CN102952870A - Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene - Google Patents

Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene Download PDF

Info

Publication number
CN102952870A
CN102952870A CN2011102515776A CN201110251577A CN102952870A CN 102952870 A CN102952870 A CN 102952870A CN 2011102515776 A CN2011102515776 A CN 2011102515776A CN 201110251577 A CN201110251577 A CN 201110251577A CN 102952870 A CN102952870 A CN 102952870A
Authority
CN
China
Prior art keywords
seq
site
sequence
comprised
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2011102515776A
Other languages
Chinese (zh)
Other versions
CN102952870B (en
Inventor
许嘉森
郭靖
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Surexam Bio Tech Co Ltd
Original Assignee
Guangzhou Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Surexam Bio Tech Co Ltd filed Critical Guangzhou Surexam Bio Tech Co Ltd
Priority to CN201110251577.6A priority Critical patent/CN102952870B/en
Publication of CN102952870A publication Critical patent/CN102952870A/en
Application granted granted Critical
Publication of CN102952870B publication Critical patent/CN102952870B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a specific primer and liquid chip for detecting an SLC22A2 gene. The liquid chip mainly comprises ASPE (allele specific primer extension) primers, microspheres and amplification primers, wherein each ASPE primer is formed by tag sequences and specific primer sequences aiming at the mutation site; the specific primer sequences are SEQ ID NO.11 and SEQ ID NO.12 aiming at the G120C site, SEQ ID NO.13 and SEQ ID NO.14 aiming at the C122T site, SEQ ID NO.15 and SEQ ID NO.16 aiming at the A104C site, SEQ ID NO.17 and SEQ ID NO.18 aiming at the C133G site and/or SEQ ID NO.19 and SEQ ID NO.20 aiming at the C208T site; and the microspheres are enveloped by anti-tag sequences. The detecting liquid chip provided by the invention has the advantages that the consistency of the detection result and the sequencing method is as high as 100%, thus parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.

