expression cassette TDH3p-AtCPR2-TPI1 t.
2.6 the promoter TEF1p was amplified using the genomic DNA of Saccharomyces cerevisiae BY4742 as a template using the following primer set.
TEF1p-tpi1t-F:ctgttatatagaagagcCGAGGACCGCGAATCCTTAC，
TEF1p-DMDH-R:GAAAAGAACAAAACCATTTTGTAATTAAAACTTAGATTAGA。
2.7 amplification of the PgPPDS gene using the synthesized PgPPDS gene as a template, using the following primer set.
DMDH-tef1p-F:ctaagttttaattacaaaATGGTTTTGTTCTTTTCTTT
DMDH-cyc1t-R:GGAAAAGGGGCCTGTCTAATTATGTGGATGTAAATGT
2.8 the terminator CYC1t was amplified using the Saccharomyces cerevisiae BY4742 genomic DNA as a template using the following primer pair.
CYC1t-DMDH-F:catttacatccacataattagACAGGCCCCTTTTCCTTTGT，
CYC1t-R:GAGGTTTTCACCGTCATCACCGGTTACATGCGTACACGCGTT。
2.9 overlap PCR was performed on the above three fragments to obtain the expression cassette TEF1p-DMDH-CYC1 t.
2.10 the vector fragment obtained above, TDH3p-CPR2-TPI1t and TEF1p-DMDH-CYC1t were assembled and ligated by Gibson method to complete plasmid construction to obtain a plasmid co-expressing DMDH and CPR2, which was designated pYES2.1-DMDH-CPR 2.
Example 2 construction of random mutant pool of hydroxylase by error-prone PCR
Random mutant libraries were constructed using the error-prone PCR technique using plasmid pYES2.1-DMDH-CPR2 obtained in example 1 as template, using the following primer pairs:
the forward primer Errorpcr-F: ATGGTTTTGTTCTTTTCTTT,
the reverse primer Errorpcr-R: AATTATGTGGATGTAAATGT.
The 50 μ L error-prone PCR reaction system included: 50ng plasmid template pYES2.1-DMDH-CPR2, 30pmol of a pair of primers Errorpcr-F and Errorpcr-R, 1 XTaq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mM dTTP, 7mM MgCl2，(0mM、0.05mM、0.1mM、0.15mM、0.2mM)MnCl22.5 units of Taq enzyme (Fermentas). The PCR reaction conditions are as follows: 5min at 95 ℃; 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 2 min/kbp; 30 cycles; 10min at 72 ℃. Gel 1.5kb random mutant fragment was recovered as a large primer, and Megaprimer PCR was performed using KOD-plus DNA polymerase: 5min at 94 ℃; 10s at 98 ℃, 30s at 60 ℃, 2min/kbp at 68 ℃ and 25 cycles; 10min at 68 ℃. DpnI digesting the plasmid template, transforming Saccharomyces cerevisiae BY4742(EUROSCARF) to obtain a product with a yield of more than 104Random mutant pools of individual clones.
EXAMPLE 3 expression and preparation of hydroxylase
The expression host is selected from Saccharomyces cerevisiae BY4742MATa his3 delta 1leu2 delta 0met15 delta 0ura3 delta 0 strain. Transformation, expression and enzyme solution preparation methods references (Han, J.Y., H.S.Hwang, S.W.Choi, H.J.Kim and Y.E.Choi.Cytochrome P450 CYP716A53v2 catalysis the Formation of Protopanaxatriol from Protopanaxadiol During Ginsonside biosyntheses in Panax Ginseng. plant Cell physiol.2012,53(9): 1535. 1545.) the following specific methods:
the host strain BY4742 was streaked on YPD solid medium, cultured at 30 ℃ for 2 days, and single colony was picked and transferred to a test tube containing 4ml of YPD liquid medium. Culturing at 30 deg.C and 220rpm overnight, transferring into 250ml shake flask containing 25ml YPD liquid culture medium, culturing at 30 deg.C and 220rpm for 4-6 hr, and culturing to OD6000.8 to 1.0, the preparation and Transformation of the strain to the Transformation competence of Saccharomyces cerevisiae using Frozen-EZ Yeast Transformation II Kit, with strict reference to the instructions, the Transformation product is spread with SC-leu (20 g/l glucose, 1.7g/l YNB basic nitrogen source, 50mg/l histidine, leucine and methionine each), cultured at 30 ℃ for 4 days, the mutant library is picked up, YPD medium is inoculated, after the culture, the strain is collected by centrifugation at 2000g 10min, resuspended with 50ml TEK buffer (100mM KCl,50mM Tris-HCl,1mM EDTA), centrifuged at 6100g 3min, and resuspended with 2ml extraction buffer (20mM β -mercaptoethanol, 1% BSA, 0.6M sorbitol, 50mM sHCl, 1mM EDTA), glass beads are added, resuspended with shaking, extraction buffer 6100g15min, the supernatant is filtered, and 50mM MgCl is added to the final concentration of 50mM MgCl2The ice bath was continued for 1h, 12500g was centrifuged for 5min, and the pellet was dissolved using 1ml of TEG (30% glycerol, 50mM Tris-HCl,1mM EDTA) and homogenized with Teflon to complete the proteosome solution.
Example 4 screening of hydroxylase mutants
And selecting mutant library transformants one by one, and preparing protein microbodies for enzyme activity determination reaction. The method for measuring the enzyme activity of the hydroxylase mutant is described in the section of the aforementioned determination of the enzyme activity of the hydroxylase.
In the random mutation library, about 2000 mutant clones were screened, and excellent mutants were screened as shown in table 1. The cloning of the two mutants is further verified, and after plasmid extraction, the two mutants are sent to Jinweizhi biotechnology company of Suzhou for sequencing confirmation, and the amino acid mutation sites are identified.
TABLE 1 relative enzyme Activity of mutants
The experimental results in the table 1 show that compared with the wild hydroxylase DMDH, the mutant SEQ ID NOs 3-4 obviously improve the enzyme activity, wherein the enzyme activity of the SEQ ID NO 3 is improved by more than 4 times, the substrate dammarenediol DMD can be efficiently catalyzed to generate the protopanaxadiol PPD, and the industrial development potential is achieved.
Sequence listing
<110> Zhejiang HuaRui Biotechnology Ltd
<120> a hydroxylase mutant
<130>SHPI1812133
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>482
<212>PRT
<213>Panax Ginseng
<400>1
Met Val Leu Phe Phe Ser Leu Ser Leu Leu Leu Leu Pro Leu Leu Leu
1 5 10 15
Leu Phe Ala Tyr Phe Ser Tyr Thr Lys Arg Ile Pro Gln Lys Glu Asn
20 25 30
Asp Ser Lys Ala Pro Leu Pro Pro Gly Gln Thr Gly Trp Pro Leu Ile
35 40 45
Gly Glu Thr Leu Asn Tyr Leu Ser Cys Val Lys Ser Gly Val Ser Glu
50 55 60
Asn Phe Val Lys Tyr Arg Lys Glu Lys Tyr Ser Pro Lys Val Phe Arg
65 70 75 80
Thr Ser Leu Leu Gly Glu Pro Met Ala Ile Leu Cys Gly Pro Glu Gly
85 90 95
Asn Lys Phe Leu Tyr Ser Thr Glu Lys Lys Leu Val Gln Val Trp Phe
100 105 110
Pro Ser Ser Val Glu Lys Met Phe Pro Arg Ser His Gly Glu Ser Asn
115 120 125
Ala Asp Asn Phe Ser Lys Val Arg Gly Lys Met Met Phe Leu Leu Lys
130 135 140
Val Asp Gly Met Lys Lys Tyr Val Gly Leu Met Asp Arg Val Met Lys
145 150 155 160
Gln Phe Leu Glu Thr Asp Trp Asn Arg Gln Gln Gln Ile Asn Val His
165 170 175
Asn Thr Val Lys Lys Tyr Thr Val Thr Met Ser Cys Arg Val Phe Met
180 185 190
Ser Ile Asp Asp Glu Glu Gln Val Thr Arg Leu Gly Ser Ser Ile Gln
195 200 205
Asn Ile Glu Ala Gly Leu Leu Ala Val Pro Ile Asn Ile Pro Gly Thr
210 215 220
Ala Met Asn Arg Ala Ile Lys Thr Val Lys Leu Leu Thr Arg Glu Val
225 230 235 240
Glu Ala Val Ile Lys Gln Arg Lys Val Asp Leu Leu Glu Asn Lys Gln
245 250 255
Ala Ser Gln Pro Gln Asp Leu Leu Ser His Leu Leu Leu Thr Ala Asn
260 265 270
Gln Asp Gly Gln Phe Leu Ser Glu Ser Asp Ile Ala Ser His Leu Ile
275 280 285
Gly Leu Met Gln Gly Gly Tyr Thr Thr Leu Asn Gly Thr Ile Thr Phe
290 295 300
Val Leu Asn Tyr Leu Ala Glu Phe Pro Asp Val Tyr Asn Gln Val Leu
305 310 315 320
Lys Glu Gln Val Glu Ile Ala Asn Ser Lys His Pro Lys Glu Leu Leu
325 330 335
Asn Trp Glu Asp Leu Arg Lys Met Lys Tyr Ser Trp Asn Val Ala Gln
340 345 350
Glu Val Leu Arg Ile Ile Pro Pro Gly Val Gly Thr Phe Arg Glu Ala
355 360 365
Ile Thr Asp Phe Thr Tyr Ala Gly Tyr Leu Ile Pro Lys Gly Trp Lys
370 375 380
Met His Leu Ile Pro His Asp Thr His Lys Asn Pro Thr Tyr Phe Pro
385 390 395 400
Ser Pro Glu Lys Phe Asp Pro Thr Arg Phe Glu Gly Asn Gly Pro Ala
405 410 415
Pro Tyr Thr Phe Thr Pro Phe Gly Gly Gly Pro Arg Met Cys Pro Gly
420 425 430
Ile Glu Tyr Ala Arg Leu Val Ile Leu Ile Phe Met His Asn Val Val
435 440 445
Thr Asn Phe Arg Trp Glu Lys Leu Ile Pro Asn Glu Lys Ile Leu Thr
450 455 460
Asp Pro Ile Pro Arg Phe Ala His Gly Leu Pro Ile His Leu His Pro
465 470 475 480
His Asn
<210>2
<211>1449
<212>DNA
<213>Panax Ginseng
<400>2
atggttttgt tcttttcttt gtctttgttg ttgttgccat tgttattatt gtttgcttat 60
ttttcttaca ctaaacgtat tcctcaaaag gaaaacgact ctaaggctcc attgccaccc 120
ggtcaaactg gatggccatt gattggtgaa actttaaatt acttgtcttg tgttaagtct 180
ggtgtttctg aaaacttcgt taagtataga aaggaaaaat attctccaaa ggttttcaga 240
acttctttat tgggtgaacc aatggctatt ttgtgcggtc cagaaggtaa taagttcttg 300
tattcaactg aaaagaagtt ggtccaagtt tggttccctt cttcagttga aaaaatgttc 360
cctcgttctc acggagagtc aaacgcagat aacttttcta aagttagagg taaaatgatg 420
ttcttattaa aagttgatgg tatgaaaaaa tatgttggtt tgatggatag agttatgaaa 480
caattcttgg agactgattg gaatagacaa caacaaatta atgttcataa cactgttaaa 540
aagtacacag ttactatgtc ttgtagagtt ttcatgtcaa ttgacgacga agagcaagtt 600
acaagattgg gttcttcaat acaaaatatt gaagctggtt tgttggctgt tccaattaat 660
attcccggta ctgcaatgaa tagagctatt aaaacagtta aattgttaac tagagaagtt 720
gaagctgtta taaaacaaag aaaagttgat ttattggaaa acaagcaagc ttcacaacca 780
caagatttgt tatctcattt gttgttgact gctaatcaag atggtcaatt tttgtcagaa 840
tcagatattg catctcattt gattggattg atgcaaggtg gttacacaac attaaacggt 900
acaataacat ttgttttaaa ttatttggct gaatttccag atgtttataa tcaagttttg 960
aaagaacaag ttgaaattgc taattcaaaa catccaaaag aattgttaaa ttgggaagac 1020
ttgagaaaga tgaagtattc ttggaacgtc gctcaagaag tcttgaggat tattccaccc 1080
ggtgttggta ctttcagaga agctataact gattttacat acgctggtta cttgattcca 1140
aaaggttgga aaatgcattt gattccacat gatactcata aaaatccaac ttatttccca 1200
tctccagaaa aatttgaccc aactagattc gaaggtaacg gaccagctcc atacactttc 1260
actccattcg gtggtggacc taggatgtgc cccggtattg agtatgctag gttagttata 1320
ttgatattta tgcataatgt tgttacaaat tttagatggg aaaaattgat accaaatgaa 1380
aagattttga ctgacccaat tccaagattc gctcacggtt tgccaataca tttacatcca 1440
cataattag 1449
<210>3
<211>482
<212>PRT
<213> Artificial sequence ()
<400>3
Met Val Leu Phe Phe Ser Leu Ser Leu Leu Leu Leu Pro Leu Leu Leu
1 5 10 15
Leu Phe Ala Tyr Phe Ser Tyr Thr Lys Arg Ile Pro Gln Lys Glu Asn
20 25 30
Asp Ser Lys Ala Pro Leu Pro Pro Gly Gln Thr Gly Trp Pro Leu Ile
35 40 45
Gly Glu Thr Leu Asn Tyr Leu Ser Cys Val Lys Ser Gly Val Ser Glu
50 55 60
