CN102517394A - Reagent kit for noninvasive test of cervical cancer susceptibility gene - Google Patents

Abstract

The invention provides a reagent kit for noninvasive test of cervical cancer susceptibility gene, which comprises specific primers, DNA (deoxyribonucleic acid) sequencing primers, PCR(polymerase chain reaction) reaction components, PCR product purifying components, DNA sequencing reaction components and the like, wherein the specific primers and the DNA sequencing primers are used for testing four mononucleotide polymorphism locus genotypes of Arg72Pro(rs1042522) on gene P53, deletion of gene GSTM1 (null/present), deletion of gene GSTT1 gene (null/present) and C677T(rs1801133) on gene MTHFR. The reagent kit can be used evaluating the risk level of female cervical cancer proportion by testing the four mononucleotide polymorphism locus genotypes relative to generation of cervical cancer closely, so that women can be guided to prevent cervical cancer pointedly in terms of the gene according to the gene test result of each woman to be tested, and the proportion of cervical cancer can be reduced. The reagent kit can be used with the oral mucosa cell sampling which is painless and non-invasive, so that cross infection is avoided. In addition, the sequencing test results are accurate and reliable, purchasing of expensive import special instruments is omitted, and the reagent kit is easy to be applied and popularized.

Description

The cervical cancer tumor susceptibility gene does not have the wound detection kit

Technical field

The invention belongs to biology field; Relate to medical science and biotechnology; Be specifically related to a kind of cervical cancer kit for detecting susceptibility genes, according to the risk class of detected result from the morbidity of gene aspect assessment cervical cancer, and the direction of conduct prevention and treatment cervical cancer instructs.

Background technology

Cervical cancer is one of common gynecologic malignant tumor, and sickness rate occupies second in women's malignant tumour, and its mortality ratio rises to the first place gradually.According to The World Health Organization's statistics, estimate at the cervical cancer new cases about 46.6 ten thousand every year, wherein 80% case occurs in developing country.China has new cases about 140,000 every year, accounts for 1/3 of world's cervical cancer new cases sum, and sickness rate is 6 times of some developed countries.

The cause of disease of cervical cancer always by Chinese scholars attention and carried out a large amount of work, find virus infection, as human papillomavirus (human papillomaviruses, HPVs), hsv (HSV) infects etc.Wherein HPV infect be cervical cancer main diseases because of.

In recent years, human papillomavirus (HPV) E6 albumen is widely accepted with the relevant viewpoint of cervical cancer generation the proteic degraded of P53, deactivation.Nearest research shows; P53 gene the 72nd bit codon polymorphum causes HPV E6 to induce the susceptibility of P53 proteolytic degradation different; The P53 albumen that the P53 albumen ratio that contains l-arginine (Arg) contains proline(Pro) (Pro) more is prone to be degraded with HPV E6 protein binding; Arg/Arg genotype proportion in cervical cancer is 7 times of heterozygous apparently higher than normal cervical tissues, thinks that therefore the Arg/Arg genotype is the Hazard Factor that cervical cancer takes place.

Except P53 gene pleiomorphism and cervical cancer have the dependency, the relation of metabolic enzyme gene polymorphum and cervical cancer has also caused various countries scholars' concern.Glutathione S-transferase (GSTs) belongs to II phase metabolic enzyme; Can promote that various electrophilic compounds (comprising environmental carcinogen and mesostate thereof) combine with gsh; Forming compound soluble in water gets rid of external; Be and poisonous substance or the relevant enzyme of carcinogenic metabolic detoxification that GSTM1 and GSTT1 and tumorigenic relation are closer in the known human GSTs family.GSTM1 has present and two allelotrope of null, and wherein present has normal enzymic activity, and the null gene is meant and is called blank genotype again by the homozygote of structure gene disappearance, lacks the GSTM1 enzymic activity.GSTT1 gene polymorphic phenomenon and GSTM1 are similar, also have the absence type gene that lacks the GSTT1 enzymic activity.Normal GSTM1 and GSTT1 enzymic activity possibly reach through the close electro ultrafiltration that promotes carcinogen and protect the susceptible tissue from intravital eliminating; Prevent somatic dna mutation; And the pure and mild disappearance of GSTM1 or GSTT1 gene may reduce or lose organism metabolism and discharge carcinogenic function, thereby it is dangerous to have bigger tumour.One of Hazard Factor that therefore can the missing gene type of GSTM1 and GSTT1 gene be taken place as cervical cancer.

The low onset risk that also can increase cervical cancer of folate level in the shortage of folic acid and the body in the meals, continuing to take foliamin, can to improve epithelium of cervix uteri unusual.MTHFR is folic acid activatory core enzyme in the folic acid metabolism process; Discover that C677T polymorphic position point mutation on the mthfr gene can cause the decline of the thermostability and the enzymic activity of enzyme; Thereby it is unusual to cause that dna methylation occurs; This methylating possibly cause oncogene and expression of tumor suppressor gene unusual unusually, influences the regulation and control of cell growth and function, promotes the generation of cancer.Thereby the polymorphum of mthfr gene and the generation of cervical cancer are closely related.

In sum; In view of P53, GSTM1, GSTT1 and MTHFR have very important effect in Cervical Carcinogenesis; Can said gene be detected the women as the inheritance susceptible factor and relevant gene mononucleotide loci gene type take place in cervical cancer; Examination in time goes out to be prone to suffer from the women high risk population of cervical cancer, thereby prevents and treat cervical cancer targetedly, and this has very important meaning for the sickness rate that reduces women's cervical cancer.

Summary of the invention

Based on Arg72Pro (rs1042522) on the P53 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present); 4 mononucleotide polymorphism site genotype of C677T on the mthfr gene (rs1801133) can be used as on the basis of the risk factor of assessing the cervical cancer morbidity, and the present invention provides a kind of cervical cancer kit for detecting susceptibility genes.

This test kit comprises:

Detect Arg72Pro (rs1042522) on the P53 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and 4 genotypic Auele Specific Primers of mononucleotide polymorphism site of C677T on the mthfr gene (rs1801133) are to reaching the dna sequencing primer;

PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);

PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);

Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).

The component and the content of test kit of the present invention comprise:

PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.

PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.

Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The use of embodiment 1. detection kit

1, extracting dna profiling

Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.

2, pcr amplification reaction

Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:

(1) P53 (Arg72Pro) forward primer: 5 ' CGTTCTGGTAAGGACAAGGGTT3 ' P53 (Arg72Pro) reverse primer: 5 ' AAGAAGCCCAGACGGAAACC3 '

(2) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC3 ' GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(3) GSTT1 (Null/Present) forward primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 ' GSTT1 (Null/Present) reverse primer: 5 ' TCACCGGATCATGGCCAGCA3 '

(4) MTHFR (C677T) forward primer: 5 ' CATCCCTCGCCTTGAACAG3 ' MTHFR (C677T) reverse primer: 5 ' CAGACACTGTTGCTGGGTTTT3 '

The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;

Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ prolonged in 1 minute, circulates 28 times, and last 72 ℃ of prolongations are more than 5 minutes.

3, pcr amplification product purifying

Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.

4, dna sequencing reaction

Use the sequencing reaction assembly in the detection kit, wherein, contain following dna sequencing primer:

(1) P53 (Arg72Pro) sequencing primer: 5 ' CGTTCTGGTAAGGACAAGGGTT3 '

(2) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC3 '

(3) GSTT1 (Null/Present) sequencing primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

(4) MTHFR (C677T) sequencing primer: 5 ' CATCCCTCGCCTTGAACAG3 '

The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.

Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.

5, gene type assay

The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.

2. couples of people of embodiment prevent the gene of cervical cancer morbidity not have the service that wound detects

1. sample and extracting DNA

Instructing the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor carries out the mouth epithelial cells sampling, adopts phenol chloroform method to carry out the DNA extracting of mouth epithelial cells

2. genotype detection

Use test kit provided by the invention; To Arg72Pro (rs1042522) on the P53 gene of person under inspection's genomic dna; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and 4 mononucleotide polymorphism sites of C677T on the mthfr gene (rs1801133) carry out dna sequencing respectively, confirm the genotype in these 4 SNPs sites.

3. cervical cancer morbidity high risk population risk assessment

Through to the genotypic analysis of person under inspection SNPs, provide cervical cancer tumor susceptibility gene risk assessment analysis report list.Specified Arg72Pro (rs1042522) on the person under inspection P53 gene in the report; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and the SNP locus gene detects information and genetic risk assessment result on 4 genes of C677T on the mthfr gene (rs1801133).In addition, according to person under inspection's risk class, and specify and understand the cervical cancer tumor susceptibility gene by the doctor to the person under inspection and do not have wound examining report list.

Claims (6)

1. a detection cervical cancer tumor susceptibility gene does not have the wound detection kit; It is characterized in that: detect Arg72Pro (rs1042522) on the P53 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTTl gene lacks (Null/Present), 4 the genotypic Auele Specific Primers of mononucleotide polymorphism site of C677T on the mthfr gene (rs1801133) and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, ddH ₂O etc.

2. test kit according to claim 1; It is characterized in that: described Auele Specific Primer is to being meant to Arg72Pro (rs1042522) on the P53 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), 4 mononucleotide polymorphism sites of C677T on the mthfr gene (rs1801133), and the primer of dna fragmentation that can specific amplification goes out to comprise these 4 SNPs sites is right.

3. test kit according to claim 1; It is characterized in that: described dna sequencing primer is to Arg72Pro (rs1042522) on the P53 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and 4 mononucleotide polymorphism sites of C677T on the mthfr gene (rs1801133) and designing can go out the dna sequencing primer of above-mentioned 4 SNPs loci gene types through dna sequencing technology specific detection.

4. according to the test kit shown in the claim 1, it is characterized in that 4 pairs of contained specific primer sequences are following:

(1) P53 (Arg72Pro) forward primer: 5 ' CGTTCTGGTAAGGACAAGGGTT 3 '

P53 (Arg72Pro) reverse primer: 5 ' AAGAAGCCCAGACGGAAACC3 '

(2) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC3 '

GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(3) GSTT1 (Null/Present) forward primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

GSTT1 (Null/Present) reverse primer: 5 ' TCACCGGATCATGGCCAGCA3 '

(4) MTHFR (C677T) forward primer: 5 ' CATCCCTCGCCTTGAACAG3 '

MTHFR (C677T) reverse primer: 5 ' CAGACACTGTTGCTGGGTTTT3 '.

5. test kit according to claim 1 is characterized in that, 4 contained dna sequencing primer sequences are following:

(1) P53 (Arg72Pro) sequencing primer: 5 ' CGTTCTGGTAAGGACAAGGGTT3 '

(2) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC3 '

(3) GSTT1 (Null/Present) sequencing primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

(4) MTHFR (C677T) sequencing primer: 5 ' CATCCCTCGCCTTGAACAG3 '.

6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:

(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH ₂O 19.175ul.

(2) PCR product purification system: 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, ddH ₂O 3.875ul.

(3) sequencing reaction system: 25%BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mMEDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH ₂O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.