CN102586468A - Noninvasive detection kit for susceptibility gene of bladder cancer - Google Patents

Abstract

The invention provides a noninvasive detection kit for detecting a susceptibility gene of bladder cancer. The noninvasive detection kit comprises a specific primer and a DNA (Deoxyribose Nucleic Acid) sequencing primer for detecting whether a GSTM1 (Glutathiones Tansferase M1) gene is null/present or not , the single nucleotide polymorphism of a G252A locus of a TNF (Tumor Necrosis Factor)-beta gene, a PCR (Polymerase Chain Reaction) reaction assembly, a PCR product purification assembly, a DNA sequencing assembly and the like. According to the kit disclosed by the invention, the risk level of bladder cancer disease of a subject is assessed by detecting genotypes of two single nucleotide polymorphism locuses which are closely related with the bladder cancer and finally, the subject is guided to specifically prevent the bladder cancer from the gene level according to the gene detection result of each subject and the disease probability of the bladder cancer is reduced. According to the sampling method disclosed by the invention, oral mucosa cells are used as samples, no pains or invasion occurs and the crossed infection is avoided. The sequencing detection result is accurate and is reliable; imported special instruments with high price can be omitted; and the method is easy for popularization and generalization.

Description

The bladder cancer tumor susceptibility gene does not have the wound detection kit

Technical field

The invention belongs to biology field; Relate to medical science and biotechnology; Be specifically related to a kind of bladder cancer kit for detecting susceptibility genes, according to the risk class of detected result from the morbidity of gene aspect assessment bladder cancer, and the direction of conduct prevention and treatment bladder cancer instructs.

Background technology

In the world wide, bladder cancer is ranked the 4th of the most common solid tumor of the male sex, ranks the 7th in the women, and the bladder cancer patients of annual new diagnosis is above 350000.In China, bladder cancer is still modal urinary system malignant tumour at present, and in recent years, the sickness rate of China's part city bladder cancer presents steadily increasing trend.In the domestic big city like Beijing, Shanghai, Tianjin, the sickness rate of bladder cancer has ranked the 6th of male sex's common cancer, and mortality ratio is ranked the 7th.Bladder cancer is sent out age 51-70 year well, and onset peak is 65 years old.We can say that the generation of bladder cancer and development are multifactor, a multistage synthesis result, and be closely related with environmental factors, inherited genetic factors and their interaction etc.

There is research to confirm that multiple exogenous compounds is a procarcinogen, needs to change ultimate carcinogens competence exertion carcinogenesis into through the metabolic activation of internal metabolism enzyme.Glutathione S-transferase (GST) is the II phase metabolic enzyme of participating in the carcinogenic metabolic detoxification process of multiple electrophilic, has found that the GST polymorphum can influence the individual susceptibility of suffering from bladder cancer.The analysis revealed of relevant gst gene polymorphum, the blank genotype of GSTT1 (GSTT1-null) carry the ill risk of colony's bladder cancer and carry colony than normal GSTT1 genotype (GSTT1-present) and increase 54%.Result of study shows that also there are positive correlation in the pathological grading and the clinical stages of GSTT1-null genotype and bladder cancer, and the frequency that the bladder cancer patients that the bladder cancer tumor grade is low more, wellability is strong is more carried the blank genotype of GSTT1 (GSTT1-null) is high more.This possibly be because blank genotype (GSTT1-null) carrier of GSTT1 body glutathion inside transferase active reduces; Make II phase metabolic detoxification reaction efficiency reduction in the body, exogenous carcinogens or mesostate accumulate in vivo, thereby body tumour incidence is increased; And carry the bladder cancer patients of said gene type; Genotype frequency is high more, and malignancy of tumor degree and invasive depth are high more, and prognosis is often poorer.

TNF has multiple bioactive important proinflammatory cytokine in the body, mainly by secretions such as LPS activated monokaryon, scavenger cell and lymphocytes.That TNF has is antiviral, induce inflammation and immunoloregulation function widely, and the most outstanding is its powerful antitumor characteristic.Thereby, particularly in the incidence and development process of malignant tumour, play an important role at autoimmune disorder, infection.Research shows that TNF-β G252A mononucleotide loci polymorphism and bladder cancer susceptibility are closely related, so can be used as one of Hazard Factor of bladder cancer susceptibility.

In sum; Seeing that GSTM1 and TNF-β have very important effect in bladder canceration process; Can said gene be detected the person under inspection as the inheritance susceptible factor and relevant gene mononucleotide loci gene type take place in bladder cancer; Examination in time goes out to be prone to suffer from the high risk population of bladder cancer, thereby prevents and treat bladder cancer targetedly, and this has very important meaning for the sickness rate that reduces bladder cancer.

Summary of the invention

Whether lack (Null/Present) based on detecting the GSTM1 gene; 2 mononucleotide polymorphism site genotype of the G252A of TNF-β gene can be used as on the basis of the risk factor of assessing the bladder cancer morbidity, and the present invention provides a kind of bladder cancer kit for detecting susceptibility genes.

This test kit comprises:

Detect the GSTM1 gene and whether lack (Null/Present), 2 genotypic Auele Specific Primers of mononucleotide polymorphism site of the G252A of TNF-β gene are to reaching the dna sequencing primer;

PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);

PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);

Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).

The component and the content of test kit of the present invention comprise:

PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.

PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.

Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The use of embodiment 1. detection kit

1, extracting dna profiling

Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.

2, pcr amplification reaction

Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:

(1) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(2) TNF-β (G252A) forward primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '

TNF-β (G252A) reverse primer: 5 ' TTCGTGCTTTGGACTACCG3 '

The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;

Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ prolonged in 1 minute, circulates 28 times, and last 72 ℃ of prolongations are more than 5 minutes.

3, pcr amplification product purifying

Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.

4, dna sequencing reaction

Use the sequencing reaction assembly in the detection kit; Wherein, contain following dna sequencing primer: (1) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 ' (2) TNF-β (G252A) sequencing primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '

The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.

Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.

5, gene type assay

The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.

2. couples of people of embodiment prevent the gene of bladder cancer morbidity not have the service that wound detects

1. sample and extracting DNA

Instructing the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor carries out the mouth epithelial cells sampling, adopts phenol chloroform method to carry out the DNA extracting of mouth epithelial cells

2. genotype detection

Use test kit provided by the invention, whether the GSTM1 gene of person under inspection's genomic dna is lacked (Null/Present), 2 mononucleotide polymorphism sites of TNF-β gene G252A carry out dna sequencing respectively, confirm the genotype in these 2 SNPs sites.

3. bladder cancer morbidity high risk population risk assessment

Through to the genotypic analysis of person under inspection SNPs, provide bladder cancer tumor susceptibility gene risk assessment analysis report list.Specified person under inspection GSTM1 gene in the report and whether lacked (Null/Present), the SNP locus gene detects information and genetic risk assessment result on 2 genes of TNF-β gene G252A.In addition, according to person under inspection's risk class, and specify and understand the bladder cancer tumor susceptibility gene by the doctor to the person under inspection and do not have wound examining report list.

Claims (6)

1. a detection bladder cancer tumor susceptibility gene does not have the wound detection kit; It is characterized in that: detect the GSTM1 gene and whether lack (Null/Present), the Auele Specific Primer of the SNP in the G252A site of TNF-β gene and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, ddH ₂O etc.

2. test kit according to claim 1; It is characterized in that: described Auele Specific Primer is to being meant to the GSTM1 gene whether lack (Null/Present); 2 mononucleotide polymorphism sites of the G252A of TNF-β gene, the primer of dna fragmentation that can specific amplification goes out to comprise these 2 SNPs sites is right.

3. test kit according to claim 1; It is characterized in that: described dna sequencing primer is whether to lack (Null/Present) to the GSTM1 gene; 2 mononucleotide polymorphism sites of the G252A of TNF-β gene and designing can go out the dna sequencing primer of above-mentioned 2 SNPs loci gene types through dna sequencing technology specific detection.

4. according to the test kit shown in the claim 1, it is characterized in that 2 pairs of contained specific primer sequences are following:

(1) GSTM1 (Null/Present) forward primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

GSTM1 (Null/Present) reverse primer: 5 ' GTTGGGCTCAAATATACGGTGG3 '

(2) TNF-β (G252A) forward primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '

TNF-β (G252A) reverse primer: 5 ' TTCGTGCTTTGGACTACCG3 '.

5. test kit according to claim 1 is characterized in that, 2 contained dna sequencing primer sequences are following:

(1) GSTM1 (Null/Present) sequencing primer: 5 ' GAACTCCCTGAAAAGCTAAAGC 3 '

(2) TNF-β (G252A) sequencing primer: 5 ' CAGAAGGAGGAGGTGTAGGGT3 '.

6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:

(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH ₂O 19.175ul.

(2) PCR product purification system: 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, ddH ₂O 3.875ul.

(3) sequencing reaction system: 25% BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mMEDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH ₂O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.