CN102559903A - Non-invasive detection kit for endometrial carcinoma predisposing gene - Google Patents
Non-invasive detection kit for endometrial carcinoma predisposing gene Download PDFInfo
- Publication number
- CN102559903A CN102559903A CN2012100219946A CN201210021994A CN102559903A CN 102559903 A CN102559903 A CN 102559903A CN 2012100219946 A CN2012100219946 A CN 2012100219946A CN 201210021994 A CN201210021994 A CN 201210021994A CN 102559903 A CN102559903 A CN 102559903A
- Authority
- CN
- China
- Prior art keywords
- gene
- primer
- test kit
- leu432val
- mspi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a non-invasive detection kit for detecting endometrial cancer predisposing gene. The kit comprises specific primers for detecting genotypes of three single nucleotide polymorphism sites, DNA sequencing primers, a PCR reaction component, a PCR product purification component, a DNA sequencing reaction component, and the like, wherein the three single nucleotide polymorphism sites comprise MspI of CYP1A1 gene, Leu432Val of CYP1B1 gene, and MspA1I of CYP17gene. According to the present invention, the kit of the present invention detects the genotypes of the three single nucleotide polymorphism sites closely related to the development of the endometrial carcinoma so as to evaluate the risk level of the development of the endometrial carcinoma of the subject, and guide the female to targeted prevent the development of the endometrial carcinoma. The sampling method of the present invention is the oral mucosa cell sampling, such that characteristics of painlessness and no invasion are provided, and the cross infection is avoided. With the present invention, the sequencing result is accurate and reliable, the expensive imported equipment is not required to purchase, and the method is easy to popularize.
Description
Technical field
The invention belongs to biology field; Relate to medical science and biotechnology; Be specifically related to a kind of carcinoma of endometrium kit for detecting susceptibility genes, according to the risk class of detected result from gene aspect assessment women onset of endometrial cancer, and as the guidance foundation of specific aim prevention and treatment.
Background technology
In recent years, the sickness rate of carcinoma of endometrium is in rising trend, becomes the gynecological tumor that after mammary cancer and ovarian cancer, threatens women's health.The Hazard Factor that most epidemiological studies show carcinoma of endometrium are all relevant with oestrogenic hormon, the main mechanism that intimal hyperplasia that the estrogen level rising causes and dna damage are considered to the uterine endometrium oncogenesis.The lot of documents report has been arranged, and cytochrome P 450 enzymes (CYP1A1, CYP1B1, CYP17 etc.) plays an important role in estrogenic metabolic process.
Have two main competitive pathways metabolisms to generate the metabolic intermediate catechol estrogen in the estrogen metabolism process: a metabolism generates SA 2-hydroxyl Theelin,dihydro-(2-OH
2); Another generation has active 4-hydroxyl Theelin,dihydro-(4-OHE
2).CYP1A1 is one of outer main I phase metabolic enzyme that oestrogenic hormon is carried out the 2-hydroxylation metabolism of human liver.In addition, it is active that CYP1A1 also has the aromatic hydrocarbon hydroxylation, and multiple carcinogens oxidations such as ability catalysis polycyclic aromatic hydrocarbons generate the electrophilic epoxide with strong carcinogenic activity.Therefore, the active difference of CYP1A1 may influence estrogenic metabolism, and is relevant with individual susceptibility.4-OHE
2Mainly be from E by CYP1B1
2Metabolism is the catechol metabolite, has the gene toxic effect.Its carcinogenic effect is brought out canceration at oestrogenic hormon and is occupied an leading position on.
CYP17 gene and estrogenic synthetic also closely related; The 34th the base place at the translation starting point upper reaches of its 5 ' promoter region exists the polymorphic site of a T-C (allelotrope A1-allelotrope A2); When allelotrope A2 exists, can cause estrogen level to change, increase the carcinoma of endometrium susceptibility.
The existence of gene pleiomorphism does not directly cause the canceration of cell and the generation of tumour, may give individual to certain special environmental factors susceptible.Possibly exist between gene and the environmental exposure factor to influence each other, the interaction of research gene pleiomorphism and uterine endometrium oncogenesis, more comprehensive to the evaluation meeting of individual tumors susceptibility, have more biorational.
Therefore; Set up simply, other detection method of women's carcinoma of endometrium susceptible risk level fast; Can detect women's Endometrial Carcinomas relevant gene mononucleotide loci gene type takes place; The women high risk population that examination in time goes out the uterine endometrium cancer susceptibility gene, thus prevent and treat carcinoma of endometrium targetedly, and this has very important meaning for the sickness rate that reduces women's carcinoma of endometrium.