Description

A kind of SLC22A2 gene pleiomorphism detection specificity primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of SLC22A2 gene pleiomorphism detection specificity primer and the liquid-phase chip of relating to.
Background technology
Human Organic cation transporter 2 (OCT2, SLC22A2) is a kind of organic cations polyspecific transporter, is positioned karyomit(e) 6q26, comprises 11 exons.SLC22A2 mainly is distributed in the epithelial outside of kidney duct basilar membrane, is main transporter of kidney active secretion organic cations, and is relevant with drug metabolism.Expression regulation for SLC22A2 in the human body mainly is the steroid hormone regulation and control at transcriptional level, and is then main relevant with the multiple protein kinases at protein level.Studies show that, the change of the polymorphism of human SLC22A2 and SLC22A2 function is closely related.
At present, the method that the SLC22A2 gene pleiomorphism is carried out determination and analysis seldom, it mainly is the PCR-RFLP analytical method, the PCR-RFLP method is based on the change of the restriction enzyme enzyme recognition site that transgenation causes, as losing or produce novel site in the site, by a certain specific fragment of pcr amplification, use again the digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be used for not producing the detection in Gene Mutation of new restriction enzyme site.Again, the PCR-RFLP analytical method exists the limitation that detects flux, can only detect a kind of mutation type at every turn, can not satisfy the needs of practical application.
The SLC22A2 gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of SLC22A2 site mutation Write a Chinese character in simplified form
1 G → C sudden change occurs in the 120th Nucleotide of SEQ ID NO.49 G120C
2 C → T sudden change occurs in the 122nd Nucleotide of SEQ ID NO.50 C122T
3 A → C sudden change occurs in the 104th Nucleotide of SEQ ID NO.51 A104C
4 C → G sudden change occurs in the 133rd Nucleotide of SEQ ID NO.52 C133G
5 C → T sudden change occurs in the 208th Nucleotide of SEQ ID NO.53 C208T
SEQ ID NO.49GGCGGAGATATCGGAGAACAGTGGGGATTTTTTACCAAGTTGCCTATACAGTTGGGCTCCTGGTGCTAGCTGGGGTGGCTTACGCACTTCCTCACTGGAGGTGGTTGCAGTTCACAGTTGCTCTGCCCAACTTCTTCTTCTTGCTCTATTACTGGTAAGTCCATTTGGAATAAAAAGGAAATAAATCAAAGTATTTTATTCTGCTAAGAAGTCTGCCTTCCTTAATGCACACTATCTTTCTGATTCTGAGATTGCTTTCACTCTCCAGACCCATTTCACAAAGAGCC
SEQ ID NO.50TGTGCTCTACCAGGGCCTCATCATGCACATGGGYCTTGCAGGTGACAATATCTACCTGGATTTCTTCTACTCTGCCCTGGTTGAATTCCCAGCTGCCTTCATGATCATCCTCACCATCGACCGCATYGGACGCCGTTACCCTTGGGCTGCATCAAATATGGTTGCAGGGGCAGCCTGTCTGGCCTCAGTTTTTATACCTGGTGGTAAGTTTCAGGTGAAGTTGGAGTCTTATCTCCAAGACCCTGGAGAAAGGGAGTGTCACGGCCCATTGATAGGAAAACCATGTAATTTGTCATCCAAATCAATTTGGAAAGACAAATTGGAGGGCAGTATCTGGGACC
SEQ ID NO.51GAATTTGTCCTTACAGTCCCACTCTGGAGCACTGTCTGAAGATGAGGAATCATCYGTGTACGGATAAGTACTGTTCTTTTCCCTCTTAGATCTACAATGGCTAAAAATTATTATCTCATGCTTGGGAAGAATGGGGATCACAATGGCCTATGAGATAGTCTGCCTGGTCAATGCTGAGCTGTACCCCACATTCATTARGTGAGTGCMTTTTCCTTAGAATGACGAGGGTGGGTGAGACATTTGTTCATTGGCTGGAACCACCACAAGTGCAGACAAA
SEQ ID NO.52GTGGTCTGTGTGCTTGGGAAAGGATGGGATTCAAGCAGGGGCAGGTGCATCCAAGTGTTCTCCAAACCTTTGGGATTSTTTAAATTCCACCACAGGTGATTCAACCTACCTGTCTGCTATGTAGCCGATACTCATAGAGCCAATAARGAATCCTACATTCACTGATGACTGGAATAGGTCCAACATCCAGGAGTTGGCACATACCAGGTTAAACTGCCAGCAGGGGAGAAGTGTTCCAAGTTGGGAGAGAAAGGAAATGAA
SEQ ID NO.53TCGCTCCGGGCACGTCGGGCAGCCTCGGGCCCTCCTGCCTGCAGGATCATGCCCACCACCGTGGACGATGTCCTGGAGCATGGAGGGGAGTTTCACTTTTTCCAGAAGCAAATGTTTTTCCTCTTGGCTCTGCTCTCGGCTACCTTCGCGCCCATCTACGTGGGCATCGTCTTCCTGGGCTTCACCCCTGACCACCGCTGCCGGAGCCCCGGAGTGGCCGAGCTGAGTCTGCGCTGCGGCTGGAGTCCTGCAGAGGAACTGAACTACACGGTGCCGGGCCCAGGACCTGCGGGCGAAGCCTCCCCAAGACAGTGTAGGCGCTACGAGGTGGACTGGAAC
Summary of the invention
One of purpose of the present invention provides the SLC22A2 gene pleiomorphism and detects liquid-phase chip, and this liquid-phase chip can be used for wild-type and the mutant of individual event or parallel detection SLC22A2 gene five kinds of common genotype G120C, C122T, A104C, C133G and C208T.
The technical scheme that realizes above-mentioned purpose is as follows:
A kind of SLC22A2 gene pleiomorphism detects liquid-phase chip, includes:
(A). the wild-type that designs respectively for the different pleomorphism sites of SLC22A2 gene and the ASPE primer of mutant: every kind of ASPE primer is comprised of the tag sequence of 5 ' end and 3 ' the end specific primer sequence for the goal gene pleomorphism site, and described specific primer sequence is: for SEQ IDNO.11 and the SEQ IDNO.12 in G120C site; SEQ ID NO.13 and SEQ ID NO.14 for the C122T site; SEQ ID NO.15 and SEQ ID NO.16 for the A104C site; SEQ ID NO.17 and SEQ ID NO.18 for the C133G site; And/or for SEQ ID NO.19 and the SEQ ID NO.20 in C208T site; Described tag sequence is selected from SEQ ID NO.1~SEQ ID NO10;
(B). anti-tag sequence microballoon coated, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.21~SEQ ID NO.30, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). be used for amplifying the primer that needs target sequence detection, that have corresponding pleomorphism site.
Preferably, described amplimer is: for SEQ ID NO.31 and the SEQ ID NO.32 in G120C site; SEQ ID NO.33 and SEQ ID NO.34 for the C122T site; SEQ ID NO.35 and SEQ ID NO.36 for the A104C site; SEQ ID NO.37 and SEQ ID NO.38 for the C133G site; And/or for SEQ ID NO.39 and the SEQID NO.40 in C208T site.
Preferably, described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.11 for the G120C site reaches the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.12; The sequence that is comprised of SEQ ID NO.3 and SEQ IDNO.13 for the C122T site reaches the sequence that is comprised of SEQ ID NO.4 and SEQ ID NO.14; The sequence that is comprised of SEQID NO.5 and SEQ ID NO.15 for the A104C site reaches the sequence that is comprised of SEQ ID NO.6 and SEQ ID NO.16; The sequence that is comprised of SEQ ID NO.7 and SEQ ID NO.17 for the C133G site reaches the sequence that is comprised of SEQ ID NO.8 and SEQ ID NO.18; And/or for the sequence that is formed by SEQ ID NO.9 and SEQ ID NO.19 in C208T site and the sequence that is formed by SEQ IDNO.10 and SEQ ID NO.20.
Another object of the present invention provides the Auele Specific Primer that detects for the SLC22A2 gene pleiomorphism.
The technical scheme that realizes above-mentioned purpose is as follows:
Be used for the Auele Specific Primer that the SLC22A2 gene pleiomorphism detects, described specific primer sequence is: for SEQ ID NO.11 and the SEQ ID NO.12 in G120C site; SEQ ID NO.13 and SEQ ID NO.14 for the C122T site; SEQ ID NO.15 and SEQ ID NO.16 for the A104C site; SEQ ID NO.17 and SEQ ID NO.18 for the C133G site; And/or for SEQ ID NO.19 and the SEQ ID NO.20 in C208T site.
Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below sequencing technologies commonly used, and realistic especially application needs.。Prepared SLC22A2 gene pleiomorphism detects liquid-phase chip and has extraordinary signal-noise ratio, and basically there is not cross reaction between designed probe and the anti-tag sequence, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection of a plurality of pleomorphism sites.
2. the present invention has chosen optimum combination by the design experiences of contriver's long-term accumulation and a large amount of experimental implementation from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention's design can sensitive be identified the mutational site of target detect specifically, accurately distinguishes the genotype of various types; In same reaction system, between the different Auele Specific Primers, basically do not have cross reaction between the pcr amplification product of Auele Specific Primer and non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the polymorphism situation in a plurality of mutational sites of simultaneously parallel detection detects effect consistent.
3. detection method step of the present invention is simple, five kinds of pleomorphism sites detect and can finish five amplifications that contain the target sequence of pleomorphism site by a step multiplex PCR, many uncertain factors of existing in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the defective that the repeatability of detected result is poor is improved existing liquid-phase chip technology simultaneously, so that prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value that detects improves greatly, thereby so that the sensitivity that detects is further enhanced, signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1
The described SLC22A2 gene pleiomorphism of the present embodiment detects liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and mutant for SLC22A2 gene five kinds of common genotype G120C, C122T, A104C, C133G and C208T design respectively specific primer sequence.The ASPE primer is comprised of " tag sequence+specific primer sequence ".The ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1SLC22A2 gene
Figure BDA0000087132470000051
Every the ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on the corresponding microballoon, and 3 ' end is mutant or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select the tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, corresponding anti-tag sequence is as shown in table 2 on 10 kinds of microballoons numberings of selection and the microballoon:
Corresponding anti-tag sequence on table 2 microballoon numbering and the microballoon
Figure BDA0000087132470000061
10 kinds of microballoons selecting are coated in the anti-tag sequence on the microballoon available from U.S. Luminex company.Be connected with the spacerarm sequence of 5-10 T between anti-tag sequence and the microballoon, namely add the spacerarm sequence of the preceding paragraph 5-10 T before each anti-tag sequence, the anti-tag sequence is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.With synthetic anti-tag sequence sterilization ddH 2O is made into the stock solution of 100nmol/ml.Described spacerarm is for being used for anti-tag and microsphere surface is spaced apart or anti-tag is placed the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficient of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n 〉=3) are such as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the process that microballoon is coated with is as follows:
Get respectively 5 * 10 6The carboxylated microballoon of individual above-mentioned numbering (available from Luminex company) is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (available from the Pierce Chemical company) working fluid of preparation 10ng/ml.The EDC working fluid that adds 2.5ul in the microballoon suspension, constant-temperature incubation 30 minutes adds the EDC working fluid of 2.5ul again, and constant-temperature incubation is 30 minutes again.After reaction finished, the Tween-20 washing with 0.02% was once washed once with 0.1% SDS liquid again.The microballoon that is coated with the anti-tag sequence after the washing is resuspended in the Tris-EDTA solution [10mmol/L Tris (pH8.0)] of 100ul, among the 1mmol/LEDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains the mutational site
For SLC22A2 gene five kinds of common genotype G120C, C122T, A104C, C133G and C208T, design of amplification primers amplifies respectively five target sequences that contain pleomorphism site to (seeing Table 3).
Table 3 amplifies the primer of the target sequence with pleomorphism site
Figure BDA0000087132470000071
All primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses embodiment 1 described SLC22A2 gene pleiomorphism to detect liquid-phase chip to the detection of sample
The prescription of described various solution is as follows:
MES damping fluid (pH5.0) prescription (250ml) of 50mM:
Figure BDA0000087132470000072
2 * Tm hybridization buffer
Reagent The source Final concentration The consumption of every 250ml
1MTris-HCl,pH8.0 SigmaT3038 0.2M 50ml
5MNaCl Sigma S5150 0.4M 20ml
Triton X-100 Sigma T8787 0.16% 0.4ml
Be stored in 4 ℃ after the filtration.
The ExoSAP-IT test kit is available from U.S. USB company.
Biotin labeled dCTP is available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
With reference to " molecular cloning " methods involving about DNA extraction, obtain DNA to be detected.
Two, the pcr amplification of testing sample
Design five pairs of primers, one step of multiplex PCR amplifies the amplified production that contains respectively SLC22A2 gene five kinds of common genotype G120C, C122T, A104C, C133G and C208T, the product size is respectively 287bp, 341bp, 277bp, 261bp and 339bp, and primer sequence (SEQ ID NO.31-40) is seen shown in the above-mentioned table 3.
At first prepare the multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.31-40 in the 1.5ml Eppendorf tube, mix and be the multiple PCR primer working fluid.The multi-PRC reaction system is as follows:
Figure BDA0000087132470000081
The pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
2.37 ℃ hatch 15min, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after the processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on the reacted product band.
At first prepare the ASPE primer working fluid that mixes: get respectively the corresponding wild-type of gene to be detected and mutant ASPE primer stock solution 10ul in the 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer and mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Figure BDA0000087132470000091
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
According to the design the ASPE primer, the corresponding 10 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 * 10 5Individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in 〉=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, the vortex mixing;
5. get the above-mentioned microballoon suspension of 25ul in the corresponding hole of 96 hole filter plates, control wells adds the ddH of 25ul 2O;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2O complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after the hybridization is in 〉=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in 〉=centrifugal the 2-5min of 3000g;
11. microballoon is resuspended in 1 * Tm hybridization buffer of 75ul, adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
12.37 ℃ hatch 15min, on the Luminex instrument, detect.
Six, the result detects and data analysis
The reaction after product detects by Luminex serial analysis instrument.Detected result is shown in table 4, table 5 and table 6.Fluorescent value (MFI) and data processing there are following requirement:
1. each site need have an allelotrope MFI at least greater than 300 and greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI less than 0 with 0 the expression);
3. satisfy the data of above two conditions, calculate sudden change ratio by following formula:
Sudden change ratio=mutant NET MFI ÷ (mutant NETMFI+ wild-type NET MFI)
4. rule of thumb to the sudden change ratio definite threshold (cut-off value) of each detection site, to divide wild-type homozygote, heterozygote and mutant homozygote.
Use present method to detect 20 increments SLC22A2 gene polymorphism sites originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: the sudden change ratio range is considered as the wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as the anomaly homozygote.Compare with the liquid-phase chip result with the sequencing detection, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments SLC22A2 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.As seen SLC22A2 gene pleiomorphism provided by the present invention detects liquid-phase chip and can detect exactly SLC22A2 gene polymorphism sites type, and the result is reliable and stable.
One of table 4 pattern detection result (MFI)
Figure BDA0000087132470000101
Figure BDA0000087132470000111
Table 5 sample SLC22A2 transgenation ratio (%)
Sample number G120C C122T A104C C133G C208T
1 2% 2% 1% 2% 1%
2 1% 1% 1% 2% 2%
3 99% 2% 2% 2% 3%
4 2% 2% 2% 2% 1%
5 3% 2% 2% 3% 2%
6 1% 1% 2% 2% 2%
7 2% 98% 1% 3% 98%
8 2% 2% 2% 2% 1%
9 2% 2% 48% 1% 1%
10 2% 2% 1% 2% 1%
11 2% 2% 1% 1% 98%
12 1% 2% 1% 98% 2%
13 2% 2% 2% 2% 2%
14 2% 1% 1% 2% 2%
15 2% 1% 2% 3% 1%
16 1% 1% 2% 2% 2%
17 2% 2% 2% 2% 2%
18 2% 2% 1% 1% 2%
19 2% 1% 2% 3% 2%
20 1% 2% 1% 2% 2%
Table 6 sample SLC22A2 gene mutation type analytical results
Catalogue number(Cat.No.) The liquid-phase chip detected result Sequencing result
1 Wild-type Wild-type
2 Wild-type Wild-type
3 120CC 120CC
4 Wild-type Wild-type
5 Wild-type Wild-type
6 Wild-type Wild-type
7 122TT、208TT 122TT、208TT
8 Wild-type Wild-type
9 104AC 104AC
10 Wild-type Wild-type
11 208TT 208TT
12 133GG 133GG
13 Wild-type Wild-type
14 Wild-type Wild-type
15 Wild-type Wild-type
16 Wild-type Wild-type
17 Wild-type Wild-type
18 Wild-type Wild-type
19 Wild-type Wild-type
20 Wild-type Wild-type
The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of SLC22A2 gene polymorphism sites
One, the design (selection of tag sequence and Anti-tag sequence) of liquid-phase chip preparation
Detect liquid-phase chip as example take SLC22A2 gene C 122T and C133G site mutation, respectively for the wild-type of C122T and C133G and the specific primer sequence of mutant design ASPE primer 3 ' end, the tag sequence of ASPE primer 5 ' end then is selected from SEQ ID NO.1-SEQ ID NO.10, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing that is coated on the microballoon is selected from SEQ ID NO.21-SEQ ID NO.30.Specific design is shown in following table (table 7).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.
The design of table 7 liquid-phase chip preparation
Figure BDA0000087132470000131
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 21-40 is detected, detected result is as follows:
Table 8 pattern detection result and Polymorphism Analysis
Figure BDA0000087132470000141
Table 9 pattern detection result and Polymorphism Analysis
Figure BDA0000087132470000142
Other is for the liquid-phase chip in different mutational sites, and the ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And the ASPE primer is when selecting among the embodiment 1 collocation of tag sequence and specific primer sequence, and effect better (signal to noise ratio is better) is referring to the present embodiment test group 2 and test group 5.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4SLC22A2 gene pleiomorphism detection specificity primer sequence
One, the design (selection of wild-type and mutant specific primer sequence) of liquid-phase chip preparation
Pleomorphism site take SLC22A2 gene G120C and A104C detects liquid-phase chip as example, take the forward or backwards complementary sequence of this place, mutational site target sequence as template, respectively for the wild-type of G120C and A104C and the specific primer sequence of mutant design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the invention 1, as shown in table 10.Wherein,
Figure BDA0000087132470000152
Interior base is pleomorphism site.
Table 10 specific primer sequence
Figure BDA0000087132470000153
Figure BDA0000087132470000161
Pleomorphism site take SLC22A2 gene G120C and A104C detects liquid-phase chip as example, select different specific primer sequences for G120C and A104C, the tag sequence of ASPE primer 5 ' end then is fixed as the best effect sequence among the embodiment 1, and select with it corresponding anti-tag sequence, specific design is shown in following table (table 11).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.
Two of the design of table 11 liquid-phase chip preparation
Figure BDA0000087132470000162
Figure BDA0000087132470000171
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 41-60 is detected, detected result is as follows:
Table 12 pattern detection result and Polymorphism Analysis
Figure BDA0000087132470000172
Figure BDA0000087132470000181
Table 13 pattern detection result and Polymorphism Analysis
By the present embodiment as seen, when the ASPE primer was selected among the embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better) was referring to the present embodiment test group 7 and test group 10.Other derives from different specific primer sequences and the collocation of tag sequence of the forward or backwards complementary sequence of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, namely still be that the specific primer sequence described in the embodiment 1 is better from different tag sequence arranging effects, concrete data are omitted.Other is for multiple specific primer sequence and the collocation of tag sequence in different mutational sites, with coming to the same thing of embodiment 2 and the present embodiment, namely embodiment 1 selected Auele Specific Primer has better signal to noise ratio, detect effect also better, concrete data are omitted.
More than be for the specifying of possible embodiments of the present invention, but this embodiment limits claim of the present invention, allly do not break away from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the claim of the present invention.
Figure IDA0000087132520000011
Figure IDA0000087132520000021
Figure IDA0000087132520000031
Figure IDA0000087132520000041
Figure IDA0000087132520000051
Figure IDA0000087132520000061
Figure IDA0000087132520000071
Figure IDA0000087132520000081
Figure IDA0000087132520000091
Figure IDA0000087132520000111

