CN102690883A - Noninvasive test kit of susceptibility gene of lung squamous carcinoma - Google Patents

Abstract

The invention provides a noninvasive test kit of a susceptibility gene of lung squamous carcinoma. The kit comprises a specific primer of two single nucleotide polymorphism locus gene types for detecting whether Lys75Gln and GSTT1 genes on an XPD (Xeroderma Pigmentosum group D) gene are lacked or not (Present/Null), a DNA (Deoxyribonucleic Acid) sequencing primer, a PCR reaction assembly, a PCR product purifying assembly, a DNA sequencing reaction assembly and the like. The kit is used for estimating a risk grade for a subject suffering the lung squamous carcinoma through detecting the gene types of the two single nucleotide polymorphism loca which are relative to the lung squamous carcinoma; and the subject is guided to prevent the happening of the lung squamous carcinoma in a targeted manner from a gene level according to a gene detection result of each subject, so as to reduce the morbidity of the subject. A sampling method of the invention is as follows: an oral mucosa cell is sampled, the purposes of being painless and noninvasive and avoiding crossed infection can be realized. A sequencing detection result is accurate and reliable, a special imported instrument with expensive cost does not need to be purchased, and the method is easy to popularize and spread.

Description

The lung squamous cancer tumor susceptibility gene does not have the wound detection kit

Technical field

The invention belongs to biology field; Relate to medical science and biotechnology; Be specifically related to a kind of lung squamous cancer kit for detecting susceptibility genes, according to the risk class of detected result from the morbidity of gene aspect assessment lung squamous cancer, and the direction of conduct prevention and treatment lung squamous cancer instructs.

Background technology

Lung squamous cancer is called squamous cell cancer again, comprises carcinoma sarcomatodes, is modal type, accounts for the 40%-50% of primary lung cancer.Lung squamous cancer is more common in elderly men, and is very close with the smoking relation.The most patients of the treatment of lung squamous cancer have been lung cancer late periods when making a definite diagnosis, cough, cough pectoralgia, become thin, anaemia etc. is the main clinical manifestation of small cell lung cancer.This disease is a multigenic disease, discovers, and the XPD gene, the GSTT1 gene has very important effect in lung squamous cancer change process, and this provides scientific basis for the high risk population who detects the lung squamous cancer morbidity in advance.

Xeroderma pitmentosum gene (XPD) is that a kind of important dna damage is repaired gene, participates in the reparation of DNA nucleotide excision.Have polymorphum in the several nucleotide sequences of XPD gene, wherein the 751Lys/Gln polymorphum is more common.When the 751st Lys of XPD gene → Gln, the dna damage repair ability reduces, the genome stability decreases, and the ability of opposing carcinogenic substance or other extraneous factor destructions reduces, and has increased the pathogenesis of cancer risk.

Molecular biology research shows, carries the individual whole genetically deficient and the loss of function of GSTT1 absence type, thereby has been equivalent to increase the concentration of environmental toxin and carcinogenic substance, has improved the individual risk of suffering from a series of types of cancer.Research both at home and abroad shows, carries the individuality of GSTT1 absence type, and risk for lung cancer increases, and the GSTT1 absence type is one of important lung cancer inheritance susceptible factor of Chinese population.

In sum; In view of the XPD gene; The GSTT1 gene has very important effect in lung squamous cancer change process, can said gene be detected the person under inspection as the inheritance susceptible factor and at lung squamous cancer relevant gene mononucleotide loci gene type take place, and examination in time goes out to be prone to suffer from the high risk population of lung squamous cancer; Thereby prevent and treat lung squamous cancer targetedly, this has very important meaning for the sickness rate that reduces lung squamous cancer.

Summary of the invention

Based on Lys751Gln on the XPD gene; GSTT1 genetically deficient whether 2 mononucleotide polymorphism site genotype of (Present/Null) can be used as on the basis of risk factor of assessment lung squamous cancer morbidity, and the present invention provides a kind of lung squamous cancer kit for detecting susceptibility genes.

This test kit comprises:

Detect Lys751Gln on the XPD gene, GSTT1 genetically deficient whether (Present/Null) 2 genotypic Auele Specific Primers of mononucleotide polymorphism site to and the dna sequencing primer;

PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);

PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);

Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).

The component and the content of test kit of the present invention comprise:

PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.

PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.

Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The use of embodiment 1. detection kit

1, extracting dna profiling

Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.

2, pcr amplification reaction

Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:

(1) XPD (Lys751Gln) forward primer: 5 ' TCCTGCGATTAAAGGCTGTG3 '

XPD (Lys751Gln) reverse primer: 5 ' TACGGACATCTCCAAATTCATTC3 '

(2) GSTT1 (Null/Present) forward primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

GSTT1 (Null/Present) reverse primer: 5 ' TCACCGGATCATGGCCAGCA3 '

The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;

Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ prolonged in 1 minute, circulates 28 times, and last 72 ℃ of prolongations are more than 5 minutes.

3, pcr amplification product purifying

Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.

4, dna sequencing reaction

Use the sequencing reaction assembly in the detection kit, wherein, contain following dna sequencing primer:

(1) XPD (Lys751Gln) sequencing primer: 5 ' TCCTGCGATTAAAGGCTGTG3 '

(2) GSTT1 (Present/Null) sequencing primer: 5 ' TTCCTTACTGGTCCTCACATCTC3 '

The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.

Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.

5, gene type assay

The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.

2. couples of people of embodiment prevent the gene of lung squamous cancer morbidity not have the service that wound detects

1. sample and extracting DNA

Instructing the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor carries out the mouth epithelial cells sampling, adopts phenol chloroform method to carry out the DNA extracting of mouth epithelial cells

2. genotype detection

Use test kit provided by the invention, to Lys751Gln on the XPD gene of person under inspection's genomic dna, GSTT1 genetically deficient whether 2 mononucleotide polymorphism sites of (Present/Null) is carried out dna sequencing respectively, confirms the genotype in these 2 SNPs sites.

3. lung squamous cancer morbidity high risk population risk assessment

Through to the genotypic analysis of person under inspection SNPs, provide lung squamous cancer tumor susceptibility gene risk assessment analysis report list.Specified Lys751Gln on the person under inspection XPD gene in the report, GSTT1 genetically deficient whether on 2 genes of (Present/Null) the SNP locus gene detect information and genetic risk assessment result.In addition, according to person under inspection's risk class, and specify and understand the lung squamous cancer tumor susceptibility gene by the doctor to the person under inspection and do not have wound examining report list.

Claims (7)

1. a detection lung squamous cancer tumor susceptibility gene does not have the wound detection kit; It is characterized in that: detect Lys751Gln on the XPD gene, GSTT1 genetically deficient is 2 genotypic Auele Specific Primers of mononucleotide polymorphism site and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, the ddH of (Present/Null) whether ₂O etc.

2. test kit according to claim 1; It is characterized in that: described Auele Specific Primer is to being meant to Lys751Gln on the XPD gene; GSTT1 genetically deficient is 2 mononucleotide polymorphism sites of (Present/Null) whether, and the primer of dna fragmentation that can specific amplification goes out to comprise these 2 SNPs sites is right.

3. test kit according to claim 1; It is characterized in that: described dna sequencing primer is to Lys751Gln on the XPD gene; GSTT1 genetically deficient whether (Present/Null) 2 mononucleotide polymorphism sites and design, can go out the dna sequencing primer of above-mentioned 2 SNPs loci gene types through dna sequencing technology specific detection.

4. according to the test kit shown in the claim 1, it is characterized in that 2 pairs of contained specific primer sequences are following:

(1) XPD (Lys751Gln) forward primer: 5'TCCTGCGATTAAAGGCTGTG3'

XPD (Lys751Gln) reverse primer: 5'TACGGACATCTCCAAATTCATTC3'

(2) GSTT1 (Null/Present) forward primer: 5'TTCCTTACTGGTCCTCACATCTC3'

GSTT1 (Null/Present) reverse primer: 5'TCACCGGATCATGGCCAGCA3'.

5. test kit according to claim 1 is characterized in that, 2 contained dna sequencing primer sequences are following:

(1) XPD (Lys751Gln) sequencing primer: 5'TCCTGCGATTAAAGGCTGTG3'

(2) GSTT1 (Present/Null) sequencing primer: 5'TTCCTTACTGGTCCTCACATCTC3'.

6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:

(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH ₂O 19.175ul.

(2) PCR product purification system: 1 U/ul SAP enzyme 0.75ul, 10 U/ul ExoI enzyme 0.375ul, ddH ₂O 3.875ul.

(3) sequencing reaction system: 25% BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mM EDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH ₂O 2ul.

7. this test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.