CN102586446A - Noninvasive detection kit for nasopharyngeal carcinoma susceptibility genes - Google Patents

Abstract

The invention provides a noninvasive detection kit for nasopharyngeal carcinoma susceptibility genes. The kit comprises a specific primer, a DNA sequencing primer, a PCR (Polymerase Chain Reaction) component, a PCR product purification component, a DNA sequencing reaction component and the like, wherein the specific primer is used for detecting the polymorphic site genotypes of four mononucleotides of the Rsall polymorphism on a CYP2E1 gene, the polymorphism of a G252 site on a TNF (Tumor Necrosis Factor)-alpha gene, the deletion (Present/Null) of a GSTM (Giant Solide Turner Of The Mediastinum) 1 gene and the deletion (Present/Null) of a GSTT (Gross Saponin From Tribulus Terrestris) 1 gene. According to the kit, the risk level of nasopharyngeal carcinoma of a subject is evaluated according to the genotypes of two mononucleotide polymorphic sites closely related to the nasopharyngeal carcinoma, and then, according to the gene detection results of each subject, the subjects are guided from the gene level to specifically prevent the nasopharyngeal carcinoma so as to reduce the morbidity risk rate of the nasopharyngeal carcinoma. The sampling method of the kit adopts oral mucosal cell sampling which is painless and non-invasive, and cross-infections are avoided. The sequencing detection result of the kit is accurate and reliable, and is easy to popularize because expensive import special instruments are not needed to be purchased.

Description

The nasopharyngeal carcinoma tumor susceptibility gene does not have the wound detection kit

Technical field

The invention belongs to biology field; Relate to medical science and biotechnology; Be specifically related to a kind of nasopharyngeal carcinoma kit for detecting susceptibility genes, according to the risk class of detected result from the morbidity of gene aspect assessment nasopharyngeal carcinoma, and the direction of conduct prevention and treatment nasopharyngeal carcinoma instructs.

Background technology

Nasopharyngeal carcinoma is meant the malignant tumour that betides cavum nasopharyngeum top and sidewall.Common symptoms is a nasal obstruction, nasal mucus bleeds, headache, tinnitus; Invade late period and the cranium brain, tinnitus, deafness, headache, diplopia and deradenoncus can occur.The most countries in the world; The nasopharyngeal carcinoma sickness rate is extremely low, but some its sickness rate of country are very high in southern china part provinces and cities and the southeast, Asia, and wherein Guangdong Province, China south is hotspot, the world; World population markization sickness rate is about 30,/10 ten thousand up to the male sex, and the women about 13,/10 ten thousand.Result of study shows; Nasopharyngeal carcinoma has epidemiologic features such as significant areal variation, family aggregation and sickness rate be relatively stable, epidemiology of immigration research evidence with meet the compartment analysis result of study and all point out inherited genetic factors in the incidence and development of nasopharyngeal carcinoma, to have vital role.

The Cytochrome P450 superfamily is one type of important metabolic enzyme gene.The CYP450 enzyme of its coding can change the procarcinogen metabolism of non-activity into and has active intermediate product; These intermediate products have electrophilicity and can add and thing with the formation of DNA covalent attachment; Thereby damage dna and cause oncogene and the change of cancer suppressor gene causes canceration to form.Some low-molecular-weight compounds of CYP2E1 enzyme main metabolic activation comprise nitrosamines, aflatoxin B1, benzopyrene, tetracol phenixin etc.

TNF has multiple bioactive important proinflammatory cytokine in the body, mainly by secretions such as LPS activated monokaryon, scavenger cell and lymphocytes.That TNF has is antiviral, induce inflammation and immunoloregulation function widely, and the most outstanding is its powerful antitumor characteristic.Thereby, particularly in the incidence and development process of malignant tumour, play an important role at autoimmune disorder, infection.Research shows that TNF-β G252A mononucleotide loci polymorphism and nasopharyngeal carcinoma susceptibility are closely related, so can be used as one of Hazard Factor of nasopharyngeal carcinoma susceptibility.