Summary of the invention
Based on the MspI of CYP1A1 gene, the Leu432Val of CYP1B1 gene; 3 mononucleotide polymorphism site genotype of the MspA1 I of CYP17 gene can be used to assess on the biological function basis of women's carcinoma of endometrium occurrence risk, and the present invention provides a kind of women's carcinoma of endometrium kit for detecting susceptibility genes.
This test kit comprises:
Detect the MspI of CYP1A1 gene, the Leu432Val of CYP1B1 gene, 3 genotypic Auele Specific Primers of mononucleotide polymorphism site of the MspA1 I of CYP17 gene are to reaching the dna sequencing primer;
PCR reaction component (comprising Taq enzyme, dNTP mixed solution, reaction buffer, ddH2O etc.);
PCR product purification assembly (comprising SAP enzyme, ExoI enzyme, ddH2O etc.);
Dna sequencing reaction assembly (comprising BigDye mix, EDTA solution, 100% ethanolic soln, 70% ethanolic soln, HIDI solution, ddH2O etc.).
The component and the content of test kit of the present invention comprise:
PCR reaction system: 10 * PCR reaction buffer 2.5ul; 25mM dNTP mixed solution 0.2ul; 5U/ul Taq archaeal dna polymerase 0.125ul; The 20uM Auele Specific Primer is to (every each 0.25ul of primer); DdH2O19.175ul.
PCR product purification system: 1U/ul SAP enzyme 0.75ul; 10U/ul ExoI enzyme 0.375ul; DdH2O3.875ul.
Sequencing reaction system: 25%BigDye mix 1ul; 3.2uM dna sequencing primer 1ul; 125mMEDTA solution 1ul; 100% ethanolic soln 15ul; 70% ethanolic soln 30ul; HIDI solution 8ul; DdH2O2ul.
This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
The use of embodiment 1. detection kit
1, extracting dna profiling
Scrape and get person under inspection's oral mucosa epithelial cell, with phenol chloroform method extracting genomic dna.
2, pcr amplification reaction
Use the PCR reaction component in the detection kit, wherein, it is right to contain following primer:
(1) CYP1A1 (MspI) forward primer: 5 ' GGGAGGAAGAAGAGGAGGTAG3 '
CYP1A1 (MspI) reverse primer: 5 ' AGGTTCTTGAAAGCAGGGACT3 '
(2) CYP1B1 (Leu432Val) forward primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 '
CYP1B1 (Leu432Val) reverse primer: 5 ' AGCCAGGATGGAGATGAAGAG3 '
(3) CYP17 (MspA1 I) forward primer: 5 ' CCCATACGAACCGAATAGA 3 '
CYP17 (MspA1 I) reverse primer: 5 ' AGTCAAGGTGAAGATCAGGGTAG3 '
The reaction system of pcr amplification is: 10 * PCR reaction buffer, 2.5 μ l; The dNTP mixed solution 0.2 μ l of 25mM, 5U/ul Taq enzyme 0.125 μ l, dna profiling 1 μ l (about 12-15ng), each 0.25 μ l of 20uM forward primer reverse primer, ddH2O 19.175 μ l;
Reaction conditions is: 94 ℃ of sex change in 4 minutes and enzyme activate, 94 ℃ of sex change in 30 seconds, and 55 ℃ of annealing in 30 seconds, 72 ℃ prolonged in 1 minute, circulates 28 times, and last 72 ℃ of prolongations are more than 5 minutes.
3, pcr amplification product purifying
Use the PCR product purification assembly in the detection kit, reaction system is TV 25ul, comprises PCR product 20ul, 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, deionized water 3.875ul.
On ABI2720 type pcr amplification appearance, react, reaction conditions is 37 ℃, 15min, 72 ℃, 20min.
4, dna sequencing reaction
Use the sequencing reaction assembly in the detection kit, wherein, contain following dna sequencing primer:
(1) CYP1A1 (MspI) sequencing primer: 5 ' GGGAGGAAGAAGAGGAGGTAG 3 '
(2) CYP1B1 (Leu432Val) sequencing primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 '
(3) CYP17 (MspA1 I) sequencing primer: 5 ' CCCATACGAACCGAATAGA 3 '
The system of reaction is TV 5ul, comprises PCR purified product 1ul, 25%Bigdye mix1ul, 3.2uMDNA sequencing primer 1ul, deionized water 2ul.
On ABI2720 type pcr amplification appearance, react, reaction conditions is 98 ℃ of 2min, carries out 96 ℃ of 30s of 25 round-robin, 55 ℃ of 30s, 60 ℃ of 4min.
Reaction finishes the back and adds 125mM EDTA solution 1ul and 100% ethanolic soln 15ul, in room temperature settle 15min; At 4 ℃, the centrifugal 30min of the rotating speed of 3600rpm/min removes supernatant gently; Add 70% ethanolic soln 30ul, the centrifugal 15min of 3600rpm/min removes supernatant gently; Room temperature adds HIDI solution 8ul after placing 20min, puts into sequenator.
5, gene type assay
The those skilled in the art that are familiar with the dna sequencing technology can be through the genotype in the definite SNP site of being detected of identification dna sequencing collection of illustrative plates.
2. couples of people of embodiment prevent the uterine endometrium cancer susceptibility gene not have the service that wound detects
1. sample and extracting DNA
Instructing the person under inspection to use the oral cavity sampling to wipe away by the hospital laboratory doctor carries out the mouth epithelial cells sampling, adopts phenol chloroform method to carry out the DNA extracting of mouth epithelial cells
2. genotype detection
Use test kit provided by the invention; To the MspI of the CYP1A1 gene of person under inspection's genomic dna, the Leu432Val of CYP1B1 gene; 3 mononucleotide polymorphism sites of the MspA1 I of CYP17 gene carry out dna sequencing respectively, confirm the genotype in these 3 SNPs sites.
3. carcinoma of endometrium women high risk population risk assessment
Through to the genotypic analysis of person under inspection SNPs, provide carcinoma of endometrium risk assessment analysis report list.Specified the MspI of person under inspection CYP1A1 gene, the Leu432Val of CYP1B1 gene in the report, the SNP locus gene detects information and genetic risk assessment result on the MspA1 I gene of CYP17 gene.In addition, according to person under inspection's risk class, and specify and understand the carcinoma of endometrium tumor susceptibility gene by the doctor to the person under inspection and do not have wound examining report list.
Claims (6)
1. a nothing that detects the uterine endometrium cancer susceptibility gene is created detection kit; It is characterized in that: detect the MspI of CYP1A1 gene, the Leu432Val of CYP1B1 gene, 3 the genotypic Auele Specific Primers of mononucleotide polymorphism site of the MspA1 I of CYP17 gene and dna sequencing primer, Taq enzyme, dNTP mixed solution, reaction buffer, SAP enzyme, ExoI enzyme, BigDye mix, EDTA solution, 70% ethanolic soln, 100% ethanolic soln, HIDI solution, ddH
2O etc.
2. test kit according to claim 1; It is characterized in that: described Auele Specific Primer is to being meant the MspI to the CYP1A1 gene, the Leu432Val of CYP1B1 gene; 3 mononucleotide polymorphism sites of the MspA1I of CYP17 gene, the primer of dna fragmentation that can specific amplification goes out to comprise these 3 SNPs sites is right.
3. test kit according to claim 1; It is characterized in that: described dna sequencing primer is the MspI to the CYP1A1 gene, the Leu432Val of CYP1B1 gene; 3 mononucleotide polymorphism sites of the MspA1I of CYP17 gene and designing can go out the dna sequencing primer of above-mentioned 3 SNPs loci gene types through dna sequencing technology specific detection.
4. according to the test kit shown in the claim 1, it is characterized in that 3 pairs of contained specific primer sequences are following:
(1) CYP1A1 (MspI) forward primer: 5 ' GGGAGGAAGAAGAGGAGGTAG3 '
CYP1A1 (MspI) reverse primer: 5 ' AGGTTCTTGAAAGCAGGGACT3 '
(2) CYP1B1 (Leu432Val) forward primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 '
CYP1B1 (Leu432Val) reverse primer: 5 ' AGCCAGGATGGAGATGAAGAG3 '
(3) CYP17 (MspA1 I) forward primer: 5 ' CCCATACGAACCGAATAGA 3 '
CYP17 (MspA1 I) reverse primer: 5 ' AGTCAAGGTGAAGATCAGGGTAG3 '
5. test kit according to claim 1 is characterized in that, 3 contained dna sequencing primer sequences are following:
(1) CYP1A1 (MspI) sequencing primer: 5 ' GGGAGGAAGAAGAGGAGGTAG 3 '
(2) CYP1B1 (Leu432Val) sequencing primer: 5 ' TTGTGCCTGTCACTATTCCTCA3 '
(3) CYP17 (MspA1 I) sequencing primer: 5 ' CCCATACGAACCGAATAGA 3 '
6. test kit according to claim 1 is characterized in that the component of test kit and content comprise:
(1) PCR reaction system: 10 * PCR reaction buffer 2.5ul, 25mM dNTP mixed solution 0.2ul, 5U/ul Taq archaeal dna polymerase 0.125ul, the 20uM Auele Specific Primer is right, every each 0.25ul of primer, ddH
2O 19.175ul.
(2) PCR product purification system: 1U/ul SAP enzyme 0.75ul, 10U/ul ExoI enzyme 0.375ul, ddH
2O 3.875ul.
(3) sequencing reaction system: 25%BigDye mix1ul, 3.2uM dna sequencing primer 1ul, 125mMEDTA solution 1ul, 100% ethanolic soln 15ul, 70% ethanolic soln 30ul, HIDI solution 8ul, ddH
2O2ul.
This test kit supplies a person-portion to detect application, and the storage temperature of test kit is-20 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100219946A CN102559903A (en) | 2012-02-01 | 2012-02-01 | Non-invasive detection kit for endometrial carcinoma predisposing gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012100219946A CN102559903A (en) | 2012-02-01 | 2012-02-01 | Non-invasive detection kit for endometrial carcinoma predisposing gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102559903A true CN102559903A (en) | 2012-07-11 |
Family
ID=46406502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100219946A Pending CN102559903A (en) | 2012-02-01 | 2012-02-01 | Non-invasive detection kit for endometrial carcinoma predisposing gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102559903A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103865996A (en) * | 2013-10-16 | 2014-06-18 | 李辉 | Endometrial cancer gene detection kit |
-
2012
- 2012-02-01 CN CN2012100219946A patent/CN102559903A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103865996A (en) * | 2013-10-16 | 2014-06-18 | 李辉 | Endometrial cancer gene detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cai et al. | Mutations of mitochondrial DNA as potential biomarkers in breast cancer | |
| Huang et al. | Haplotypes, loss of heterozygosity, and expression levels of glycine N-methyltransferase in prostate cancer | |
| Fujiwara-Igarashi et al. | Inhibition of p16 tumor suppressor gene expression via promoter hypermethylation in canine lymphoid tumor cells | |
| Maat et al. | Epigenetic regulation identifies RASEF as a tumor-suppressor gene in uveal melanoma | |
| CN104152557B (en) | The diagnostic kit of gene pleiomorphism variant sites earlier evaluations mammary cancer risk | |
| CN102559903A (en) | Non-invasive detection kit for endometrial carcinoma predisposing gene | |
| CN102517394A (en) | Reagent kit for noninvasive test of cervical cancer susceptibility gene | |
| Doulah et al. | Association of single nucleotide polymorphisms in miR-499 and miR-196a with susceptibility to breast cancer | |
| CN102586468A (en) | Noninvasive detection kit for susceptibility gene of bladder cancer | |
| CN102605082A (en) | Detection kit for systemic lupus erythematosus | |
| CN103468789A (en) | Noninvasive test kit of thyroid cancer susceptibility genes | |
| CN102559893A (en) | Noninvasive detection kit for genetic susceptibility genes of three female tumors | |
| CN102586430A (en) | Noninvasive detection kit for liver cancer susceptibility genes | |
| Tsou et al. | The joint effect of hOGG1 single nucleotide polymorphism and betel quid chewing on oral cancer in Taiwan | |
| CN104450876A (en) | Non-invasive defection kit for screening susceptibility genes of endometrial carcinoma | |
| CN102703581A (en) | Colorectal cancer susceptibility gene noninvasive detection kit | |
| CN102586447A (en) | Noninvasive detection kit of predisposing genes of pancreatic cancer | |
| Muisuk et al. | Novel mutations in cholangiocarcinoma with low frequencies revealed by whole mitochondrial genome sequencing | |
| CN102373285A (en) | Noninvasive gene assay kit for female gestational hypertension | |
| CN108179192A (en) | A kind of kit of gene pleiomorphism variant sites early diagnosis carcinoma of endometrium | |
| WO2022073259A1 (en) | Kit for detecting susceptibility of sudden cardiac death on basis of insertion and deletion polymorphic sites of cox10 gene | |
| WO2022077540A1 (en) | Sudden cardiac death susceptibility detection kit based on stim1 gene insertion and deletion polymorphic sites | |
| Mohammed et al. | Vitamin D Receptors Gene Polymorphisms and their Association with Serum Vitamin D level among Sudanese Patients with Benign Prostatic Hyperplasia | |
| CN102424853A (en) | Kit for noninvasive detection of ovarian cancer susceptible gene | |
| CN102433380A (en) | Noninvasive test kit for female estrogen-sensitive toxic and side effect predisposing gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| DD01 | Delivery of document by public notice |
Addressee: Decoding (Shanghai) Pharmaceutical Co., Ltd. Document name: Notification of before Expiration of Request of Examination as to Substance |
|
| C05 | Deemed withdrawal (patent law before 1993) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120711 |