CN102559893A - Noninvasive detection kit for genetic susceptibility genes of three female tumors - Google Patents
Noninvasive detection kit for genetic susceptibility genes of three female tumors Download PDFInfo
- Publication number
- CN102559893A CN102559893A CN2011104589581A CN201110458958A CN102559893A CN 102559893 A CN102559893 A CN 102559893A CN 2011104589581 A CN2011104589581 A CN 2011104589581A CN 201110458958 A CN201110458958 A CN 201110458958A CN 102559893 A CN102559893 A CN 102559893A
- Authority
- CN
- China
- Prior art keywords
- primer
- cancer
- sequencing
- test kit
- comt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a noninvasive detection kit for genetic susceptibility genes of three female tumors. The kit comprises a specific primer and a DNA (deoxyribonucleic acid) sequencing primer, a PCR (polymerase chain reaction) component, a PCR product purification component, a DNA sequencing reaction component and the like, wherein the specific primer is used for detecting 9 mononucleotide polymorphism locus genotypes closely related to female diseases which easily cause tumors, such as breast cancer, uterine cancer and cervical cancer. According to the invention, the level of a risk that a female has the liability to the breast cancer, the uterine cancer and the cervical cancer can be estimated through detecting the 9 mononucleotide polymorphism locus genotypes closely related to the breast cancer, the uterine cancer and the cervical cancer, and the risk level of susceptibility of female tumor is estimated from a gene level according to the gene detection result of each examinee in the end so as to guide the female to purposefully prevent the generation of the breast cancer, the uterine cancer and the cervical cancer in advance.
Description
Technical field
The invention belongs to biology field; Relate to medical science and biotechnology; Be specifically related to the gene detecting kit of three tumour genetic predispositions of a kind of women; According to the risk class of detected result, and instruct as the suggestion of women's Breast Cancer Prevention, uterus carcinoma, cervical cancer from three tumour genetic predispositions of gene aspect assessment women.
Background technology
The massive epidemiology investigation shows that malignant tumour has high incidence and high mortality, is one of dead major reason of each age group crowd.
Show that according to authoritative statistic data in 6,600,000,000 populations of the whole world, about 1,000 ten thousand, more than 500 ten thousand people of annual New Development tumour patient die from cancer, and cancer patients's death was almost just arranged in 6 seconds.And statistical result showed, causing the common cancer of women dead 5 kinds is mammary cancer, lung cancer, cancer of the stomach, uterus carcinoma and cervical cancer.
In China, annual New Development tumour patient is about 2,500,000, and because of the cancer mortality number is 1,400,000, promptly every dead 5 philtrums just have 1 people to die from cancer.We can say that cancer has become a kind of common disease and frequently-occurring disease.According to World Bank's measuring and calculating, China is used for about 80,000,000,000 yuan of cancer patient medical fee every year, accounts for health total expenses 20%, far above the medical expenses for medicine of other chronic diseases.
Above thus data can find out that the cancer morbidity of China is suitable with world average level, and all are in ascendant trend year by year, therefore how to prevent or control the present medicine and hygiene fields problem demanding prompt solution of becoming of cancer.
A large amount of medical researches show, tumour be that multiple factor interaction produces, comprising multiple determinatives such as inherited genetic factors, environmental factorss, its mechanism of action is very complicated.Along with the development of tumour molecular genetics, oncocytogenetics and molecular epidemiology, recognize gradually that just cancer is a kind of genetics disease, the activation of proto-oncogene and the deactivation of tumor suppressor gene play the biological action at center in the canceration process; In hereditary cancer syndrome, the germ line mutation of cancer associated gene has determined the tumour genetic predisposition of this family; And in sporadic cancer, the primary hazard factor is an environmental factor, and the genetic polymorphism of genes involved has determined individual susceptibility to these factors therewith.In recent years, the Human Genome Project, environment genome plan, oncogene group are dissected the research of plan and tumour epigenetics etc., have constantly deepened the understanding to the tumour genetic predisposition.
Because most tumors all is that environmental factors is brought out, the inheritance susceptible factor promotes to form, so the prevention of tumour can be started with the occurrence risk of reduction tumour from the inheritance susceptible factor.
The Genetic Detection project is exactly to use theory, technology and the method for modern molecular genetics, the health check-up project that person under inspection's diseases genetic risk and ability are detected and assess.
For example there is quite a few to be and the relevant gene of estrogen metabolism regulation and control in the inheritance susceptible factor of mammary cancer.A G/A polymorphic site sudden change on No. 4 exon of COMT gene causes its 158th bit codon amino acids coding to become Met by Val.The genotype in this site has GG, GA, AA, and wherein A allelotrope is relevant with the generation of mammary cancer, and AA genotype (being the Met/Met genotype) is confirmed as the mammary cancer risk genotype.The Val of COMT gene, Met allelotrope are relevant with the high and low activity of enzyme respectively, and are codominant inheritance, and promptly the genotypic enzyme of Val/Val has high reactivity, and the genotypic enzyme of Val/Met has moderate activity, and the genotypic enzymic activity of Met/Met is minimum.Between Val/Val and the Met/Met genotype, enzymic activity differs 3-4 doubly.When carrying risk genes type (Met/Met, i.e. AA), the COMT enzymic activity descends, and has influenced the deactivation of catechol estrogen, and promptly catechol estrogen increases, and promptly catechol estrogen increases, and the mammary cancer occurrence risk rises.
Therefore; Foundation simply, the gene of three tumour genetic predispositions of women does not have the wound detection method fast; Can detect the women and relevant gene mononucleotide loci gene type take place with mammary cancer, uterus carcinoma, cervical cancer; Examination in time goes out to be prone to suffer from breast cancer, the women high risk population of uterus carcinoma, cervical cancer, thereby takes preventive measures as early as possible according to detected result, and this has very important meaning for reducing women with breast cancer, uterus carcinoma, cervical cancer sickness rate.
Summary of the invention
9 mononucleotide polymorphism site genotype based on ER-α (Pvu II), ER-α (XbaI), COMT (Val158Met), GSTP1 (Ile105Val), P53 (Arg72Pro), GSTM1 (Null/Present), IL-18 (G-137C), CYP17A1 (MspA1I), CYP1B1 (Leu432Val) can be used to assess on female estrogen biological function and the detoxification ability basis; The present invention provides three tumour genetic predispositions of a kind of women gene detecting kit, and to the person under inspection personalized health guidance scheme is provided.
This test kit comprises:
9 genotypic Auele Specific Primers of mononucleotide polymorphism site that detect ER-α (Pvu II), ER-α (XbaI), COMT (Val158Met), GSTP1 (Ile105Val), P53 (Arg72Pro), GSTM1 (Null/Present), IL-18 (G-137C), CYP17A1 (MspA1I), CYP1B1 (Leu432Val) are to reaching the dna sequencing primer;
PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);
PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);
Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).
The component and the content of test kit of the present invention comprise:
PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.
PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.
Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.
This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
The use of embodiment 1. detection kit
1, extracting dna profiling
Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.
2, pcr amplification reaction
Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:
(1) ER-α (Pvu II)/ER-α (XbaI) forward primer: 5 ' TCTCCCACCTCAGCCTTACA3 ' ER-α (Pvu II)/ER-α (XbaI) reverse primer: 5 ' TCCATAGCCATACTTCCCTTG3 '
(2) COMT (Val158Met) forward primer: 5 ' TCGTGGACGCCGTGATTC3 ' COMT (Val158Met) reverse primer: 5 ' CACCCATACAAGCATTCATCAGTT3 '
(3) GSTP1 (Ile105Val) forward primer: 5 ' ATCCTTCCACGCACATCC3 ' GSTP1 (Ile105Val) reverse primer: 5 ' CACCCATACAAGCATTCATCAGTT3 '
(4) P53 (Arg72Pro) forward primer: 5 ' CGTTCTGGTAAGGACAAGGGTT, 3 ' P53 (Arg72Pro) reverse primer: 5 ' AAGAAGCCCAGACGGAAACC 3 '
(5) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC, 3 ' GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '
(6) IL-18 (G-137C) forward primer: 5 ' GCTTCTAATGGACTAAGGAGGTG, 3 ' IL-18 (G-137C) reverse primer: 5 ' GGAAGAAGGTGGAGGGAGG3 '
(7) CYP17 (MspA1I) forward primer: 5 ' CCCATACGAACCGAATAGA, 3 ' CYP 17 (MspA1 I) reverse primer: 5 ' AGTCAAGGTGAAGATCAGGGTAG3 '
(8) CYP1B1 (Leu432Val) forward primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 ' CYP1B1 (Leu432Val) reverse primer: 5 ' AGCCAGGATGGAGATGAAGAG3 '
The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;
Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ prolonged in 1 minute, circulates 28 times, and last 72 ℃ of prolongations are more than 5 minutes.
