CN102586430A - Noninvasive detection kit for liver cancer susceptibility genes - Google Patents

Abstract

The invention provides a noninvasive detection kit for detecting liver cancer susceptibility genes. The kit comprises a specific primer for detecting a mononucleotide polymorphism site Tyr113His (rs1051740) on an EPHX1 gene, detecting whether the deletion of a GSTM1 gene occurs or not (Null/Present), detecting whether the deletion of a GSTT1 gene occurs or not (Null/Present) and detecting the genotype of a mononucleotide polymorphism site Ile462Val (rs1048943) on a CYP1A1 gene, a DNA (deoxyribonucleic acid) sequencing primer, a PCR (polymerase chain reaction) reaction system, a PCR product purification system, a DNA sequencing reaction system and the like. The kit disclosed by the invention can evaluate the risk grade of patients with liver cancer in Chinese populations by detecting the genotypes of the four mononucleotide polymorphism sites which are closely related with the liver cancer, guide the Chinese populations to prevent the occurrence of the liver cancer in a targeted manner from gene direction according to gene detection results of subjects and further reduce the incidence rate of the liver cancer. Samples used by the noninvasive detection kit disclosed by the invention are of oral mucosal cells, and the collection method is painless and noninvasive, and can avoid cross infection. The gene sequencing process adopts an ABI 3730 sequencing instrument, the method is simple, convenient, the results are accurate and reliable, and the noninvasive detection kit is suitable for popularization.

Description

Liver cancer susceptibility does not have the wound detection kit

Technical field

The invention belongs to biology field, relate to medical science and biotechnology, be specifically related to a kind of liver cancer susceptibility detection kit, according to the risk class of detected result from gene level assessment onset of liver cancer, and as the direction guidance that prevents and treat liver cancer.

Background technology

Liver cancer is the 5th common cancer in the whole world, also is one of the fastest tumour of sickness rate rising in this year, and its case fatality rate is positioned at the 3rd because of cancer death.According to The World Health Organization's statistics, liver cancer is occurred frequently in the African southeast and South East Asia, and China is more common in southeastern coast.China has 110,000 people to die from liver cancer every year, and wherein the male sex 80,000, and the women 30,000, accounts for whole world PLC mortality number 45%.

The Hazard Factor that cause liver cancer are a lot, and China is caused that by hepatitis b virus infected wherein the hepatitis B patient of 25%-30% can develop into liver cirrhosis and then develop into liver cancer.In recent years, Chinese scholars has been done a large amount of research to the Hazard Factor of liver cancer, finds that genetic predisposition is the internal cause of onset of liver cancer, and the variation of genes involved can cause the unusual of corresponding expression of enzymes, causes individual to poisonous substance or carcinogens generation untoward reaction.

Nearest research shows, the generation of liver cancer and EPHX1, GSTM1, GSTT1, four inheritance susceptible genes of CYP1A1 are closely related.EPHX1 is the Epoxide hydrolase encoding sox, belongs to II phase metabolic enzyme, and the major function of this enzyme is the various epoxide hydrolysis of catalysis, and the material that forms solubility excretes.Epoxide is easy to and DNA, protein and other covalent attachment, causes cytotoxicity or transgenation.EPHX1 Tyr113His mononucleotide polymorphism site is C/T polymorphic position point mutation on No. 3 exon of EPHX1 gene; The genotype of this polymorphic site has three kinds of CC, CT, TT, CC (His/His) and CT (His/Tyr) risk genes type carrier, and the 113rd amino acid of its EPHX1 gene coded protein becomes His (H) by Tyr (Y); This enzymic activity is descended; Thereby the epoxide hydrolysis rate is reduced, cause the dna single splitting of chain, increase the susceptibility of liver cancer.

Glutathione S-transferase (GSTs) belongs to II phase metabolic enzyme; Can promote that various electrophilic compounds (comprising environmental carcinogen and mesostate thereof) combine with gsh; Forming compound soluble in water gets rid of external; Be and poisonous substance or the relevant enzyme of carcinogenic metabolic detoxification that GSTM1 and GSTT1 and tumorigenic relation are the closest in the known human GSTs family.GSTM1 has present and two allelotrope of null, and wherein present has normal enzymic activity, and the null gene is meant and is called blank genotype again by the homozygote of structure gene disappearance, lacks the GSTM1 enzymic activity.GSTT1 gene polymorphic phenomenon and GSTM1 are similar, also have the absence type gene that lacks the GSTT1 enzymic activity.Normal GSTM1 and GSTT1 enzymic activity possibly reach through the close electro ultrafiltration that promotes carcinogen and protect the susceptible tissue from intravital eliminating; Prevent somatic dna mutation; And the pure and mild disappearance of GSTM1 or GSTT1 gene may reduce or lose organism metabolism and discharge carcinogenic function, thereby it is dangerous to have bigger tumour.Therefore, GSTM1, GSTT1 genetically deficient can be used as the important risk factor that liver cancer takes place.

Cytochrome P450 family gene CYP1A1 also is that relevant important gene takes place liver cancer; The carcinogenic main enzyme Cytochrome P450 1A1 of a kind of important activation polycyclic aromatic hydrocarbons of this genes encoding; This enzyme is one of metabolic enzyme important in the liver microsomes; Its unconventionality expression can impel a large amount of carcinogenss in liver, to assemble, and the CYP1A1 that is activated can change the organic substance in the multiple environment into cytotoxin or other carcinogenic substances, thereby increases the danger that cancer takes place.Big quantity research shows that the interaction of CYP1A1 gene and environmental factors can influence the onset risk of the multiple cancer that comprises liver cancer.Such as; When CYP1A1 zymoprotein 462 amino acids become Val by Ile, the increased activity of CYP1A1 enzyme, the epoxide concentration that causes having carciongenic potency increases; Cause damage and the chromosome aberration of DNA, cause comprising the onset risk of the kinds of tumors of liver cancer.

In sum; The important incidence relation that has in view of EPHX1, GSTM1, GSTT1 and CYP1A1 gene and liver cancer; Can be as the potential indication of prediction and examination liver cancer; Through the detection of these liver cancer susceptibilities, can play the vital role that can not be ignored at aspects such as prevention and treatment liver cancer and reduction liver cancer incidences.

Summary of the invention

The present invention is based on Tyr113His on the EPHX1 gene (rs1051740); Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present); 4 mononucleotide polymorphism site genotype of Ile462Val on the CYP1A1 gene (rs1048943) can be used as on the basis of the risk factor of assessing onset of liver cancer, develop a kind of liver cancer susceptibility detection kit.

This test kit comprises:

Detect Tyr113His (rs1042522) on the EPHX1 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and 4 genotypic Auele Specific Primers of mononucleotide polymorphism site of Ile462Val on the CYP1A1 gene (rs1048943) are to reaching the dna sequencing primer;

PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);

PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);

Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).

The component and the content of test kit of the present invention comprise:

PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.

PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.

Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The use of embodiment 1. detection kit

1, extracting dna profiling

Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.

2, pcr amplification reaction

Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:

(1) EPHX1 (Tyr113His) forward primer: 5 ' CCACCTTTGGAGGACAGC3 '

EPHX1 (Tyr113His) reverse primer: 5 ' CATTGGACTGGATGGTGC3 '

(2) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(3) GSTT1 (Null/Present) forward primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

GSTT1 (Null/Present) reverse primer: 5 ' TCACCGGATCATGGCCAGCA3 '

(4) CYP1A1 (Ile462Val) forward primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

CYP1A1 (Ile462Val) reverse primer: 5 ' CAGGCTGAACCTTAGACCACA3 '

The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;

Reaction conditions is: 94 ℃ of preparatory sex change 5min, and 94 ℃ of sex change 1min then, 50 ℃ of 1min annealing, 72 ℃ are extended 50s, and after 35 circulations, 72 ℃ were extended 10 minutes.

3, pcr amplification product purifying

Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.

4, dna sequencing reaction

Use the sequencing reaction assembly in the detection kit, wherein, contain following dna sequencing primer:

(1) EPHX1 (Tyr113His) sequencing primer: 5 ' CCACCTTTGGAGGACAGC3 '

(2) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

(3) GSTT1 (Null/Present) sequencing primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

(4) CYP1A1 (Ile462Val) sequencing primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.

Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.

5, gene type assay

The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.

The gene of embodiment 2. examination liver cancer risk population does not have wound and detects service

1. there is not the wound sampling

Instruct the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor and carry out the oral mucosa epithelial cell sampling, sample is preserved with cell-preservation liquid normal temperature.

2.DNA extracting

Adopt phenol chloroform method that the oral mucosa cell that collects is carried out the DNA extracting.

3. genotype detection

Use test kit provided by the invention; To Tyr113His (rs1051740) on the EPHX1 gene of person under inspection's genomic dna; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and 4 mononucleotide polymorphism sites of Ile462Val on the CYP1A1 gene (rs1048943) carry out dna sequencing respectively, confirm the genotype in these 4 SNPs sites.

4. onset of liver cancer high risk population bioinformatic analysis and risk assessment

Through genotypic bioinformatic analysis of person under inspection SNPs and risk evaluation model are identified, provide liver cancer susceptibility risk assessment analysis report list.Specified Tyr113His (rs1051740) on the person under inspection EPHX1 gene in the report; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and 4 SNP locus genes of Ile462Val on the CYP1A1 gene (rs1048943) detect information, liver cancer risk evaluation result and prevent and treat scheme.According to person under inspection's risk class, specifying and understand liver cancer susceptibility by the doctor to the person under inspection does not have wound examining report list.

Claims (6)

1. a nothing that detects liver cancer susceptibility is created detection kit; Its moity is: detect mononucleotide polymorphism site Tyr113His (rs1051740) on the EPHX1 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), genotypic PCR special primer of mononucleotide polymorphism site Ile462Val (rs1048943) and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, ddH on the CYP1A1 gene ₂O etc.

2. test kit according to claim 1; Its characteristics are: described Auele Specific Primer is to being meant to mononucleotide polymorphism site Tyr113His (rs1051740) on the EPHX1 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), mononucleotide polymorphism site Ile462Val (rs1048943) on the CYP1A1 gene, and the primer of dna fragmentation that can specific amplification goes out to comprise 4 SNPs sites is right.

3. test kit according to claim 1; Its characteristics are: described dna sequencing primer is to Tyr113His (rs1051740) on the EPHX1 gene; Whether the GSTM1 gene lacks (Null/Present); Whether the GSTT1 gene lacks (Null/Present), and mononucleotide polymorphism site Ile462Val (rs1048943) on the CYP1A1 gene can go out the dna sequencing primer of above-mentioned 4 SNPs loci gene types through dna sequencing technology specific detection.

4. according to the test kit shown in the claim 1, its 4 pairs of contained specific primer sequences are following:

(1) EPHX1 (Tyr113His) forward primer: 5 ' CCACCTTTGGAGGACAGC3 '

EPHX1 (Tyr113His) reverse primer: 5 ' CATTGGACTGGATGGTGC3 '

(2) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(3) GSTT1 (Null/Present) forward primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

GSTT1 (Null/Present) reverse primer: 5 ' TCACCGGATCATGGCCAGCA3 '

(4) CYP1A1 (Ile462Val) forward primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

CYP1A1 (Ile462Val) reverse primer: 5 ' CAGGCTGAACCTTAGACCACA3 '

5. test kit according to claim 1 is characterized in that, 4 contained dna sequencing primer sequences are following:

(1) EPHX1 (Tyr113His) sequencing primer: 5 ' CCACCTTTGGAGGACAGC3 '

(2) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

(3) GSTT1 (Null/Present) sequencing primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

(4) CYP1A1 (Ile462Val) sequencing primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:

(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH ₂O 19.175ul.

(2) PCR product purification system: 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, ddH ₂O 3.875ul.

(3) sequencing reaction system: 25%BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mMEDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH ₂O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.