Asn Phe Val Lys Tyr Arg Lys Glu Lys Tyr Ser Pro Lys Val Phe Arg
65 70 75 80
Thr Ser Leu Leu Gly Glu Pro Met Ala Ile Leu Cys Gly Pro Glu Gly
85 90 95
Asn Lys Phe Leu Tyr Ser Thr Glu Lys Lys Leu Val Gln Val Trp Phe
100 105 110
Pro Ser Ser Val Glu Lys Met Phe Pro Arg Ser His Gly Glu Ser Asn
115 120 125
Ala Asp Asn Phe Ser Lys Val Arg Gly Lys Met Met Phe Leu Leu Lys
130 135 140
Val Asp Gly Met Lys Lys Tyr Val Gly Leu Met Asp Arg Val Met Lys
145 150 155 160
Gln Phe Leu Glu Thr Asp Trp Asn Arg Gln Gln Gln Ile Asn Val His
165 170 175
Asn Thr Val Lys Lys Tyr Thr Val Thr Leu Ser Cys Arg Val Phe Met
180 185 190
Ser Ile Asp Asp Glu Glu Gln Val Thr Arg Leu Gly Ser Ser Ile Gln
195 200 205
Asn Ile Glu Ala Gly Leu Leu Ala Val Pro Ile Asn Ile Pro Gly Thr
210 215 220
Ala Met Asn Arg Ala Ile Lys Thr Val Lys Leu Leu Thr Arg Glu Val
225 230 235 240
Glu Ala Val Ile Lys Gln Arg Lys Val Asp Leu Leu Glu Asn Lys Gln
245 250 255
Ala Ser Gln Pro Gln Asp Leu Leu Ser His Leu Leu Leu Thr Ala Asn
260 265 270
Gln Asp Gly Gln Phe Leu Ser Glu Ser Asp Ile Ala Ser His Leu Ile
275 280 285
Gly Leu Met Gln Gly Gly Tyr Thr Thr Leu Asn Gly Thr Ile Thr Phe
290 295 300
Val Leu Asn Tyr Leu Ala Glu Phe Pro Asp Val Tyr Asn Gln Val Leu
305 310 315 320
Ala Glu Gln Val Glu Ile Ala Asn Ser Lys His Pro Lys Glu Leu Leu
325 330 335
Asn Trp Glu Asp Leu Arg Lys Met Lys Tyr Ser Trp Asn Val Ala Gln
340 345 350
Glu Val Leu Arg Ile Ile Pro Pro Gly Val Gly Thr Phe Arg Glu Ala
355 360 365
Ile Thr Asp Phe Thr Tyr Ala Gly Tyr Leu Ile Pro Lys Gly Trp Lys
370 375 380
Met His Leu Ile Pro His Asp Thr His Lys Asn Pro Thr Tyr Phe Pro
385 390 395 400
Ser Pro Glu Lys Phe Asp Pro Thr Arg Phe Glu Gly Asn Gly Pro Ala
405 410 415
Pro Tyr Thr Phe Thr Pro Phe Gly Gly Gly Pro Arg Met Cys Pro Gly
420 425 430
Ile Glu Tyr Ala Arg Leu Val Ile Leu Ile Phe Met His Asn Val Val
435 440 445
Thr Asn Phe Arg Trp Glu Lys Leu Ile Pro Asn Glu Lys Ile Leu Thr
450 455 460
Asp Pro Ile Pro Arg Phe Ala His Gly Leu Pro Ile His Leu His Pro
465 470 475 480
His Asn
<210>4
<211>482
<212>PRT
<213> Artificial sequence ()
<400>4
Met Val Leu Phe Phe Ser Leu Ser Leu Leu Leu Leu Pro Leu Leu Leu
15 10 15
Leu Phe Ala Tyr Phe Ser Tyr Thr Lys Arg Ile Pro Gln Lys Glu Asn
20 25 30
Asp Ser Lys Ala Pro Leu Pro Pro Gly Gln Thr Gly Trp Pro Leu Ile
35 40 45
Gly Glu Thr Leu Asn Tyr Leu Ser Cys Val Lys Ser Gly Val Ser Glu
50 55 60
Asn Phe Val Lys Tyr Arg Lys Glu Lys Tyr Ser Pro Lys Val Phe Arg
65 70 75 80
Thr Ser Leu Leu Gly Glu Pro Met Ala Ile Leu Cys Gly Pro Glu Gly
85 90 95
Asn Lys Phe Leu Tyr Ser Thr Glu Lys Lys Leu Val Gln Val Trp Phe
100 105 110
Pro Ser Ser Val Glu Lys Met Ala Pro Arg Ser His Gly Glu Ser Asn
115 120 125
Ala Asp Asn Phe Ser Lys Val Arg Gly Lys Met Met Phe Leu Leu Lys
130 135 140
Val Asp Gly Met Lys Lys Tyr Val Gly Leu Met Asp Arg Val Met Lys
145 150 155 160
Gln Phe Leu Glu Thr Asp Trp Asn Arg Gln Gln Gln Ile Asn Val His
165170 175
Asn Thr Val Lys Lys Tyr Thr Val Thr Leu Ser Cys Arg Val Phe Met
180 185 190
Ser Ile Asp Asp Glu Glu Gln Val Thr Arg Leu Gly Ser Ser Ile Gln
195 200 205
Asn Ile Glu Ala Gly Leu Leu Ala Val Pro Ile Asn Ile Pro Gly Thr
210 215 220
Ala Met Asn Arg Ala Ile Lys Thr Val Lys Leu Leu Thr Arg Glu Val
225 230 235 240
Glu Ala Val Ile Lys Gln Arg Lys Val Asp Leu Leu Glu Asn Lys Gln
245 250 255
Ala Ser Gln Pro Gln Asp Leu Leu Ser His Leu Leu Leu Thr Ala Asn
260 265 270
Gln Asp Gly Gln Phe Leu Ala Glu Ser Asp Ile Ala Ser His Leu Ile
275 280 285
Gly Leu Met Gln Gly Gly Tyr Thr Thr Leu Asn Gly Thr Ile Thr Phe
290 295 300
Val Leu Asn Tyr Leu Ala Glu Phe Pro Asp Val Tyr Asn Gln Val Leu
305 310 315 320
Lys Glu Gln Val Glu Ile Ala Asn Ser Lys His Pro Lys Glu Leu Leu
325330 335
Asn Trp Glu Asp Leu Arg Lys Met Lys Tyr Ser Trp Asn Val Ala Gln
340 345 350
Glu Val Leu Arg Ile Ile Pro Pro Gly Val Gly Thr Phe Arg Glu Ala
355 360 365
Ile Thr Asp Phe Thr Tyr Ala Gly Tyr Leu Ile Pro Lys Gly Trp Lys
370 375 380
Met His Leu Ile Pro His Asp Thr His Lys Asn Pro Thr Tyr Phe Pro
385 390 395 400
Ser Pro Glu Lys Phe Asp Pro Thr Arg Phe Glu Gly Asn Gly Pro Ala
405 410 415
Pro Tyr Thr Phe Thr Pro Phe Gly Gly Gly Pro Arg Met Cys Pro Gly
420 425 430
Ile Glu Tyr Ala Arg Leu Val Ile Leu Ile Phe Met His Asn Val Val
435 440 445
Thr Asn Phe Arg Trp Glu Lys Leu Ile Pro Asn Glu Lys Ile Leu Thr
450 455 460
Asp Pro Ile Pro Arg Phe Ala His Gly Leu Pro Ile His Leu His Pro
465 470 475 480
His Asn
<210>5
<211>712
<212>PRT
<213>Arabidopsis thaliana
<400>5
Met Ser Ser Ser Ser Ser Ser Ser Thr Ser Met Ile Asp Leu Met Ala
1 5 10 15
Ala Ile Ile Lys Gly Glu Pro Val Ile Val Ser Asp Pro Ala Asn Ala
20 25 30
Ser Ala Tyr Glu Ser Val Ala Ala Glu Leu Ser Ser Met Leu Ile Glu
35 40 45
Asn Arg Gln Phe Ala Met Ile Val Thr Thr Ser Ile Ala Val Leu Ile
50 55 60
Gly Cys Ile Val Met Leu Val Trp Arg Arg Ser Gly Ser Gly Asn Ser
65 70 75 80
Lys Arg Val Glu Pro Leu Lys Pro Leu Val Ile Lys Pro Arg Glu Glu
85 90 95
Glu Ile Asp Asp Gly Arg Lys Lys Val Thr Ile Phe Phe Gly Thr Gln
100 105 110
Thr Gly Thr Ala Glu Gly Phe Ala Lys Ala Leu Gly Glu Glu Ala Lys
115 120 125
Ala Arg Tyr Glu Lys Thr Arg Phe Lys Ile Val Asp Leu Asp Asp Tyr
130 135 140
Ala Ala Asp AspAsp Glu Tyr Glu Glu Lys Leu Lys Lys Glu Asp Val
145 150 155 160
Ala Phe Phe Phe Leu Ala Thr Tyr Gly Asp Gly Glu Pro Thr Asp Asn
165 170 175
Ala Ala Arg Phe Tyr Lys Trp Phe Thr Glu Gly Asn Asp Arg Gly Glu
180 185 190
Trp Leu Lys Asn Leu Lys Tyr Gly Val Phe Gly Leu Gly Asn Arg Gln
195 200 205
Tyr Glu His Phe Asn Lys Val Ala Lys Val Val Asp Asp Ile Leu Val
210 215 220
Glu Gln Gly Ala Gln Arg Leu Val Gln Val Gly Leu Gly Asp Asp Asp
225 230 235 240
Gln Cys Ile Glu Asp Asp Phe Thr Ala Trp Arg Glu Ala Leu Trp Pro
245 250 255
Glu Leu Asp Thr Ile Leu Arg Glu Glu Gly Asp Thr Ala Val Ala Thr
260 265 270
Pro Tyr Thr Ala Ala Val Leu Glu Tyr Arg Val Ser Ile His Asp Ser
275 280 285
Glu Asp Ala Lys Phe Asn Asp Ile Asn Met Ala Asn Gly Asn Gly Tyr
290 295 300
Thr Val Phe Asp Ala GlnHis Pro Tyr Lys Ala Asn Val Ala Val Lys
305 310 315 320
Arg Glu Leu His Thr Pro Glu Ser Asp Arg Ser Cys Ile His Leu Glu
325 330 335
Phe Asp Ile Ala Gly Ser Gly Leu Thr Tyr Glu Thr Gly Asp His Val
340 345 350
Gly Val Leu Cys Asp Asn Leu Ser Glu Thr Val Asp Glu Ala Leu Arg
355 360 365
Leu Leu Asp Met Ser Pro Asp Thr Tyr Phe Ser Leu His Ala Glu Lys
370 375 380
Glu Asp Gly Thr Pro Ile Ser Ser Ser Leu Pro Pro Pro Phe Pro Pro
385 390 395 400
Cys Asn Leu Arg Thr Ala Leu Thr Arg Tyr Ala Cys Leu Leu Ser Ser
405 410 415
Pro Lys Lys Ser Ala Leu Val Ala Leu Ala Ala His Ala Ser Asp Pro
420 425 430
Thr Glu Ala Glu Arg Leu Lys His Leu Ala Ser Pro Ala Gly Lys Val
435 440 445
Asp Glu Tyr Ser Lys Trp Val Val Glu Ser Gln Arg Ser Leu Leu Glu
450 455 460
Val Met Ala Glu Phe Pro Ser AlaLys Pro Pro Leu Gly Val Phe Phe
465 470 475 480
Ala Gly Val Ala Pro Arg Leu Gln Pro Arg Phe Tyr Ser Ile Ser Ser
485 490 495
Ser Pro Lys Ile Ala Glu Thr Arg Ile His Val Thr Cys Ala Leu Val
500 505 510
Tyr Glu Lys Met Pro Thr Gly Arg Ile His Lys Gly Val Cys Ser Thr
515 520 525
Trp Met Lys Asn Ala Val Pro Tyr Glu Lys Ser Glu Asn Cys Ser Ser
530 535 540
Ala Pro Ile Phe Val Arg Gln Ser Asn Phe Lys Leu Pro Ser Asp Ser
545 550 555 560
Lys Val Pro Ile Ile Met Ile Gly Pro Gly Thr Gly Leu Ala Pro Phe
565 570 575
Arg Gly Phe Leu Gln Glu Arg Leu Ala Leu Val Glu Ser Gly Val Glu
580 585 590
Leu Gly Pro Ser Val Leu Phe Phe Gly Cys Arg Asn Arg Arg Met Asp
595 600 605
Phe Ile Tyr Glu Glu Glu Leu Gln Arg Phe Val Glu Ser Gly Ala Leu
610 615 620
Ala Glu Leu Ser Val Ala Phe Ser Arg GluGly Pro Thr Lys Glu Tyr
625 630 635 640
Val Gln His Lys Met Met Asp Lys Ala Ser Asp Ile Trp Asn Met Ile
645 650 655
Ser Gln Gly Ala Tyr Leu Tyr Val Cys Gly Asp Ala Lys Gly Met Ala
660 665 670
Arg Asp Val His Arg Ser Leu His Thr Ile Ala Gln Glu Gln Gly Ser
675 680 685
Met Asp Ser Thr Lys Ala Glu Gly Phe Val Lys Asn Leu Gln Thr Ser
690 695 700
Gly Arg Tyr Leu Arg Asp Val Trp
705 710
<210>6
<211>2139
<212>DNA
<213>Arabidopsis thaliana
<400>6
atgtcttctt cttcatcatc ttcaacttct atgattgact tgatggcagc aattattaag 60
ggagaaccag tcattgtctc tgatccagct aacgcttctg catatgagtc tgtcgcagct 120
gagttgtctt ctatgttaat tgaaaataga cagtttgcta tgattgttac tacatcaatt 180
gcagtcttga ttggttgtat tgttatgttg gtttggagga ggtctggatc tggtaattca 240
aagagagttg aacctttaaa acctttagtt attaaaccaa gagaagaaga aattgacgat 300
ggtcgtaaaa aagttactat cttttttgga actcagactg gtactgctga gggtttcgct 360
aaagctttgg gtgaggaggc taaggctaga tatgaaaaaa ctagattcaa gattgttgat 420
ttggatgatt acgctgcaga cgacgacgaa tacgaggaaa aattgaaaaa agaagatgtc 480
gctttcttct ttttagctac atatggtgac ggtgaaccaa cagacaatgc tgcaagattt 540
tacaagtggt tcacagaagg aaatgatcgt ggtgagtggt tgaaaaattt gaaatatggt 600
gtttttggtt tgggaaacag acaatacgag catttcaata aagttgcaaa agtcgttgat 660