Claims (6)

1. a SLC22A2 gene pleiomorphism detects liquid-phase chip, it is characterized in that, includes:
(A). the wild-type that designs respectively for the different pleomorphism sites of SLC22A2 gene and the ASPE primer of mutant: every kind of ASPE primer is comprised of the tag sequence of 5 ' end and 3 ' the end specific primer sequence for the goal gene pleomorphism site, and described specific primer sequence is: for SEQ ID NO.11 and the SEQ ID NO.12 in G120C site; SEQ ID NO.13 and SEQ ID NO.14 for the C122T site; SEQ ID NO.15 and SEQ ID NO.16 for the A104C site; SEQ ID NO.17 and SEQ ID NO.18 for the C133G site; And/or for SEQ ID NO.19 and the SEQ ID NO.20 in C208T site; Described tag sequence is selected from SEQ ID NO.1~SEQ ID NO10;
(B). anti-tag sequence microballoon coated, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.21~SEQ ID NO.30, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). be used for amplifying the primer that needs target sequence detection, that have corresponding pleomorphism site.
2. SLC22A2 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described amplimer is: for SEQ ID NO.31 and the SEQ ID NO.32 in G120C site; SEQ ID NO.33 and SEQ ID NO.34 for the C122T site; SEQ ID NO.35 and SEQ ID NO.36 for the A104C site; SEQ ID NO.37 and SEQ ID NO.38 for the C133G site; And/or for SEQ ID NO.39 and the SEQ ID NO.40 in C208T site.
3. SLC22A2 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.11 for the G120C site reaches the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.12; The sequence that is comprised of SEQ ID NO.3 and SEQ ID NO.13 for the C122T site reaches the sequence that is comprised of SEQ ID NO.4 and SEQ ID NO.14; The sequence that is comprised of SEQ ID NO.5 and SEQ ID NO.15 for the A104C site reaches the sequence that is comprised of SEQ ID NO.6 and SEQ ID NO.16; The sequence that is comprised of SEQ ID NO.7 and SEQID NO.17 for the C133G site reaches the sequence that is comprised of SEQ ID NO.8 and SEQ ID NO.18; And/or for the sequence that is formed by SEQ ID NO.9 and SEQ ID NO.19 in C208T site and the sequence that is formed by SEQ ID NO.10 and SEQ ID NO.20.
4. SLC22A2 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that,
(A). described ASPE primer is: the sequence that is comprised of SEQ ID NO.1 and SEQ ID NO.11 for the G120C site reaches the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.12; The sequence that is comprised of SEQ ID NO.3 and SEQ ID NO.13 for the C122T site reaches the sequence that is comprised of SEQ ID NO.4 and SEQ ID NO.14; The sequence that is comprised of SEQ ID NO.5 and SEQ ID NO.15 for the A104C site reaches the sequence that is comprised of SEQ ID NO.6 and SEQ ID NO.16; The sequence that is comprised of SEQ ID NO.7 and SEQ ID NO.17 for the C133G site reaches the sequence that is comprised of SEQ ID NO.8 and SEQ ID NO.18; Reach the sequence that is formed by SEQ ID NO.10 and SEQ ID NO.20 with the sequence that is formed by SEQ ID NO.9 and SEQ ID NO.19 for the C208T site;
(B). anti-tag sequence microballoon coated, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.21~SEQ ID NO.30, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). described amplimer is: for SEQ ID NO.31 and the SEQ ID NO.32 in G120C site; SEQ ID NO.33 and SEQ ID NO.34 for the C122T site; SEQ ID NO.35 and SEQ ID NO.36 for the A104C site; SEQ ID NO.37 and SEQ ID NO.38 for the C133G site; With SEQ ID NO.39 and the SEQ ID NO.40 for the C208T site.
5. each described SLC22A2 gene pleiomorphism detects liquid-phase chip according to claim 1-4, it is characterized in that, described spacerarm is 5-10 T.
6. be used for the Auele Specific Primer that the SLC22A2 gene pleiomorphism detects, it is characterized in that, described specific primer sequence is: for SEQ ID NO.11 and the SEQ ID NO.12 in G120C site; SEQ ID NO.13 and SEQ ID NO.14 for the C122T site; SEQ ID NO.15 and SEQ ID NO.16 for the A104C site; SEQ ID NO.17 and SEQ ID NO.18 for the C133G site; And/or for SEQ ID NO.19 and the SEQ ID NO.20 in C208T site.
CN201110251577.6A 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene Expired - Fee Related CN102952870B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201110251577.6A CN102952870B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201110251577.6A CN102952870B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene

Publications (2)

Publication Number Publication Date
CN102952870A true CN102952870A (en) 2013-03-06
CN102952870B CN102952870B (en) 2014-06-18

Family

ID=47762251

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201110251577.6A Expired - Fee Related CN102952870B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene

Country Status (1)

Country Link
CN (1) CN102952870B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005026736A2 (en) * 2003-09-13 2005-03-24 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with organic cation transporter slc22a2 (slc22a2)

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005026736A2 (en) * 2003-09-13 2005-03-24 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with organic cation transporter slc22a2 (slc22a2)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
OLIVER ZOLK ET AL.: "Functional Characterization of the Human Organic Cation Transporter 2 Variant p.270 Ala>Ser", 《DRUG MATAB DISPOS》 *
XIAOHONG ZHANG ET AL.: "A Conserved Glutamate Residue in Transmembrane Helix 10 Influences Substrate Specificity of Rabbit OCT2(SLC22A2)", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 *

Also Published As

Publication number Publication date
CN102952870B (en) 2014-06-18

Similar Documents

Publication Publication Date Title
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN102994621A (en) PTPN11 gene mutation detection specificity primer and liquid chip thereof
CN102912002B (en) ABCB2 gene polymorphism detection specific primers and liquid chip
CN102181573B (en) Specific primers and liquid-phase chip for detection of KITLG gene
CN102952870B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene
CN102304567B (en) Polymorphic detection specific primers and liquid phase chip in 8 q 24 section of chromosome
CN102952866B (en) Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene
CN103031367A (en) VHL (Von Hippel Lindau) genetic mutation detection specific primer and liquid phase chip
CN103031365A (en) ATM gene mutation detection specific primer and liquid chip
CN102952867B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene
CN102952868B (en) Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene
CN102952874B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene
CN102994625B (en) PIK3R1 gene mutation detection specificity primer and liquid chip thereof
CN102952872B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene
CN102888444B (en) Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip
CN102191335B (en) Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes
CN102952873B (en) Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene
CN102912005A (en) CYP2C8 gene polymorphism detection specific primers and liquid chip
CN102952871B (en) Specific primer and liquid chip for detecting polymorphism of SULT1A1 gene
CN103374607A (en) ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip
CN103031364A (en) FGFR3 gene mutation detection specific primer and liquid chip
CN102912006A (en) CYP2A6 gene polymorphism detection specific primers and liquid chip
CN102191336A (en) MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C53 Correction of patent of invention or patent application
CB02 Change of applicant information

Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant after: Surexam Biological Technology Co., Ltd.

Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant before: Guangzhou Yishan Biotechnology Co., Ltd.

COR Change of bibliographic data

Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD.

C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140618

Termination date: 20140829

EXPY Termination of patent right or utility model