3, pcr amplification product purifying
Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.
On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.
4, dna sequencing reaction
Use the sequencing reaction assembly in the detection kit, wherein, contain following dna sequencing primer:
(1) ER-α (Pvu II)/ER-α (XbaI) sequencing primer: 5 ' CCCATACGAACCGAATAGA3 '
(2) COMT (Val158Met) sequencing primer: 5 ' TCGTGGACGCCGTGATTC3 '
(3) GSTP1 (Ile105Val) sequencing primer: 5 ' ATCCTTCCACGCACATCC3 '
(4) P53 (Arg72Pro) sequencing primer: 5 ' CGTTCTGGTAAGGACAAGGGTT 3 '
(5) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '
(6) IL-18 (G-137C) sequencing primer: 5 ' GCTTCTAATGGACTAAGGAGGTG 3 '
(7) CYP17 (MspA1I) sequencing primer: 5 ' CCCATACGAACCGAATAGA 3 '
(8) CYP1B1 (Leu432Val) sequencing primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 '
The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.
On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.
Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.
5, gene type assay
The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.
Embodiment 2. provides three tumour genetic predispositions of person under inspection women to detect service
1. sample and extracting DNA
Instructing the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor carries out the mouth epithelial cells sampling, adopts phenol chloroform method to carry out the DNA extracting of mouth epithelial cells
2. genotype detection
Use test kit provided by the invention; 9 mononucleotide polymorphism sites to the ER-α (Pvu II) of person under inspection's genomic dna, ER-α (XbaI), COMT (Val158Met), GSTP1 (Ile105Val), P53 (Arg72Pro), GSTM1 (Null/Present), IL-18 (G-137C), CYP17A1 (MspA1I), CYP1B1 (Leu432Val) carry out dna sequencing respectively, confirm the genotype in these 9 SNPs sites.
3. three tumour genetic predispositions of women high risk population risk assessment
Through to the genotypic analysis of person under inspection SNPs, provide three tumor disease genetic susceptibility risk assessment of women analysis report list.Person under inspection ER-α (Pvu II), ER-α (XbaI), COMT (Val158Met), GSTP1 (Ile105Val), P53 (Arg72Pro), GSTM1 (Null/Present), IL-18 (G-137C), CYP17A1 (MspA1I), CYP1B1 (Leu432Val) upward SNP locus gene detection information and genetic risk assessment result have been specified in the report.In addition, according to person under inspection's risk class, and specify and understand three tumour genetic predispositions of women gene by the doctor to the person under inspection and do not have wound examining report list.
Claims (6)
1. a gene that detects three tumour genetic predispositions of women does not have the wound detection kit, it is characterized in that: detection is prone to swell with the women, and the knurl disease--closely-related ER-α (Pvu II), ER-α (XbaI), COMT (Val158Met), GSTP1 (Ile105Val), P53 (Arg72Pro), GSTM1 (Null/Present), IL-18 (G-137C), CYP17A1 (MspA1I), 9 genotypic Auele Specific Primers of mononucleotide polymorphism site of CYP1B 1 (Leu432Val) and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, ddH take place in-mammary cancer, uterus carcinoma, cervical cancer
2O etc.
2. test kit according to claim 1; It is characterized in that: described Auele Specific Primer is to being meant 9 mononucleotide polymorphism sites to ER-α (Pvu II), ER-α (XbaI), COMT (Val158Met), GSTP1 (Ile105Val), P53 (Arg72Pro), GSTM1 (Null/Present), IL-18 (G-137C), CYP17A1 (MspA1I), CYP1B1 (Leu432Val), and the primer of dna fragmentation that can specific amplification goes out to comprise these 9 SNPs sites is right.
3. test kit according to claim 1; It is characterized in that: described dna sequencing primer is to design to 9 mononucleotide polymorphism sites of ER-α (Pvu II), ER-α (XbaI), COMT (Val158Met), GSTP1 (Ile105Val), P53 (Arg72Pro), GSTM1 (Null/Present), IL-18 (G-137C), CYP17A1 (MspA1I), CYP1B1 (Leu432Val), can go out the dna sequencing primer of above-mentioned 9 SNPs loci gene types through dna sequencing technology specific detection.
4. according to the test kit shown in the claim 1, it is characterized in that 9 pairs of contained specific primer sequences are following:
(1) ER-α (Pvu II)/ER-α (XbaI) forward primer: 5 ' TCTCCCACCTCAGCCTTACA3 ' ER-α (Pvu II)/ER-α (XbaI) reverse primer: 5 ' TCCATAGCCATACTTCCCTTG3 '
(2) COMT (Val158Met) forward primer: 5 ' TCGTGGACGCCGTGATTC3 ' COMT (Val158Met) reverse primer: 5 ' CACCCATACAAGCATTCATCAGTT3 '
(3) GSTP1 (Ile105Val) forward primer: 5 ' ATCCTTCCACGCACATCC3 ' GSTP1 (Ile105Val) reverse primer: 5 ' CACCCATACAAGCATTCATCAGTT3 '
(4) P53 (Arg72Pro) forward primer: 5 ' CGTTCTGGTAAGGACAAGGGTT, 3 ' P53 (Arg72Pro) reverse primer: 5 ' AAGAAGCCCAGACGGAAACC 3 '
(5) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC, 3 ' GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '
(6) IL-18 (G-137C) forward primer: 5 ' GCTTCTAATGGACTAAGGAGGTG, 3 ' IL-18 (G-137C) reverse primer: 5 ' GGAAGAAGGTGGAGGGAGG3 '
(7) CYP17 (MspA1I) forward primer: 5 ' CCCATACGAACCGAATAGA, 3 ' CYP17 (MspA1I) reverse primer: 5 ' AGTCAAGGTGAAGATCAGGGTAG3 '
(8) CYP1B1 (Leu432Val) forward primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 ' CYP1B1 (Leu432Val) reverse primer: 5 ' AGCCAGGATGGAGATGAAGAG3 '
5. test kit according to claim 1 is characterized in that, 9 contained dna sequencing primer sequences are to be directed against as follows:
(1) ER-α (Pvu II)/ER-α (XbaI) sequencing primer: 5 ' CCCATACGAACCGAATAGA3 '
(2) COMT (Val158Met) sequencing primer: 5 ' TCGTGGACGCCGTGATTC3 '
(3) GSTP1 (Ile105Val) sequencing primer: 5 ' ATCCTTCCACGCACATCC3 '
(4) P53 (Arg72Pro) sequencing primer: 5 ' CGTTCTGGTAAGGACAAGGGTT 3 '
(5) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '
(6) IL-18 (G-137C) sequencing primer: 5 ' GCTTCTAATGGACTAAGGAGGTG 3 '
(7) CYP17 (MspA1I) sequencing primer: 5 ' CCCATACGAACCGAATAGA 3 '
(8) CYP1B1 (Leu432Val) sequencing primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 '
6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:
(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH
2O 19.175ul.
(2) PCR product purification system: 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, ddH
2O 3.875ul.
(3) sequencing reaction system: 25%BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mMEDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH
2O2ul.
This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104589581A CN102559893A (en) | 2011-12-30 | 2011-12-30 | Noninvasive detection kit for genetic susceptibility genes of three female tumors |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104589581A CN102559893A (en) | 2011-12-30 | 2011-12-30 | Noninvasive detection kit for genetic susceptibility genes of three female tumors |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102559893A true CN102559893A (en) | 2012-07-11 |
Family
ID=46406493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104589581A Pending CN102559893A (en) | 2011-12-30 | 2011-12-30 | Noninvasive detection kit for genetic susceptibility genes of three female tumors |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102559893A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361344A (en) * | 2013-06-08 | 2013-10-23 | 深圳市奥尼克斯基因技术有限公司 | SNP (single nucleotide polymorphisms) associated with cervical cancer and method for detecting susceptible populations of cervical cancer |
| CN106244727A (en) * | 2016-08-22 | 2016-12-21 | 杭栋 | Test method for combined effect of HPV-16 and host genetic factors |
-
2011
- 2011-12-30 CN CN2011104589581A patent/CN102559893A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361344A (en) * | 2013-06-08 | 2013-10-23 | 深圳市奥尼克斯基因技术有限公司 | SNP (single nucleotide polymorphisms) associated with cervical cancer and method for detecting susceptible populations of cervical cancer |
| CN103361344B (en) * | 2013-06-08 | 2015-11-25 | 深圳市奥尼克斯基因技术有限公司 | The SNP be associated with cervical cancer and the method for detecting cervical cancer Susceptible population thereof |
| CN106244727A (en) * | 2016-08-22 | 2016-12-21 | 杭栋 | Test method for combined effect of HPV-16 and host genetic factors |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Søborg et al. | Influence of candidate susceptibility genes on tuberculosis in a high endemic region | |
| Merza et al. | The NRAMPI, VDR and TNF-α gene polymorphisms in Iranian tuberculosis patients: the study on host susceptibility | |
| CN102399875A (en) | Gene noninvasive detection kit for preventing neural tube defects of newborns | |
| CN104152557B (en) | The diagnostic kit of gene pleiomorphism variant sites earlier evaluations mammary cancer risk | |
| CN102559893A (en) | Noninvasive detection kit for genetic susceptibility genes of three female tumors | |
| CN102517394A (en) | Reagent kit for noninvasive test of cervical cancer susceptibility gene | |
| CN102586468A (en) | Noninvasive detection kit for susceptibility gene of bladder cancer | |
| CN102586447A (en) | Noninvasive detection kit of predisposing genes of pancreatic cancer | |
| CN102373285A (en) | Noninvasive gene assay kit for female gestational hypertension | |
| CN104450876A (en) | Non-invasive defection kit for screening susceptibility genes of endometrial carcinoma | |
| CN102703581A (en) | Colorectal cancer susceptibility gene noninvasive detection kit | |
| CN102424854A (en) | Noninvasive detection kit for sporadic breast cancer susceptibility gene | |
| CN103468789A (en) | Noninvasive test kit of thyroid cancer susceptibility genes | |
| CN102424853A (en) | Kit for noninvasive detection of ovarian cancer susceptible gene | |
| CN102559903A (en) | Non-invasive detection kit for endometrial carcinoma predisposing gene | |
| CN102605081A (en) | Noninvasive detection kit for susceptibility genes for oral cancer | |
| CN102433380A (en) | Noninvasive test kit for female estrogen-sensitive toxic and side effect predisposing gene | |
| CN104894238A (en) | Kit for auxiliary evaluation of esophagus cancer genetic risk of people to be detected | |
| CN103540649A (en) | Deep venous thrombosis susceptible gene detection kit (MTHFR and other genes) | |
| CN108179192A (en) | A kind of kit of gene pleiomorphism variant sites early diagnosis carcinoma of endometrium | |
| Mohammed et al. | Vitamin D Receptors Gene Polymorphisms and their Association with Serum Vitamin D level among Sudanese Patients with Benign Prostatic Hyperplasia | |
| CN103374622A (en) | Noninvasive detection kit for Hashimoto's thyroiditis genes | |
| CN102586443A (en) | Noninvasive chronic myelogenous leukemia susceptibility gene assay kit | |
| CN102586445A (en) | Kit for noninvasive detection of stomach cancer susceptible genes | |
| CN103468782A (en) | Essential hypertension gene noninvasive detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C05 | Deemed withdrawal (patent law before 1993) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120711 |