Glutathione S-transferase (GSTs) is one type of polygene enzyme family with important detoxification in the human body; GSTM1 wherein and GSTT1 encode respectively GST-μ and GST-θ isozyme have very strong detoxification to the haloalkane hydro carbons in polycyclic aromatic hydrocarbons and epoxide and the sterilant respectively.Research shows that the disappearance of GSTT1 and GSTM1 gene causes the isozyme disappearance of their codings, all possibly influence the function of detoxification of body to above-mentioned poisonous substance, increases the susceptibility of host to such carcinogens effect.It is polymorphic to there are some researches show that GSTM1 and GSTT1 exist the crowd to lack; And the different miss rates in region are variant; Chinese GSTM1 miss rate is higher, and at 35%-63%, especially the GSTT1 miss rate is up to 58%; This part crowd has been equivalent to increase the concentration of environmental toxin and carcinogenic substance, has improved the individual risk of suffering from a series of types of cancer.Research both at home and abroad shows, carries the individuality of GSTM1 and GSTT1 absence type, and the risk of nasopharyngeal carcinoma increases, so the GSTM1/GSTT1 absence type is one of important nasopharyngeal carcinoma inheritance susceptible factor of Chinese population.

In sum; In view of Rsal1 polymorphum on the CYP2E1 gene; G252A loci polymorphism on the TNF-β gene, GSTM1 genetically deficient be (Present/Null) whether, and whether (Present/Null) has very important effect to GSTT1 genetically deficient in nasopharynx canceration process; Can said gene be detected the person under inspection as the inheritance susceptible factor and relevant gene mononucleotide loci gene type take place in nasopharyngeal carcinoma; Examination in time goes out to be prone to suffer from the high risk population of nasopharyngeal carcinoma, thereby prevents and treat nasopharyngeal carcinoma targetedly, and this has very important meaning for the sickness rate that reduces nasopharyngeal carcinoma.

Summary of the invention

Based on Rsal1 polymorphum on the CYP2E1 gene; G252A loci polymorphism on the TNF-β gene; GSTM1 genetically deficient is (Present/Null) whether; GSTT1 genetically deficient whether 4 mononucleotide polymorphism site genotype of (Present/Null) can be used as on the basis of risk factor of assessment nasopharyngeal carcinoma morbidity, and the present invention provides a kind of nasopharyngeal carcinoma kit for detecting susceptibility genes.

This test kit comprises:

Detect Rsal1 polymorphum on the CYP2E1 gene; G252A loci polymorphism on the TNF-β gene; GSTM1 genetically deficient is (Present/Null) whether, GSTT1 genetically deficient whether (Present/Null) 4 genotypic Auele Specific Primers of mononucleotide polymorphism site to and the dna sequencing primer;

PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);

PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);

Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).

The component and the content of test kit of the present invention comprise:

PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.

PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.

Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The use of embodiment 1. detection kit

1, extracting dna profiling

Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.

2, pcr amplification reaction

Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:

(1) CYP2E1 (Rsal1) forward primer: 5 ' AAGTGATTTGGCTGGATTGTA3 '

CYP2E1 (Rsal1) reverse primer: 5 ' ATACAGACCCTCTTCCACCTT3 '

(2) TNF-β (G252A) forward primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '

TNF-β (G252A) reverse primer: 5 ' TTCGTGCTTTGGACTACCG3 '

(3) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC3 '

GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(4) GSTT1 (Null/Present) forward primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

GSTT1 (Null/Present) reverse primer: 5 ' TCACCGGATCATGGCCAGCA3 '

The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;

Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ prolonged in 1 minute, circulates 28 times, and last 72 ℃ of prolongations are more than 5 minutes.

3, pcr amplification product purifying

Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.

4, dna sequencing reaction

Use the sequencing reaction assembly in the detection kit, wherein, contain following dna sequencing primer:

(1) CYP2E1 (Rsal1) sequencing primer: 5 ' AAGTGATTTGGCTGGATTGTA3 '

(2) TNF-β (G252A) sequencing primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '

(3) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

(4) GSTT1 (Null/Present) sequencing primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.

Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.

5, gene type assay

The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.

2. couples of people of embodiment prevent the gene of nasopharyngeal carcinoma morbidity not have the service that wound detects

1. sample and extracting DNA

Instructing the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor carries out the mouth epithelial cells sampling, adopts phenol chloroform method to carry out the DNA extracting of mouth epithelial cells

2. genotype detection

Use test kit provided by the invention; To Rsal1 polymorphum on the CYP2E1 gene of person under inspection's genomic dna; G252A loci polymorphism on the TNF-β gene; GSTM1 genetically deficient is (Present/Null) whether, and GSTT1 genetically deficient whether 4 mononucleotide polymorphism sites of (Present/Null) is carried out dna sequencing respectively, confirms the genotype in these 4 SNPs sites.

3. nasopharyngeal carcinoma morbidity high risk population risk assessment

Through to the genotypic analysis of person under inspection SNPs, provide nasopharyngeal carcinoma tumor susceptibility gene risk assessment analysis report list.Specified Rsal1 polymorphum on the person under inspection CYP2E1 gene in the report; G252A loci polymorphism on the TNF-β gene; GSTM1 genetically deficient is (Present/Null) whether, GSTT1 genetically deficient whether on 4 genes of (Present/Null) the SNP locus gene detect information and genetic risk assessment result.In addition, according to person under inspection's risk class, and specify and understand the nasopharyngeal carcinoma tumor susceptibility gene by the doctor to the person under inspection and do not have wound examining report list.

Claims (6)

1. a detection nasopharyngeal carcinoma tumor susceptibility gene does not have the wound detection kit; It is characterized in that: detect Rsal1 polymorphum on the CYP2E1 gene; G252A loci polymorphism on the TNF-β gene; GSTM1 genetically deficient is (Present/Null) whether, and GSTT1 genetically deficient is 4 genotypic Auele Specific Primers of mononucleotide polymorphism site and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, the ddH of (Present/Null) whether ₂O etc.

2. test kit according to claim 1; It is characterized in that: described Auele Specific Primer is to being meant to Rsal1 polymorphum on the CYP2E1 gene; G252A loci polymorphism on the TNF-β gene; GSTM1 genetically deficient is (Present/Null) whether, and GSTT1 genetically deficient is 4 mononucleotide polymorphism sites of (Present/Null) whether, and the primer of dna fragmentation that can specific amplification goes out to comprise these 4 SNPs sites is right.

3. test kit according to claim 1; It is characterized in that: described dna sequencing primer is to Rsal1 polymorphum on the CYP2E1 gene; G252A loci polymorphism on the TNF-β gene; GSTM1 genetically deficient is (Present/Null) whether, GSTT1 genetically deficient whether (Present/Null) 4 mononucleotide polymorphism sites and design, can go out the dna sequencing primer of above-mentioned 4 SNPs loci gene types through dna sequencing technology specific detection.

4. according to the test kit shown in the claim 1, it is characterized in that 4 pairs of contained specific primer sequences are following:

(1) CYP2E1 (Rsal1) forward primer: 5 ' AAGTGATTTGGCTGGATTGTA3 '

CYP2E1 (Rsal1) reverse primer: 5 ' ATACAGACCCTCTTCCACCTT3 '

(2) TNF-β (G252A) forward primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '

TNF-β (G252A) reverse primer: 5 ' TTCGTGCTTTGGACTACCG3 '

(3) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(4) GSTT1 (Null/Present) forward primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

GSTT1 (Null/Present) reverse primer: 5 ' TCACCGGATCATGGCCAGCA3 '

5. test kit according to claim 1 is characterized in that, 4 contained dna sequencing primer sequences are following:

(1) CYP2E1 (Rsal1) sequencing primer: 5 ' AAGTGATTTGGCTGGATTGTA3 '

(2) TNF-β (G252A) sequencing primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '

(3) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

(4) GSTT1 (Null/Present) sequencing primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:

(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH ₂O 19.175ul.

(2) PCR product purification system: 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, ddH ₂O 3.875ul.

(3) sequencing reaction system: 25%BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mMEDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH ₂O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.