CN102559902A - Noninvasive detection kit for susceptibility gene for small cell lung cancer - Google Patents

Abstract

The invention provides a noninvasive detection kit for susceptibility gene for small cell lung cancer. The reagent kit comprises specific primers, DNA sequencing primers, PCR reaction components, purification components for PCR products, DNA sequencing reaction components for detecting genotypes of three mononucleotide polymorphism sites of T-460C on VEGF gene, Ile462Val on CYP1A1 gene and C677T on MTHFR gene. The reagent kit of the invention evaluates a risk level of suffering from small cell lung cancer of subjects by detecting genotypes of three mononucleotide polymorphism sites closely related with small cell lung cancer generation; the subjects can be instructed on a gene level to pertinently prevent small cell lung cancer generation according to gene detection results of every subject and reduces incidence of small cell lung cancer. In the invention, oral cavity mucous membrane cell is sampled, which is painless, noninvasive and avoids cross infection; sequencing results are accurate and reliable without using expensive special instruments imported; the method of the invention is easily popularized.

Description

The small cell lung cancer tumor susceptibility gene does not have the wound detection kit

Technical field

The invention belongs to biology field; Relate to medical science and biotechnology; Be specifically related to a kind of small cell lung cancer kit for detecting susceptibility genes, according to the risk class of detected result from the morbidity of gene aspect assessment small cell lung cancer, and the direction of conduct prevention and treatment small cell lung cancer instructs.

Background technology

Lung cancer is modal lung primary malignant tumor, and most lung cancer originate from the bronchial mucosa epithelium, so also claim lung bronchogenic carcinoma.Over nearly more than 50 years, countries in the world are industrially developed country particularly, and the M & M of lung cancer all rises rapidly, and the andropathy philtrum lung cancer of dying from cancer ranks first, and the women is only second to mammary cancer death and accounts for second, mostly occurs at 45-75 year age bracket.Before more than 40 year, in China performed surgical operation the patient who treats because of pulmonary disorder, the overwhelming majority was a pneumonia, and taking second place is pneumonia infection diseases such as bronchiectasis, pulmonary abscess, and the lung cancer case is few in number.Over nearly more than 30 years, lung cancer increases gradually in the case of pulmonectomy, leaps to the first.Shanghai City malignant tumour statistical information shows that in the male cancer case, the lung cancer morbidity rate sharply increases, and occupies first.Lung cancer is divided two big types clinically: small cell lung cancer (small cell lung carcinoma, SCLC) and nonsmall-cell lung cancer (non-small cell lung carcinoma, NSCLC).

The small cell lung cancer sickness rate accounts for the 10.7%-21.5% of lung cancer sum; The cancer cells doubling time is 33 days; Therefore cancer cells can be invaded lymphoglandula and little blood vessel in early days; Lymph or hematogenous metastasis kitchen range take place, its biological behaviour and cytology characteristic have determined the patient to shift early, prognosis is relatively poor, be prone to recurrence, lifetime weak point.

Angiogenic growth is the prerequisite of tumor proliferation, infiltration and transfer, and tumour is grown to diameter 2-3mm, cell count greater than 10 ⁷During the left and right sides, must there be newborn capillary vessel and little angiogenic growth to provide nutritive substance and oxygen to keep its growth.Research is illustrated in angiogenic growth more in the patients with lung cancer and the certain dependency of the relatively poor existence of its prognosis, and capillary vessel in the tumor tissues and little angiogenic growth are many more, and tumor growth is fast more.And in the process of tumor tissues medium vessels growth; Some cytokines such as fibroblast growth factor, vascular endothelial growth factor (VEGF) etc. have all played vital role; Wherein VEGF is the short vascular endothelial growth factor of recent a kind of high degree of specificity of finding; Claim vascular permeability factor again, in the tumor vessel stroke, playing the part of important effect.This gene T-460C site T causes the VEGF gene expression dose to raise to the C sudden change, stimulates vasculogenesis to increase, and has improved the onset risk of small cell lung cancer, so the polymorphic detection that can be used for the small cell lung cancer susceptibility in this site.

CYP1A1 mainly expresses in lung tissue; The aryl hydrocarbon hydroxylase of coding; Be the main enzyme of polycyclic arene compound such as benzopyrene (B (a) P) in the activation tobacco, and product benzopyrene-glycol epoxide (BPDE) carinogenicity of B (a) P after activating through I phase metabolic reaction is stronger.The polymorphum of CYP1A1 mainly shows the Exon7 polymorphic site; The conversion of A → G has appearred in its 4889th position; 462nd the Isoleucine (Ile) relevant with this proteic heme land substituted, so it is polymorphic to be called Ile/Val again by Xie Ansuan (Val).Ile/Val is polymorphic to have three kinds of genotype: Ile/Ile (wild-type), Ile/Val (sudden change heterozygous) and Val/Val (it is homozygous to suddenly change).The enzymic activity that the CYP1A1 activity ratio normal gene that the polymorphic mutator gene of Ile462Val is expressed is expressed obviously increases, and can produce the CYP1A1 enzyme of high induced activity, and the polycyclic arene compound active rate is accelerated, and causes the occurrence risk of multiple cancer to increase.Therefore this site can be used as the Genetic Detection factor of lung cancer susceptibility.

MTHFR full name 5, the 10-MTHFR plays important effect in the folic acid metabolism process.In case research shows that folic acid and the vital role of metabolic intermediate in the organism physiology biochemical reaction thereof have determined body generation folic acid defective or folic acid metabolism enzyme defect; Possibly cause the cell cycle unusual; Multiple biochemical abnormal responses such as DNA, protein methylation reaction are unusual, the DNA base can't normally be synthesized, and directly or indirectly cause the generation of newborn infant's neural tube defect and adult cancer, cardiovascular and cerebrovascular diseases.Discover that the polymorphum in MTHFR 677 sites is the active important factors that influence this enzyme.The enzymic activity of carrying the allelic individuality of MTHFR 677T is to carry about 45% of wild-type; Influenced folic acid metabolism; Cause the increase of a series of disease incidence risks, cause the lung cancer morbidity risk to increase, this site can be used as the tumor susceptibility gene detection site of small cell lung cancer.

In sum; In view of VEGF, CYP1A1, MTHFR has very important effect in small cell lung cancer change process; Can said gene be detected the person under inspection as the inheritance susceptible factor and relevant gene mononucleotide loci gene type take place at small cell lung cancer; Examination in time goes out to be prone to suffer from the high risk population of small cell lung cancer, thereby prevents and treat small cell lung cancer targetedly, and this has very important meaning for the sickness rate that reduces small cell lung cancer.

Summary of the invention

Based on T-460C on the VEGF gene; Ile462Val on the CYP1A1 gene; 3 of C677T mononucleotide polymorphism site genotype can be used as on the basis of the risk factor of assessing the small cell lung cancer morbidity on the mthfr gene, and the present invention provides a kind of small cell lung cancer kit for detecting susceptibility genes.

This test kit comprises:

Detect T-460C on the VEGF gene, Ile462Val on the CYP1A1 gene, 3 of C677T genotypic Auele Specific Primers of mononucleotide polymorphism site are to reaching the dna sequencing primer on the mthfr gene;

PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);

PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);

Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).

The component and the content of test kit of the present invention comprise:

PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.

PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.

Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The use of embodiment 1. detection kit

1, extracting dna profiling

Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.

2, pcr amplification reaction

Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:

(1) VEGF (T-460C) forward primer: 5 ' TGTTTGGGAGGTCAGAAATAGG3 '

VEGF (T-460C) reverse primer: 5 ' GGGAGCAGGAAAGTGAGGTTA3 '

(2) CYP1A1 (Ile462Val) forward primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

CYP1A1 (Ile462Val) reverse primer: 5 ' CAGGCTGAACCTTAGACCACA3 '

(3) MTHFR (C677T) forward primer: 5 ' CATCCCTCGCCTTGAACAG 3 '

MTHFR (C677T) reverse primer: 5 ' CAGACACTGTTGCTGGGTTTT 3 '

The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;

Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ prolonged in 1 minute, circulates 28 times, and last 72 ℃ of prolongations are more than 5 minutes.

3, pcr amplification product purifying

Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.

4, dna sequencing reaction

Use the sequencing reaction assembly in the detection kit, wherein, contain following dna sequencing primer:

(1) VEGF (T-460C) sequencing primer: 5 ' TGTTTGGGAGGTCAGAAATAGG3 '

(2) CYP1A1 (Ile462Val) sequencing primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

(3) MTHFR (C677T) sequencing primer: 5 ' CATCCCTCGCCTTGAACAG 3 '

The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.

On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2mi n, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.

Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.

5, gene type assay

The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.

2. couples of people of embodiment prevent the gene of small cell lung cancer morbidity not have the service that wound detects

1. sample and extracting DNA

Instructing the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor carries out the mouth epithelial cells sampling, adopts phenol chloroform method to carry out the DNA extracting of mouth epithelial cells

2. genotype detection

Use test kit provided by the invention; To T-460C on the VEGF gene of person under inspection's genomic dna; Ile462Val on the CYP1A1 gene, 3 of C677T mononucleotide polymorphism sites carry out dna sequencing respectively on the mthfr gene, confirm the genotype in these 3 SNPs sites.

3. small cell lung cancer morbidity high risk population risk assessment

Through to the genotypic analysis of person under inspection SNPs, provide small cell lung cancer tumor susceptibility gene risk assessment analysis report list.Specified T-460C on the person under inspection VEGF gene in the report, Ile462Val on the CYP1A1 gene, on the mthfr gene on 3 of C677T genes the SNP locus gene detect information and genetic risk assessment result.In addition, according to person under inspection's risk class, and specify and understand the small cell lung cancer tumor susceptibility gene by the doctor to the person under inspection and do not have wound examining report list.

Claims (6)

1. a detection small cell lung cancer tumor susceptibility gene does not have the wound detection kit; It is characterized in that: detect T-460C on the VEGF gene; Ile462Val on the CYP1A1 gene, 3 of C677T genotypic Auele Specific Primers of mononucleotide polymorphism site and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, ddH on the mthfr gene ₂O etc.

2. test kit according to claim 1; It is characterized in that: described Auele Specific Primer is to being meant to T-460C on the VEGF gene; Ile462Val on the CYP1A1 gene; 3 of C677T mononucleotide polymorphism sites on the mthfr gene, the primer of dna fragmentation that can specific amplification goes out to comprise these 3 SNPs sites is right.

3. test kit according to claim 1; It is characterized in that: described dna sequencing primer is to T-460C on the VEGF gene; Ile462Val on the CYP1A1 gene; 3 of C677T mononucleotide polymorphism sites on the mthfr gene and designing can go out the dna sequencing primer of above-mentioned 3 SNPs loci gene types through dna sequencing technology specific detection.

4. according to the test kit shown in the claim 1, it is characterized in that 3 pairs of contained specific primer sequences are following:

(1) VEGF (T-460C) forward primer: 5 ' TGTTTGGGAGGTCAGAAATAGG3 '

VEGF (T-460C) reverse primer: 5 ' GGGAGCAGGAAAGTGAGGTTA3 '

(2) CYP1A1 (Ile462Val) forward primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

CYP1A1 (Ile462Val) reverse primer: 5 ' CAGGCTGAACCTTAGACCACA3 '

(3) MTHFR (C677T) forward primer: 5 ' CATCCCTCGCCTTGAACAG 3 '

MTHFR (C677T) reverse primer: 5 ' CAGACACTGTTGCTGGGTTTT 3 '

5. test kit according to claim 1 is characterized in that, 3 contained dna sequencing primer sequences are following:

(1) VEGF (T-460C) sequencing primer: 5 ' TGTTTGGGAGGTCAGAAATAGG3 '

(2) CYP1A1 (Ile462Val) sequencing primer: 5 ' CTTGCCTGTCCTCTATCCTTTG3 '

(3) MTHFR (C677T) sequencing primer: 5 ' CATCCCTCGCCTTGAACAG 3 '

6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:

(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH ₂O 19.175ul.

(2) PCR product purification system: 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, ddH ₂O 3.875ul.

(3) sequencing reaction system: 25%BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mMEDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH ₂O2ul.

This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.