gatattttag tcgaacaagg tgctcagaga ttggtccaag tcggtttggg tgacgatgat 720
caatgtatag aggatgactt cacagcttgg agggaggctt tgtggccaga attggatact 780
attttgagag aggaaggtga tacagctgtc gctacaccat acactgctgc agtcttggag 840
tacagagttt caattcatga ttctgaagat gcaaaattta acgatattaa catggctaat 900
ggtaatggtt atactgtttt cgatgctcaa catccataca aggcaaacgt cgcagtcaag 960
agggagttgc acacaccaga atcagataga tcatgcattc atttagagtt tgacatagct 1020
ggttctggtt tgacatacga aactggtgac cacgttggtg tcttgtgcga caacttgtca 1080
gagacagtcg atgaagcttt gagattatta gacatgtctc cagacactta tttctctttg 1140
catgctgaga aagaagatgg tactccaatt tcatcttcat tgcctcctcc attcccacct 1200
tgcaacttaa gaactgcttt gactagatac gcttgtttgt tgtcttctcc taagaaatct 1260
gctttggtcg ctttggctgc acatgcttct gatccaacag aggcagagag gttaaagcac 1320
ttggcatcac cagctggaaa ggttgatgag tactctaagt gggtcgtcga gtcacagcgt 1380
tctttgttag aagttatggc agagttccct tcagctaagc caccattggg tgtcttcttc 1440
gctggagttg caccaaggtt gcaaccaaga ttttattcta tttcttcttc tccaaagatt 1500
gcagaaacta ggattcatgt tacttgtgct ttggtttacg aaaaaatgcc aactggtcgt 1560
attcataaag gtgtctgttc tacatggatg aagaacgctg ttccttatga aaaatctgaa 1620
aactgttcat cagctcctat attcgtcaga caatctaact tcaagttacc ttcagattca 1680
aaggttccaa ttattatgat tggtcccggt actggattgg caccttttcg tggtttcttg 1740
caagaaaggt tggctttggt tgagtctggt gtcgaattgg gaccatcagt cttgtttttc 1800
ggttgtagga acagaagaat ggatttcatt tatgaggagg aattgcaaag gtttgttgag 1860
tctggtgctt tggcagagtt gtctgtcgct ttctctaggg agggtcctac aaaggaatac 1920
gttcaacata aaatgatgga taaagcatct gatatatgga atatgatttc acaaggagct 1980
tatttgtatg tctgcggtga tgcaaagggt atggctaggg acgtccatcg ttctttacat 2040
actattgctc aagaacaagg ttctatggat tcaacaaagg ctgaaggatt tgttaagaac 2100
ttgcaaactt ctggaagata tttgagagat gtctggtag 2139
Claims (10)
1. A hydroxylase having the amino acid sequence:
3, which is a mutant of SEQ ID NO. 1 in which M at position 186 is replaced by L and K at position 321 is replaced by A; or
4, which is a mutant of SEQ ID NO. 1 in which F at position 120 is replaced by A, M at position 186 is replaced by L, and S at position 279 is replaced by A.
2. A gene encoding the hydroxylase of claim 1.
3. A plasmid comprising the gene of claim 2.
4. The plasmid of claim 3 further comprising the gene SEQ ID NO 6 encoding P450 reductase for co-expression of hydroxylase and P450 reductase SEQ ID NO 5.
5. A microorganism transformed with the plasmid of claim 3 and co-transformed with a plasmid for expression of P450 reductase SEQ ID NO 5.
6. A microorganism transformed with the plasmid of claim 4.
7. The microorganism of claim 5 or 6, selected from Saccharomyces cerevisiae or yarrowia lipolytica.
8. The microorganism according to claim 7, which is Saccharomyces cerevisiae BY 4742.
9. Use of a hydroxylase according to claim 1 or a microorganism according to claim 5 or 6 for the synthesis of protopanaxadiol.
10. The use according to claim 9, wherein the protopanaxadiol is prepared by hydroxylation reaction of dammarenediol as a substrate material under the catalysis of hydroxylase and P450 reductase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811396041.1A CN109468287B (en) | 2018-11-22 | 2018-11-22 | Hydroxylase mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811396041.1A CN109468287B (en) | 2018-11-22 | 2018-11-22 | Hydroxylase mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109468287A CN109468287A (en) | 2019-03-15 |
| CN109468287B true CN109468287B (en) | 2020-10-16 |
Family
ID=65672984
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811396041.1A Active CN109468287B (en) | 2018-11-22 | 2018-11-22 | Hydroxylase mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109468287B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357418A (en) * | 2014-10-11 | 2015-02-18 | 上海交通大学 | Applications of glycosyltransferase and mutants thereof to synthesis of ginsenoside Rh2 |
| CN105802925A (en) * | 2016-03-24 | 2016-07-27 | 西南医科大学 | CYP119 enzyme mutant and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058446B (en) * | 2012-12-06 | 2021-10-22 | 中国科学院分子植物科学卓越创新中心 | Group of glycosyltransferases and application thereof |
| CN104450633B (en) * | 2014-12-04 | 2017-08-04 | 天津大学 | Fused protein and construction method and the application of dammarendiol transformation efficiency can be improved |
| CN108330111B (en) * | 2017-01-20 | 2023-01-31 | 生合万物(苏州)生物科技有限公司 | Cytochrome P450 mutant protein and application thereof |
| KR101957910B1 (en) * | 2017-05-02 | 2019-03-15 | 재단법인 지능형 바이오 시스템 설계 및 합성 연구단 | Increased production of ginsenosides through yeast cell organelle improvement |
-
2018
- 2018-11-22 CN CN201811396041.1A patent/CN109468287B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104357418A (en) * | 2014-10-11 | 2015-02-18 | 上海交通大学 | Applications of glycosyltransferase and mutants thereof to synthesis of ginsenoside Rh2 |
| CN105802925A (en) * | 2016-03-24 | 2016-07-27 | 西南医科大学 | CYP119 enzyme mutant and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109468287A (en) | 2019-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11091787B2 (en) | Methods and materials for biosynthesis of mogroside compounds | |
| CN107058446B (en) | Group of glycosyltransferases and application thereof | |
| CN110551701B (en) | Carbonyl reductase mutant and application thereof in reduction of cyclopentadione compounds | |
| CN112877307B (en) | Amino acid dehydrogenase mutant and application thereof | |
| CN113748204A (en) | Method for biosynthesizing diosmetin and/or hesperetin in microorganisms | |
| KR20090096511A (en) | Method for the production of secol derivatives by enantioselective enzymatic reduction of secodione derivatives by means of oxidoreductase/dehydrogenase in the presence of nadh or nadph | |
| CN109796516B (en) | A method for synthesizing natural and unnatural protopanaxatriol type ginsenoside | |
| CN111088254B (en) | Endogenous carried exogenous gene efficient controllable expression system | |
| CN111484961B (en) | Genetically engineered bacterium for producing 5 alpha-androstanedione and application thereof | |
| CN114480512B (en) | Application of oxidoreductase and mutant thereof in biosynthesis of nootkatone | |
| JP2022524214A (en) | UDP-Rhamnose Biosynthetic Production | |
| CN109468287B (en) | Hydroxylase mutant | |
| JP4668176B2 (en) | Triterpene hydroxylase | |
| CN109295027B (en) | Glycosyltransferase mutant | |
| WO2020165178A1 (en) | Method for biosynthesising eriodictyol and/or luteolin in a yeast | |
| WO2023006109A1 (en) | Highly specific glycosyltransferase for rhamnose, and use thereof | |
| WO2022241298A2 (en) | Engineered cells, enzymes, and methods for producing cannabinoids | |
| CN112410353B (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
| JP6107130B2 (en) | Novel steroid 11β-hydroxylase and method for producing 11β-hydroxysteroid using the same | |
| CN112322592B (en) | CYP76B100 protein involved in alkannin biosynthesis, coding gene thereof and application thereof | |
| CN114250219B (en) | Balsamiferol synthase mutant and application thereof | |
| WO2015111155A1 (en) | NOVEL STEROID 11β-HYDROXYLASE AND METHOD FOR PRODUCING 11β-HYDROXYSTEROID USING SAME | |
| CN113444703B (en) | Glycosyltransferase mutant for catalyzing sugar chain extension and application thereof | |
| JP2011024534A (en) | 22 position hydroxylase | |
| KR101716962B1 (en) | Novel cyclosporin specific hybrid hydroxylase constructed by domain swapping |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |