CN104404044B - Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction - Google Patents
Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction Download PDFInfo
- Publication number
- CN104404044B CN104404044B CN201410727064.1A CN201410727064A CN104404044B CN 104404044 B CN104404044 B CN 104404044B CN 201410727064 A CN201410727064 A CN 201410727064A CN 104404044 B CN104404044 B CN 104404044B
- Authority
- CN
- China
- Prior art keywords
- seq
- myocardial infarction
- polymorphic site
- anril
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to biotechnology center flesh infarct related gene technical field, and in particular to susceptible relevant with myocardial infarctionANRILThe detection method of gene extron sub-district mononucleotide polymorphic site and its application.The present invention provides a kind of and relevant gene of myocardial infarctionANRILAnd its polymorphic site（Rs10965215 and rs10738605）And the polymorphic method is detected, and the prevention in myocardial infarction, auxiliary diagnosis and the purposes for the treatment of etc..Utilize the provided by the invention and relevant gene of myocardial infarction and its nucleotide sequence of polymorphic site, build the kit that genetic diagnosis are carried out to myocardial infarction, it can be applied to the auxiliary diagnosis of myocardial infarction and whether the neurological susceptibility with myocardial infarction judged to individual, be conducive to prevention, the early diagnosis and therapy of myocardial infarction.
Description
Technical field
The present invention relates to biotechnology center flesh infarct related gene technical field, and in particular to the susceptible phase of myocardial infarction
CloseANRILThe detection method of gene extron sub-district mononucleotide polymorphic site and its application.
Background technology
Myocardial infarction（coronary artery disease）It is that current China's human adult heart disease is in hospital and dead first
Position reason, its morbidity and mortality are still in rising trend.The estimated the year two thousand thirty China's heart of one large-scale retrospective study
Flesh myocardial infarction patients will increase to 23,000,000.With the quickening of China human mortality aging trend, the change of people life style and dynamic
Pulse atherosclerosis Related Risk Factors continue to increase, and the senile angiocardiopathy such as myocardial infarction will also be in continue ascendant trend,
And as one of important diseases for threatening China's public health.The myocardial infarction Major Risk Factors having confirmed at present include：
Hypertension, smoking, dyslipidemia, diabetes, overweight and fat, age and gender etc..Research in recent years is found, a few one
Obvious family history is often shown in body, prompts inherent cause to play a significant role during myocardial infarction is induced.Monokaryon
Nucleotide polymorphism（Single nucleotide polymorphism, SNP）It is to influence individual to the important of disease inheritance susceptible
Inherent cause.
SNP refers in genomic level by the DNA sequence polymorphism caused by single nucleotide acid variation.SNP be ethnic group it
Between, one of the physical basis of heredity of interindividual variation.The theoretical foundation of SNP researchs is allelic association, it refers to disease
The marker allele incidence of character significantly sexually revises, and represents with the relevant allele of disease trait in random occur
Deviation.When a genetic marker frequency in patients significantly more than non-patient when, that is, show the mark and disease association.
Effects of the SNP played in disease gene positioning mainly includes：First, the SNP that causes a disease is found in disease localization region, it is this
The appearance of SNP may directly results in change of the gene on transcriptional level and translation skill, that is, change gene expression amount or
The composition structure of person's gene product protein, so as to cause certain disease to occur or make it that individual is easy to certain special environment
Sense.Second, SNP is as a genetic marker, with disease or phenotype close linkage.
Long-chain non-coding RNA（Long non-coding RNA, lncRNA）It is a kind of transcript length more than 200nt
Functional RNA molecule, they are generally not involved in protein coding.LncRNA is mainly after epigenetic, transcriptional control and transcription
The many levels such as regulation and control realize the regulation and control to gene expression, participate in adjusting a variety of life process such as cell Proliferation, differentiation and apoptosis,
And played a crucial role during the occurrence and development of angiocardiopathy.In recent years, lncRNA is as a kind of feature
Effect of the RNA molecule in terms of angiocardiopathy is also increasingly subject to people to pay close attention to.ANRIL (antisense noncoding
RNA in the INK4 locus, ANRIL) it is the antisense non-coding for transcribing out in INK4a-ARF-INK4b gene clusters
RNA, is the site that coronary artery disease genetic predisposition is most strong in 21 region of chromosome 9p, and closely related with myocardial infarction.
Recent research indicate that ANRIL high expression in coronary artery disease peripheral blood in patients PBMCs and atherosclerotic plaque.Pass through
Analysis to coronary artery disease peripheral blood in patients PBMCs and atherosclerotic plaque tissue equal samples, find ANRIL with
Atherosclerosis is closely related, and the rise of its expression is directly related with coincident with severity degree of condition, the expression of this prompting ANRIL
Abundance is directly related with the formation of coronary atherosclerosis.Also studies have found that,ANRILThe noncoding region SNPs of gene is such as
The risk allele of rs1333049, rs10757274, rs2383206, rs2383297 and rs10757278 can be notable
Improve the gene expression abundance of ANRIL, and and p14ARF、p15INK4bAnd p16INK4aGene expression abundance it is closely related so that in artery congee
Play a significant role in the forming process of sample hardening, and further cause coronary artery disease, prompt these SNP to pass through shadow
The expression of ANRIL is rung, and then promotes the formation and development of Coronary Atherosclerotic Plaque, and dramatically increases the hair of myocardial infarction
Sick risk.
It is above-mentioned that these are rightANRILSusceptible association study is concentrated mainly on its noncoding region SNPs with myocardial infarction.So far
It is relatedANRILThere is not been reported with the relation of myocardial infarction inheritance susceptible by the SNPs of gene extron sub-district.Non-coding RNA
Exon 1 SNPs influences its stability and expression often through directly affecting the space structure of the non-coding RNA, therefore
More there is research significance in disease-susceptible humans.
The content of the invention
It is an object of the present invention in view of the deficiencies of the prior art, there is provided with the susceptible relevant ANRIL of myocardial infarction
Gene.
The second object of the present invention is in view of the deficiencies of the prior art, there is provided with the susceptible relevant ANRIL of myocardial infarction
The detection method of gene extron sub-district mononucleotide polymorphic site.
The third object of the present invention is in view of the deficiencies of the prior art, there is provided susceptible related to myocardial infarction for detecting
ANRIL gene extron sub-districts mononucleotide polymorphic site primer.
The fourth object of the present invention is in view of the deficiencies of the prior art, there is provided susceptible related to myocardial infarction for detecting
ANRIL gene extron sub-districts mononucleotide polymorphic site specific probe.
The fifth object of the present invention is in view of the deficiencies of the prior art, there is provided susceptible related to myocardial infarction for detecting
ANRIL gene extron sub-districts mononucleotide polymorphic site kit.
The sixth object of the present invention is in view of the deficiencies of the prior art, there is provided with the susceptible relevant ANRIL of myocardial infarction
Whether the mononucleotide polymorphic site of gene extron sub-district in the auxiliary diagnosis to myocardial infarction and has myocardial infarction to individual
The application that neurological susceptibility is judged.
One of to achieve these goals, the present invention adopts the following technical scheme that：
Offer and the susceptible relevant ANRIL genes of myocardial infarction, it is describedANRILThe nucleotide sequence of gene has SEQ ID
NO:1 and SEQ ID NO:Sequence shown in 2；
Wherein, SEQ ID NO:In sequence shown in 1, the 269th is G；
SEQ ID NO:In sequence shown in 2, the 300th is C.
It is describedANRILThe mononucleotide polymorphic site of gene extron sub-district is：Rs10965215, its allele point to for
G/A（That is SEQ ID NO:The nucleotide of the 269th in sequence shown in 1）With it is describedANRILThe monokaryon glycosides of gene extron sub-district
Sour polymorphic site is：Rs10738605, its allele point is to for C/G（That is SEQ ID NO:The 300th in sequence shown in 2
Nucleotide）；
The mononucleotide polymorphic site rs10965215 and rs10738605 is related to the susceptible degree of myocardial infarction.
To achieve these goals two, the present invention adopts the following technical scheme that：
There is provided described above with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction
Detection method, it comprises the following steps：
Step 1, determinesANRILThe mononucleotide polymorphic site of gene extron sub-district（Rs10965215 and
rs10738605）, i.e. SEQ ID NO:The nucleotide of the 269th and SEQ ID NO in sequence shown in 1:Sequence shown in 2
In the nucleotide of the 300th；
Step 2, using PCR-ligase chain reaction（PCR-LDR）Protocols in Molecular Biology inspection
Survey is detected in sampleANRILGene extron sub-district is with the presence or absence of single nucleotide polymorphism and the class of mononucleotide polymorphic
Type.
In above-mentioned technical proposal, in the step 2, the PCR system is：Each sample carries out
Two cumulative volumes are the amplified reaction of 20ul systems, amplify SEQ ID NO respectively:1 and SEQ ID NO:Sequence shown in 2
Row, and including：Prepared genomic DNA dilution 1ul, 2mM dNTP 2ul, 3mM MgCl20.6ul, it is corresponding positive and negative
To each 1.0ul of amplimer, 1 × Buffer 2ul, Taq the archaeal dna polymerases 0.2ul, ddH of 1 unit2O 12.2ul；
The PCR program is：SEQ ID NO:The amplified reaction of sequence shown in 1 is in 95 DEG C of pre-degenerations 2
Minute, after 94 DEG C are denatured 30 seconds, 1 point of the 50 DEG C of annealing 30 seconds of progress 40, the amplification cycles of 65 DEG C of extensions 30 seconds, finally carry out 65
The filling-in of DEG C 10 minutes；SEQ ID NO:In 95 DEG C of pre-degenerations 2 minutes, 94 DEG C were denatured 30 seconds the amplified reaction of sequence shown in 2
Afterwards, 1 point of 53 DEG C of annealing of progress 40 30 seconds, the amplification cycles of 72 DEG C of extensions 30 seconds, finally carry out 72 DEG C of filling-in of 10 minutes.
In above-mentioned technical proposal, in the step 2, the ligase chain reaction system in terms of 10 μ L of total amount including：
PCR product 4ul, specific probe 1ul, 1 × Buffer 1ul, the ligase 0.05ul, ddH of 2 units2O 4ul；
The ligase chain reaction program is：Reaction carries out 40 94 DEG C of denaturation 15s after 95 DEG C of pre-degenerations 2 minutes,
The circular response of 50 DEG C of reaction 25s.
To achieve these goals three, the present invention adopts the following technical scheme that：
There is provided and be used to detect the mononucleotide described above with the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction
The primer of polymorphic site, the primer specifically include：
（1）SEQ ID NO:Sequence shown in 1（Include rs10965215）Amplimer：
Forward primer：5’- GGATGTTTTGCAGGACTATT -3’(SEQ ID NO: 3)
Reverse primer：5’- GGAATCATCACAGCATGGAC -3’(SEQ ID NO: 4)
（2）SEQ ID NO:Sequence shown in 2（Include rs10738605）Amplimer：
Forward primer：5’- TTTTCCAGTGGTGTTTCTAAATAA -3’(SEQ ID NO: 5)
Reverse primer：5’- CCTCTGATGGTTTCTTTGGAGT -3’(SEQ ID NO: 6).
To achieve these goals four, the present invention adopts the following technical scheme that：
There is provided and be used to detect the mononucleotide described above with the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction
The specific probe of polymorphic site, including following two group-specifics probe：
First group：
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）FAM probes：
5’-GTGGCAAATAGTCCTGCAAAACATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 7)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCT
CTCTTGGAATCCTTTGAAATGTC-3’ (SEQ ID NO: 8)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）A probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCT
CTTGGAATCCTTTGAAATGTT-3’ (SEQ ID NO: 9)；
Second group：
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）FAM probes：
5’-CACACCTAACAGTGATGCTTGAACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 10)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）C probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTGTACTGACTCGGGAAAGGATTCCAG-3’ (SEQ ID NO: 11)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTGTACTGACTCGGGAAAGGATTCCAC-3’ (SEQ ID NO: 12)。
To achieve these goals five, the present invention adopts the following technical scheme that：
There is provided and be used to detect and the mononucleotide polymorphic site of the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction
Kit, it is characterised in that：It is used to detect and the susceptible relevant ANRIL gene extrons of myocardial infarction including described above
The primer of the mononucleotide polymorphic site in area, and described above be used to detect and the susceptible relevant ANRIL bases of myocardial infarction
Because of the specific probe of the mononucleotide polymorphic site of exon 1.
To achieve these goals six, the present invention adopts the following technical scheme that：
There is provided and obstruct with the mononucleotide polymorphic site of the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction to cardiac muscle
Dead auxiliary diagnosis and the application that whether there is myocardial infarction neurological susceptibility to be judged individual, it is describedANRILGene extron
The mononucleotide polymorphic site in area is rs10965215 and rs10738605 described above.
Compared with prior art, beneficial effect is the present invention：
（1）Present invention is disclosedANRILThe mononucleotide polymorphic site of gene extron sub-district（Rs10965215 and
rs10738605）With the correlation of the susceptible degree of myocardial infarction, and the polymorphism is in terms of screening myocardial infarction Susceptible population
Purposes.Wherein, the loci C of the loci G and rs10738605 of rs10965215 can increase individual myocardial infarction
Onset risk.
（2）Utilize the provided by the present invention and susceptible relevant ANRIL genes of myocardial infarction and its nucleic acid of polymorphic site
Sequence, builds the kit that science of heredity screening is carried out to myocardial infarction Susceptible population；The kit can be applied to obstruct cardiac muscle
Whether the auxiliary diagnosis of dead patient, there is myocardial infarction neurological susceptibility to assess individual.
（3）The present invention can screen the active drug using rs10965215 and rs10738605 polymorphic sites as target, i.e.,
WillANRILPotential target spots of the mononucleotide polymorphic site rs10965215 and rs10738605 of gene extron sub-district as medicine
To screen and design medicine, find out with adjustingANRILThe bioactive molecule of gene expression, promotes new treatment myocardial infarction medicine
Discovery, so as to be conducive to the prevention of myocardial infarction, early diagnosis and therapy.
（4）The method that the present invention is established can be used for analysis people'sANRILExon 1 mononucleotide in gene order
The G/A allelotypes of polymorphic site rs10965215 and the C/G allelotypes of rs10738605, to be applied to cardiac muscle
The auxiliary diagnosis of infarct and to individual whether have myocardial infarction neurological susceptibility judge, so as to be conducive to the prevention of myocardial infarction
And treatment.
（5）SEQ ID NO can specifically, be efficiently detected using primer provided by the invention and specific probe: 1
The polymorphic site of the 269th and SEQ ID NO in shown sequence:The polymorphic site of the 300th in sequence shown in 2.
（6）Using it is provided by the invention with the susceptible relevant ANRIL genes of myocardial infarction and its sequence of polymorphic site and
Methods of genotyping, can build the detection kit that molecular genetics diagnosis is carried out to myocardial infarction.
（7）Due to it is provided by the invention be likely to the susceptible relevant ANRIL genes of myocardial infarction also to take part in other with
The relevant pathologic process of the cellular activities such as propagation, apoptosis imbalance, including tumour etc., therefore, the present invention to furtheing investigate from now onANRILThe relation of gene and other diseases provides experience and application foundation.
Brief description of the drawings
Fig. 1 isANRILThe LDR sequencing electrophoretograms of the polymorphic site rs10965215 of gene.
Fig. 2 isANRILThe LDR sequencing electrophoretograms of the polymorphic site rs10738605 of gene.
Embodiment
In order to which technical problem, technical solution and beneficial effect solved by the invention is more clearly understood, below in conjunction with
Drawings and examples, the present invention will be described in further detail.It should be appreciated that specific embodiment described herein is only used
To explain the present invention, it is not intended to limit the present invention.
Embodiment 1.
With the susceptible relevant ANRIL genes of myocardial infarction, the nucleotide sequence of the ANRIL genes has SEQ ID NO: 1
With SEQ ID NO:Sequence shown in 2；
Wherein, SEQ ID NO:In sequence shown in 1, the 269th is G；
SEQ ID NO:In sequence shown in 2, the 300th is C.
Wherein, shouldANRILThe mononucleotide polymorphic site of gene extron sub-district is：Rs10965215, its allele point
To for G/A（That is SEQ ID NO:The nucleotide of the 269th in sequence shown in 1）With the monokaryon of the ANRIL gene extron sub-districts
Thuja acid polymorphic site is：Rs10738605, its allele point is to for C/G（That is SEQ ID NO:The 300th in sequence shown in 2
The nucleotide of position）；
Mononucleotide polymorphic site rs10965215 and rs10738605 is related to the susceptible degree of myocardial infarction.
Embodiment 2.
With the detection method of the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction, it is wrapped
Include following steps：
Step 1, determines the mononucleotide polymorphic site of ANRIL gene extron sub-districts（Rs10965215 and
rs10738605）, i.e. SEQ ID NO:The nucleotide of the 269th and SEQ ID NO in sequence shown in 1:Sequence shown in 2
In the nucleotide of the 300th；
Step 2, using PCR-ligase chain reaction（PCR-LDR）Protocols in Molecular Biology inspection
Survey is detected in sampleANRILGene extron sub-district is with the presence or absence of single nucleotide polymorphism and the class of mononucleotide polymorphic
Type.
Wherein, in step 2, PCR system is：Each sample carries out two cumulative volumes as 20ul systems
Amplified reaction, amplifies SEQ ID NO respectively:1 and SEQ ID NO:Sequence shown in 2, and including：Prepared genome
DNA dilutions 1ul, 2mM dNTP 2ul, 3mM MgCl20.6ul, corresponding forward and reverse each 1.0ul of amplimer, 1 ×
Buffer 2ul, Taq the archaeal dna polymerases 0.2ul, ddH of 1 unit2O 12.2ul；
PCR program is：SEQ ID NO:The amplified reaction of sequence shown in 1 in 95 DEG C of pre-degenerations 2 minutes,
After 94 DEG C are denatured 30 seconds, 1 point of the 50 DEG C of annealing 30 seconds of progress 40, the amplification cycles of 65 DEG C of extensions 30 seconds, finally carry out 65 DEG C 10
The filling-in of minute；SEQ ID NO:The amplified reaction of sequence shown in 2 was in 95 DEG C of pre-degenerations 2 minutes, after 94 DEG C of denaturation 30 seconds, into
53 DEG C of row 40,1 point of annealing 30 seconds, the amplification cycles of 72 DEG C of extensions 30 seconds, finally carry out 72 DEG C of filling-in of 10 minutes.
Wherein, in step 2, ligase chain reaction system in terms of 10 μ L of total amount including：PCR product 4ul, specificity are visited
Pin 1ul, 1 × Buffer 1ul, the ligase 0.05ul, ddH of 2 units2O 4ul；
Ligase chain reaction program is：Reaction carries out 40 94 DEG C of denaturation 15s after 95 DEG C of pre-degenerations 2 minutes, 50 DEG C
React the circular response of 25s.
Embodiment 3.
Draw for detecting with the mononucleotide polymorphic site of the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction
Thing, the primer specifically include：
（1）SEQ ID NO:Sequence shown in 1（Include rs10965215）Amplimer：
Forward primer：5’- GGATGTTTTGCAGGACTATT -3’(SEQ ID NO: 3)
Reverse primer：5’- GGAATCATCACAGCATGGAC -3’(SEQ ID NO: 4)
（2）SEQ ID NO:Sequence shown in 2（Include rs10738605）Amplimer：
Forward primer：5’- TTTTCCAGTGGTGTTTCTAAATAA -3’(SEQ ID NO: 5)
Reverse primer：5’- CCTCTGATGGTTTCTTTGGAGT -3’(SEQ ID NO: 6).
Embodiment 4.
It is special with the mononucleotide polymorphic site of the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction for detecting
Property probe, including following two group-specifics probe：
First group：
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）FAM probes：
5’-GTGGCAAATAGTCCTGCAAAACATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 7)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCT
CTCTTGGAATCCTTTGAAATGTC-3’ (SEQ ID NO: 8)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）A probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCT
CTTGGAATCCTTTGAAATGTT-3’ (SEQ ID NO: 9)；
Second group：
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）FAM probes：
5’-CACACCTAACAGTGATGCTTGAACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 10)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）C probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTGTACTGACTCGGGAAAGGATTCCAG-3’ (SEQ ID NO: 11)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTGTACTGACTCGGGAAAGGATTCCAC-3’ (SEQ ID NO: 12)。
Embodiment 5.
For detecting the reagent with the mononucleotide polymorphic site of the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction
Box, it includes the mononucleotide polymorphic for being used for detection and the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction of embodiment 3
The primer in site, and the monokaryon glycosides for being used for detection and the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction of embodiment 4
The specific probe of sour polymorphic site.
Embodiment 6.
Mononucleotide polymorphic site with the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction is to myocardial infarction
Auxiliary diagnosis and the application whether there is myocardial infarction neurological susceptibility to be judged to individual, shouldANRILThe list of gene extron sub-district
Nucleotide polymorphism site is the rs10965215 and rs10738605 of embodiment 1.
Experiment
First, the collection of blood sample and the extraction of genomic DNA
The 286 parts of myocardial infarction samples collected from First People's Hospital of Foshan City and Subsidiary Hospital of Guangdong Medical College, put down
Equal 62.03 ± 12.04 years old age（Standard deviation）, wherein 222 are male.Myocardial infarction diagnosis standard is with reference to International Cardiology
Association and WHO clinical names《The name of ischemic heart disease and diagnostic criteria》, all patients all in accordance with typical clinical manifestation,
Specific ECG change and myocardium enzyme measurement of concetration are found, and all underwent coronary radiography confirms.Control group be through
Heart ECT（Heart radioisotope scanning）, coronary artery CTA（CT imaging in coronary artery）Or the inspection such as coronarography excludes of myocardial infarction
Body, has 646 parts, average age 61.58 ± 12.28 years old（Standard deviation）, wherein 378 are male.All myocardial infarction patients
It is South China's Chinese Han Population of consanguinity-less relation with normal control individuals, excludes congenital heart disease, cardiomyopathy, serious liver
Dirty and kidney trouble, its essential characteristic are shown in Table 1.
With TIANamp poba gene group extracts kits（TIANGEN）Gene is extracted from the above-mentioned blood preparation being collected into
After group DNA, sample DNA is uniformly diluted to 20ng/ul, as DNA profiling.
The essential characteristic of 1 control group of table and myocardial infarction group
Wherein, a is the correction age, gender, smoking, drinks, the variable such as hypertension, diabetes and hyperlipidemia in table 1.
2nd, the parting of mononucleotide polymorphic site
The present invention uses the single nucleotide polymorphism technology based on PCR（PCR-LDR）, it is rightANRILGene
Polymorphic site rs10965215 present in exon 1（Its allele point is to for G/A）And rs10738605（Its equipotential base
Because point is to for C/G）Genotyping has been carried out in case group and control group.
PCR reactions carry out on MJ PTC-200 instruments.
PCR reaction systems and program are as follows：
Each sample carries out the amplified reaction that two cumulative volumes are 20ul systems, amplifies SEQ ID NO respectively:1 He
SEQ ID NO:Sequence shown in 2.Genomic DNA dilution 1ul, 2mM the dNTP 2ul, 3mM prepared is included in system
MgCl20.6ul, corresponding forward and reverse each 1.0ul of amplimer, 1 × Buffer 2ul, the Taq archaeal dna polymerases of 1 unit
0.2ul, ddH2O 12.2ul.SEQ ID NO:The amplified reaction of sequence shown in 1 is in 95 DEG C of pre-degenerations 2 minutes, 94 DEG C of denaturation 30
After second, 1 point of the 50 DEG C of annealing 30 seconds of progress 40, the amplification cycles of 65 DEG C of extensions 30 seconds, finally carry out 65 DEG C of filling-in of 10 minutes.
SEQ ID NO:The amplified reaction of sequence shown in 2 after 94 DEG C of denaturation 30 seconds, carries out 40 53 DEG C and moves back in 95 DEG C of pre-degenerations 2 minutes
1 point of fire 30 seconds, 72 DEG C of extensions amplification cycles of 30 seconds, finally carry out 72 DEG C of filling-in of 10 minutes.
SEQ ID NO:Sequence shown in 1（Include rs10965215）Amplimer：
Forward primer：5’- GGATGTTTTGCAGGACTATT -3’(SEQ ID NO: 3)
Reverse primer：5’- GGAATCATCACAGCATGGAC -3’(SEQ ID NO: 4)
SEQ ID NO:Sequence shown in 2（Include rs10738605）Amplimer：
Forward primer：5’- TTTTCCAGTGGTGTTTCTAAATAA -3’(SEQ ID NO: 5)
Reverse primer：5’- CCTCTGATGGTTTCTTTGGAGT -3’(SEQ ID NO: 6)
Use Ligase detection reaction（LDR）Method is including for 80bp to the length that amplification obtainsANRIL SEQ ID
NO:Sequence shown in 1 and length are including for 181bpANRILSEQ ID NO:It is polymorphic in the DNA fragmentation of sequence shown in 2
Site carries out Genotyping.Reaction system is 10ul, comprising PCR product 4ul, specific probe 1ul, 1 × Buffer 1ul, and 2
The ligase 0.05ul, ddH of a unit2O 4ul.Reaction carries out 40 94 DEG C of denaturation 15s after 95 DEG C of pre-degenerations 2 minutes,
The circular response of 50 DEG C of reaction 25s.SEQ ID NO:The LDR fragment lengths of sequence shown in 1 are respectively 166bp and 168bp.SEQ
ID NO:The LDR fragment lengths of sequence shown in 2 are respectively 178bp and 180bp.Product is sequenced through 377 electrophoresis of ABI, as a result transports
Data analysis is carried out with 4.0 softwares of GeneMapper.As shown in Figure 1, LDR sequencing electrophoresis sectional drawings show rs10965215 monokaryons
Nucleotide polymorphism type AG genotype is bimodal, AA and GG genotype is unimodal.As shown in Fig. 2, LDR sequencing electrophoresis sectional drawings are shown
Rs10738605 single nucleotide polymorphism Type C G genotype is bimodal, CC and GG genotype is unimodal.
Specific probe is as follows：
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）FAM probes：
5’-GTGGCAAATAGTCCTGCAAAACATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 7)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCT
CTCTTGGAATCCTTTGAAATGTC-3’ (SEQ ID NO: 8)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）A probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCT
CTTGGAATCCTTTGAAATGTT-3’ (SEQ ID NO: 9)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）FAM probes：
5’-CACACCTAACAGTGATGCTTGAACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 10)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）C probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTGTACTGACTCGGGAAAGGATTCCAG-3’ (SEQ ID NO: 11)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTGTACTGACTCGGGAAAGGATTCCAC-3’ (SEQ ID NO: 12)。
The present invention is by rightANRILGene extron sub-district Chinese han population minimum gene frequency is more than 10%
SNPs sites（Rs10965215, rs76521274, rs76184305, rs10738605 and rs78766516）Carry out parting, hair
The G allele of existing rs10965215 SNP and the C allele of rs10738605 SNP can increase individual myocardial infarction
Onset risk.
3rd,ANRILGene extron sub-district mononucleotide polymorphic site rs10965215 and rs10738605 and myocardial infarction
Correlation analysis
Statistical method：Whether meet Hardy- using the genotype distribution of goodness-of-fit chi-square criterion polymorphic sites
Weinberg is balanced.With SPSS specialty statistics softwares, Chi-square Test is selected to polymorphic position in patient's group and control group sample
The genotype distribution frequency of point carries out statistical analysis.Each polymorphic site and myocardial infarction are counted with unconditional logistic regression analysis
Correlation, and be corrected with the myocardial infarction hazards such as hypertension, smoking, calculate the odds ratio of relative risk（OR）
And 95% confidential interval（CI）.Statistical significant difference level set isP <0.05。
Statistical result：The polymorphic position of rs10965215 and rs10738605 of healthy control group sample and patients with myocardial infarction group
Point gene type and loci distribution frequency are as shown in table 2：
Rs10965215 the and rs10738605 polymorphic site bases of 2 healthy control group sample of table and patients with myocardial infarction group
Because of type and loci distribution frequency
Wherein, a is the correction age, gender, smoking, drinks, the variable such as hypertension, diabetes and hyperlipidemia in table 2.
According to 2 distribution frequency of table, rs10965215 and rs10738605 are equal in the genotype frequency distribution of control group sample
Meet Hardy-Weinberg balances.As seen from Table 2,ANRILThe G equipotentials position of Polymorphism site rs10965215
Point, the distribution frequency conspicuousness in myocardial infarction patient colony（P=0.020）More than its frequency of distribution in control group colony
Rate；The C locis of rs10738605, the distribution frequency conspicuousness in myocardial infarction patient colony（P=0.019）More than it
Distribution frequency in control group colony.Rs10965215 discoveries are further analyzed with dominant models, with respect to AA genotype individuals,
Being distributed in control group and case group for AG/GG genotype individuals has more marked difference（P=0.030）, wherein AG/GG genes
The danger that type individual suffers from myocardial infarction is 1.45 times of AA genotype individuals.Rs10738605 is further analyzed with dominant models
It was found that with respect to GG genotype individuals, being distributed in control group and case group for GC/CC genotype individuals has more marked difference（P
=0.008）, the danger that wherein GC/CC genotype individuals suffer from myocardial infarction is 1.58 times of CC genotype individuals.
4th, detection kit
The kit of detection myocardial infarction neurological susceptibility is prepared, wherein containing following oligonucleotide primer pair, for from inspection
Specific amplification in the genome sample of object is surveyed to includeANRILThe genomic fragment of sequence.
SEQ ID NO:Sequence shown in 1（Include rs10965215）Amplimer：
Forward primer：5’- GGATGTTTTGCAGGACTATT -3’(SEQ ID NO: 3)
Reverse primer：5’- GGAATCATCACAGCATGGAC -3’(SEQ ID NO: 4)
SEQ ID NO:Sequence shown in 2（Include rs10738605）Amplimer：
Forward primer：5’- TTTTCCAGTGGTGTTTCTAAATAA -3’(SEQ ID NO: 5)
Reverse primer：5’- CCTCTGATGGTTTCTTTGGAGT -3’(SEQ ID NO: 6)
The kit also includes two group-specific probes, polymorphic for detecting rs10965215 and rs10738605 in sample
The allelotype in site.
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）FAM probes：
5’-GTGGCAAATAGTCCTGCAAAACATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 7)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCT
CTCTTGGAATCCTTTGAAATGTC-3’ (SEQ ID NO: 8)
Detect SEQ ID NO:Polymorphic site in sequence shown in 1（rs10965215）A probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCT
CTTGGAATCCTTTGAAATGTT-3’ (SEQ ID NO: 9)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）FAM probes：
5’-CACACCTAACAGTGATGCTTGAACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTT-3’ (SEQ ID NO: 10)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）C probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTGTACTGACTCGGGAAAGGATTCCAG-3’ (SEQ ID NO: 11)
Detect SEQ ID NO:Polymorphic site in sequence shown in 2（rs10738605）G probes：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTGTACTGACTCGGGAAAGGATTCCAC-3’ (SEQ ID NO: 12)。
Finally it should be noted that the above embodiments are merely illustrative of the technical solutions of the present invention, rather than the present invention is protected
The limitation of scope is protected, although being explained with reference to preferred embodiment to the present invention, those of ordinary skill in the art should
Work as understanding, can be to technical scheme technical scheme is modified or replaced equivalently, without departing from the reality of technical solution of the present invention
Matter and scope.
Gene order table
<110>Guangdong Medical College
<120>It is susceptible relevant with myocardial infarctionANRILThe detection method of gene extron sub-district mononucleotide polymorphic site
And its application
<160> 2
<210> SEQ ID NO: 1
<211> 533
<212> DNA
<213> ANRIL
<400> SEQ ID NO: 1
GGTGACAAAACCATTGGTAGACAGTGGTTGAGAAACAGAATAGTCTCAGGATATCACTCCGTAGATTTA
TTCATTAATTAAAAAGAGAAAATGTGCTTTGAGAGAGAGAAAGCTATTACCGTCTTTATCAAATAGGAGAGCCTGAT
CATGTGTGGTCTGAAGTTTATCTAATGGGATTCCTGATGGAATGTTTAGTCTGAATCTAATCACATAGAGACTTGTC
TGACAAATCCAGATTTTTTGGATGTTTTGCAGGACTATTTGCCACGACATTTCAAAGGATTCCAAGAGAGAATATTG
GTGTCCATGCTGTGATGATTCCTCAGCTCCTCTCATCTGATCTCCGTCCTGGCCCCCATGACTTTCTTTGTGGTAGT
TAGGGTGTGGTATGTGCCACTGAGGCCCACACCTATTGCTGTAAGTGCTGTTTGGGAAACCATCATCTTTCAGGTCT
GTGTGATAAAAGAAGAGCCTTGGGGAAATGTTCTCTTCCAAATTTAATCTTTACATTATTAGAAAATATTTTGATGA
CC
<210> SEQ ID NO: 2
<211> 534
<212> DNA
<213> ANRIL
<400> SEQ ID NO: 2
TGACAATGAGAAATATTTAATGGCAAACTTAGTCTTCTAATTTGAAAATGGAAATCATAACAGTTCTTG
CCTCTTAGGGATAGTGTGAGACAAGTGAAATAATCCATGTAAGAGGTATAGTACTATGCTTGCCATTCTTTAAGAGC
TCAACAAATATTCACTTTTTACCTATTAGTATCAATCTTAATTCTAAAATTCTATTATTTAATATTTTCCAGTGGTG
TTTCTAAATAATATCTAATGACTAGGCTAATACACTATGTGGTTCTTCTAGGGTTCAAGCATCACTGTTAGGTGTGC
TGGAATCCTTTCCCGAGTCAGTACTGCTTTCTAGAAGAAAACCGGGGAGATCTATTTGGAATGTATCTAACTCCAAA
GAAACCATCAGAGGTAACAGGTAGGAGATATGAAACGACCTTTTAGATATGAACCCTAATTGAATAAAAGTTGCCAA
ACAACTGTTCCCAAACATCTAAAGAAGAGTTTTAGTCTAAGTGGAATGGCTGGAGAGTATGGGAAGAGTTCTTTCCT
ACT
Claims (3)
1. with the mononucleotide polymorphic site rs10965215 of the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction and
The amplimer of rs10738605 is used to detect and exists with the purposes in the susceptible relevant kit of myocardial infarction, its feature in preparation
In：The amplimer expands SEQ ID NO respectively:1 and SEQ ID NO:Sequence shown in 2；
The primer includes：
(1) the SEQ ID NO of rs10965215 are included:The amplimer of sequence shown in 1：
Forward primer：5’-GGATGTTTTGCAGGACTATT-3’(SEQ ID NO:3)
Reverse primer：5’-GGAATCATCACAGCATGGAC-3’(SEQ ID NO:4), and
(2) the SEQ ID NO of rs10738605 are included:The amplimer of sequence shown in 2：
Forward primer：5’-TTTTCCAGTGGTGTTTCTAAATAA-3’(SEQ ID NO:5)
Reverse primer：5’-CCTCTGATGGTTTCTTTGGAGT-3’(SEQ ID NO:6)；
The mononucleotide polymorphic site rs10965215 of the ANRIL gene extrons sub-district, its allele point are right to for G/A
Answer SEQ ID NO:The nucleotide of the 269th and the mononucleotide polymorphic of the ANRIL gene extrons sub-district in sequence shown in 1
Site rs10738605, its allele point is to for C/G, corresponding SEQ ID NO:The nucleosides of the 300th in sequence shown in 2
Acid；
The loci C increase individuals of the loci G and rs10738605 of the mononucleotide polymorphic site rs10965215
The onset risk of myocardial infarction.
2. for detecting the mononucleotide polymorphic site with the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction
The specific probe of rs10965215 and rs10738605 is being prepared in detection and the susceptible relevant kit of myocardial infarction
Purposes, it is characterised in that：Including following two group-specifics probe：
First group：
Detect SEQ ID NO:The FAM probes of polymorphic site rs10965215 in sequence shown in 1：
5’-GTGGCAAATAGTCCTGCAAAACATCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTT-3’(SEQ ID NO:7)
Detect SEQ ID NO:The G probes of polymorphic site rs10965215 in sequence shown in 1：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCTCT
TGGAATCCTTTGAAATGTC-3’(SEQ ID NO:8)
Detect SEQ ID NO:The A probes of polymorphic site rs10965215 in sequence shown in 1：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCTCTTG
GAATCCTTTGAAATGTT-3’(SEQ ID NO:9)；
Second group：
Detect SEQ ID NO:The FAM probes of polymorphic site rs10738605 in sequence shown in 2：
5’-CACACCTAACAGTGATGCTTGAACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTT-3’(SEQ ID NO:10)
Detect SEQ ID NO:The C probes of polymorphic site rs10738605 in sequence shown in 2：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTGTACTGACTCGGGAAAGGATTCCAG-3’(SEQ ID NO:11)
Detect SEQ ID NO:The G probes of polymorphic site rs10738605 in sequence shown in 2：
5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTGTACTGACTCGGGAAAGGATTCCAC-3’(SEQ ID NO:12)；The mononucleotide polymorphic site
The onset risk of the individual myocardial infarction of loci C increases of the loci G and rs10738605 of rs10965215.
3. primer and probe is used for the mononucleotide of detection and the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction preparing
Purposes in the kit of polymorphic site, it is characterised in that：Primer is easy with myocardial infarction for detecting described in claim 1
Feel the primer of the mononucleotide polymorphic site of relevant ANRIL gene extrons sub-district, probe is to be used to examine described in claim 2
Survey the specific probe with the mononucleotide polymorphic site of the susceptible relevant ANRIL gene extrons sub-district of myocardial infarction；The list
The individual myocardial infarction of loci C increases of the loci G and rs10738605 of nucleotide polymorphism site rs10965215
Onset risk.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410727064.1A CN104404044B (en) | 2014-12-04 | 2014-12-04 | Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410727064.1A CN104404044B (en) | 2014-12-04 | 2014-12-04 | Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404044A CN104404044A (en) | 2015-03-11 |
| CN104404044B true CN104404044B (en) | 2018-04-27 |
Family
ID=52641713
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410727064.1A Expired - Fee Related CN104404044B (en) | 2014-12-04 | 2014-12-04 | Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404044B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109136377B (en) * | 2018-09-25 | 2021-09-28 | 浙江师范大学 | Therapeutic agent and diagnostic kit for adult T cell leukemia |
| CN109628577A (en) * | 2019-01-07 | 2019-04-16 | 杭州艾迪康医学检验中心有限公司 | Detect the primer and method of coronary sclerosis correlation mononucleotide polymorphism site |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009100029A1 (en) * | 2008-02-01 | 2009-08-13 | The General Hospital Corporation | Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions |
| CN102747076A (en) * | 2012-06-07 | 2012-10-24 | 中国医学科学院阜外心血管病医院 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
| CN102747072A (en) * | 2012-06-07 | 2012-10-24 | 中国医学科学院阜外心血管病医院 | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr5p15, and applications thereof |
-
2014
- 2014-12-04 CN CN201410727064.1A patent/CN104404044B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009100029A1 (en) * | 2008-02-01 | 2009-08-13 | The General Hospital Corporation | Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions |
| CN102747076A (en) * | 2012-06-07 | 2012-10-24 | 中国医学科学院阜外心血管病医院 | Single nucleotide polymorphism of susceptible area chr4q32 associated with susceptibility to coronary heart disease and application thereof |
| CN102747072A (en) * | 2012-06-07 | 2012-10-24 | 中国医学科学院阜外心血管病医院 | Coronary heart disease susceptibility substantially-associated single nucleotide polymorphism (SNP) sites of susceptible region chr5p15, and applications thereof |
Non-Patent Citations (1)
| Title |
|---|
| Chromosome 9p21 SNPs Associated with Multiple Disease Phenotypes Correlate with ANRIL Expression;Michael S. Cunnington，et al;《PLoS Genet》;20100408;第6卷(第4期);第6页右栏倒数第一段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404044A (en) | 2015-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Jin et al. | Association of endothelin-1 gene variant with hypertension | |
| Kelada et al. | Integrative genetic analysis of allergic inflammation in the murine lung | |
| Wu et al. | Three single-nucleotide polymorphisms of the angiotensinogen gene and susceptibility to hypertension: single locus genotype vs. haplotype analysis | |
| US20090136954A1 (en) | Genetic markers for scd or sca therapy selection | |
| Chang et al. | Replication of genome‐wide association signals of type 2 diabetes in han Chinese in a prospective cohort | |
| KR101220806B1 (en) | Identification of group of hypertension-susceptibility genes | |
| KR20080084806A (en) | Methods and compositions for the assessment of cardiovascular function and disorders | |
| CN104404044B (en) | Detection method and its application with the susceptible relevant ANRIL gene extrons sub-district mononucleotide polymorphic site of myocardial infarction | |
| Sia et al. | Distribution and phenotypic expression of mineralocorticoid receptor and CYP11B2 T-344C polymorphisms in a Taiwanese hypertensive population | |
| WO2016019633A1 (en) | Gene polymorphism variation site diagnostic reagent kit for early evaluation of breast cancer risk | |
| US10939868B2 (en) | Method of predicting rapid progression of fibrosis and therapy and reagents therefor | |
| CN107557468B (en) | Cancer-testis gene genetic marker related to auxiliary diagnosis of primary lung cancer and application thereof | |
| KR101979633B1 (en) | SNP markers for metabolic syndrome and use thereof | |
| Bhat et al. | CYP2D6 (C2850T, G1846A, C100T) polymorphisms, haplotypes and MDR analysis in predicting coronary artery disease risk in north-west Indian population: A case-control study | |
| CN104372004B (en) | One detection method and its application with the susceptible relevant miR-27a Polymorphisms site of myocardial infarction | |
| Shen et al. | A1180V of cardiac sodium channel gene (SCN5A): is it a risk factor for dilated cardiomyopathy or just a common variant in Han Chinese? | |
| Joe et al. | 11 Genetic analysis of inherited hypertension in the rat | |
| CN113416775A (en) | Cardiovascular disease related SNP site primer composition and application | |
| CN104513828A (en) | Coronary heart disease (CHD) related gene namely CYP17A1 gene, and in-vitro detection reagent, preparation or kit and application thereof | |
| CN113444791B (en) | ARMS-PCR kit for assisting in screening familial papillary thyroid carcinoma | |
| KR101881812B1 (en) | Biomarker for predicting of training response | |
| KR101881817B1 (en) | Biomarker for predicting of training response | |
| WO2019153241A1 (en) | Single nucleotide polymorphism loci associated with major adverse cardiovascular events and application thereof | |
| JP2017006074A (en) | Peripheral arterial disease inspection method and inspection reagent | |
| Ahmeda et al. | Association of Genetic Polymorphisms of Dipeptidyl Peptidase-4 with Metabolic Syndrome Parameters in Malaysian Subjects |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 523000 Guangdong Medical University, Songshan Avenue, Xincheng Road, Dongguan, Guangdong Applicant after: GUANGDONG MEDICAL College Address before: 524023 Zhanjiang, Guangdong Province, East Road, Xiashan District, No. 2 Applicant before: Guangdong Medical College |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180427 Termination date: 20211204 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |