CN102534003A - Applications of human pre-B-cell leukemia homeobox 1 (PBX1) gene and related drugs thereof - Google Patents
Applications of human pre-B-cell leukemia homeobox 1 (PBX1) gene and related drugs thereof Download PDFInfo
- Publication number
- CN102534003A CN102534003A CN2012100056991A CN201210005699A CN102534003A CN 102534003 A CN102534003 A CN 102534003A CN 2012100056991 A CN2012100056991 A CN 2012100056991A CN 201210005699 A CN201210005699 A CN 201210005699A CN 102534003 A CN102534003 A CN 102534003A
- Authority
- CN
- China
- Prior art keywords
- pbx1
- gene
- people
- rna
- plko
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses applications of a human pre-B-cell leukemia homeobox 1 (PBX1) gene and related drugs thereof. The invention discloses the applications of the PBX1 gene in cancer therapy, cancer diagnosis and drug preparation. The invention also further constructs a human PBX1 gene small interfering ribonucleic acid (siRNA), a human PBX1 gene interfering nucleic acid constructor and a human PBX1 gene interfering slow virus and discloses the applications thereof. The siRNA or the nucleic acid constructor containing the siRNA and the slow virus provided by the invention are capable of specifically restraining the expression of the human PBX1 expression, especially, the slow virus is capable of efficiently infecting target cells to efficiently restrain the expression of the PBX1 gene in the target cell, and further, the growth of cancer cells is restrained, and the apoptosis of cancer cells is promoted. The human PBX1 gene has very important meaning in the cancer therapy.
Description
Technical field
The present invention relates to biological technical field, relate more specifically to the purposes and the related drugs thereof of people PBX1 gene.
Background technology
(RNA interference RNAi) is sequence-specific PTGS phenomenon by double chain RNA mediate to The RNA interference.The RNAi technology has higher post-transcriptional silencing efficient and specificity, is expected to become instrument (the Izquierdo M.Short interfering RNAs as a tool for cancer gene therapy.Cancer Gene Ther.2005 of tumor disease gene therapy; 12 (3): 217-27.).Plasmid or virus vector can be handled hairpin structure RNA (the short hairpin RNA of one section 45-50nt; ShRNA) expression in mammalian cell; ShRNA can be formed to siRNA (small interfering RNA automatically in cell; SiRNA), cause gene silencing or expression inhibiting then.Lentiviral vectors has that the gene fragment of carrying capacity is big, transfection efficiency is high, is difficult for bringing out host immune response, can stablizes advantages such as suppressing target gene expression; Field (SinnPL such as gene therapy, production of vaccine and scientific research have been widely used in; Sauter SL; McCray PB.Gene therapy progress and prospects:development of improved lentiviral and retroviral vectors-design; Biosafety, and production.Gene Ther 2005; 12:1089-98.).
Pre B cell white blood disease transcription factor 1 (pre-B-cell leukemia homeobox 1; PBX1) belong to TALE (three amino acid loop extension) family protein with regulation of embryonic development function; Can with family proteins such as PDX, Meis be attached to together the conserved regions 5 of DNA '-ATCAATCAA-3 '; Regulate (the Krosl J that transcribes of many important gene; Baban S, Krosl G, Rozenfeld S; Largman C, Sauvageau G.Cellular proliferation and transformation induced by HOXB4 and HOXB3 proteins involves cooperation with PBX1.Oncogene.1998; 16 (26): 3403-12.Pan L; Xie Y; Black TA; Jones CA, Pruitt SC, Gross KW.An Abd-B class HOX.PBX recognition sequence is required for expression from the mouse Ren-1cgene.J Biol Chem.2001; 276 (35): 32489-94.Moens CB, Selleri L.Hox cofactors in vertebrate development.Dev Biol.2006; 291 (2): 193-206.Knoepfler PS; Calvo KR; Chen H; Antonarakis SE, Kamps MP.Meis 1and pKnox1 bind DNA cooperatively with Pbx1 utilizing an interaction surface disrupted in oncoprotein E2a-Pbx1.Proc Natl Acad Sci U S is A.1997; 94 (26): 14553-8.Okada Y; Nagai R; Sato T, Matsuura E, Minami T; Morita I, Doi T.Homeodomain proteins MEIS1 and PBXs regulate the lineage-specific transcription of the platelet factor 4 gene.Blood.2003; 101 (12): 4748-56.).The PBX1 gene produces, keeps in the self process of hemopoietic stem cell and embryonic stem cell and bring into play critical function (Chiba S.Homeobox genes in normal hematopoiesis and leukemogenesis.Int J Hematol.1998 regulating blood cell; 68 (4): 343-53.Chan KK, Zhang J, Chia NY; Chan YS, Sim HS, Tan KS; Oh SK, Ng HH, Choo AB.KLF4 and PBX1 directly regulate NANOG expression in human embryonic stem cells.Stem Cells.2009; 27 (9): 2114-25.).Similar with other TALE family protein, the PBX1 gene also plays a significant role in tissue development, as is adjusted to bone forming; The fetal development of spleen, kidney and urogenital organ's (Cheung CL, Chan BY, Chan V such as differentiation; Ikegawa S, Kou I, Ngai H; Smith D, Luk KD, Huang QY; Mori S, Sham PC, Kung AW.Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible genetic association with bone mineral density variation.Hum Mol Genet.2009; 18 (4): 679-87.Brendolan A, Rosado MM, Carsetti R, Selleri L, Dear TN.Development and function of the mammalian spleen.Bioessays.2007; 29 (2): 166-77.Yu J, McMahon AP, Valerius MT.Recent genetic studies of mouse kidney development.Curr Opin Genet Dev.2004; 14 (5): 550-7.Schnabel CA, Selleri L, Cleary ML.Pbx1is essential for adrenal development and urogenital differentiation.Genesis.2003; 37 (3): 123-30.).This expression of gene disappearance can cause embryonic death and multiple histoorgan unusual.
PBX1 is positioned at karyomit(e) 1q21-q24, is in type ii diabetes tumor susceptibility gene site, with closely related (the Duesing K of the generation of mellitus; Charpentier G, Marre M, Tichet J; Hercberg S; Balkau B, Froguel P, Gibson F.Evaluating the association of common PBX1variants with type 2diabetes.BMC Med Genet.2008; 9:14.Thameem F, Wolford JK, Bogardus C, Prochazka M.Analysis of PBX1as a candidate gene for type 2 diabetes mellitus in Pima Indians.Biochim Biophys Acta.2001; 1518 (1-2): 215-20.).In recent years, the effect of PBX1 gene in malignant tumour receives investigator's concern day by day.At acute lymphoblastic is often to find PBX1 gene and other gene Fusion sudden change in the white blood disease; Form fusion rotein (Thorsteinsdottir U such as E2A-PBX1, EWSR1-PBX1; Krosl J, Kroon E, Haman A; Hoang T, Sauvageau G.The oncoprotein E2A-Pbxla collaborates with Hoxa9 to acutely transform primary bone marrow cells.Mol Cell Biol.1999; 19 (9): 6355-66.Monica K; LeBrun DP; Dedera DA; Brown R, Cleary ML.Transformation properties of the E2a-Pbx1 chimeric oncoprotein:fusion with E2a is essential, but the Pbx1 homeodomain is dispensable.Mol Cell Biol.1994; 14 (12): 8304-14.Aspland SE, Bendall HH, Murre C.The role of E2A-PBX1 in leukemogenesis.Oncogene.2001; 20 (40): 5708-17.Brandal P, Panagopoulos I, Bjerkehagen B, Gorunova L, Skjeldal S, Micci F, Heim S.Detection of a t (1; 22) (q23; Q12) translocation leading to an EWSR1-PBX1 fusion gene in a myoepithelioma.Genes Chromosomes Cancer.2008; 47 (7): 558-64.).The generation of fusion rotein mainly is because chromosome shift has taken place; The expression that these fusion roteins can be regulated many downstream oncogene causes leukemia cell's propagation then; As can promote Bmi-1 genetic expression to reduce downstream INK4A-ARF genetic expression (Smith KS, Chanda SK, Lingbeek M then; Ross D T; Botstein D, van Lohuizen M, Cleary ML.Bmi-1 regulation of INK4A-ARF is a downstream requirement for transformation of hematopoietic progenitors by E2a-Pbx1.Mol Cell.2003; 12 (2): 393-400.).PBX1 abnormal expression in people's esophageal squamous cell carcinoma tissue raises (Liu DB; Gu ZD; Cao XZ; Liu H, Li JY.Immunocytochemical detection of HoxD9and Pbx1homeodomain protein expression in Chinese esophageal squamous cell carcinomas.World J Gastroenterol.2005; 11 (10): 1562-6.).In prostate cancer, the high expression level of PBX1 promotes propagation (Kikugawa T, the Kinugasa Y of the prostate cancer cell of androgen independence; Shiraishi K; Nanba D, Nakashiro K, Tanji N; Yokoyama M, Higashiyama S.PLZF regulates Pbx1transcription and Pbx1-HoxC8 complex leads to androgen-independent prostate cancer proliferation.Prostate.2006; 66 (10): 1092-9.).In ovarian cancer; PBX1 is as survival (the Park JT of the downstream gene mediation tumour cell of Notch3; Shih IeM; Wang TL.Identification of Pbx1, a potential oncogene, as a Notch3target gene in ovarian cancer.Cancer Res.2008; 68 (21): 8852-60.).
Based on the report of above PBX1 gene in tumours such as people's esophageal squamous cell carcinoma, prostate cancer and ovarian cancer, infer that PBX1 is expected to become the target spot of oncotherapy.Yet the PBX1 gene is not illustrated in lung cancer, liver cancer and mammary cancer generation and developing role as yet at present.Therefore, be necessary to further investigate the effect of PBX1 in above-mentioned lung cancer, liver cancer and breast cancer cell malignant proliferation and the molecular mechanism that influences the propagation of tumour cell.
Summary of the invention
The treat-ment and the medicine that the objective of the invention is to open and people PBX1 (pre-B-cell leukemia homeobox 1) gene-correlation.In order to further investigate the regulatory function of PBX1 in tumour takes place; It is model that the present invention chooses people's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell, gastric carcinoma cells SGC7901 and human pancreas cancer Panc-1 cell, is that means research PBX1 is in the survival of above-mentioned tumour cell and the effect in the apoptosis destiny with RNAi.
First aspect present invention, disclose with people PBX1 gene be used for the preparation or the screening anti-tumor medicine, perhaps people PBX1 gene is used to prepare the diagnosing tumor medicine.
People PBX1 gene is used to prepare or screen the content that anti-tumor medicine comprises two aspects: one of which is applied to prepare anti-tumor medicine or preparation as medicine or preparation to the action target of tumour cell with people PBX1 gene; Its; , people PBX1 gene is applied to screen anti-tumor medicine or preparation as medicine or preparation to the action target of tumour cell.
Said people PBX1 gene specifically is meant as medicine or the preparation action target to tumour cell: people PBX1 gene is produced the target of RNA interference effect as medicine or preparation to tumour cell, thereby can reduce tumour cell people PBX1 expression of gene level.
Said people PBX1 gene is applied to screen anti-tumor medicine as medicine or preparation to the action target of tumour cell or preparation specifically is meant: people PBX1 gene is screened medicine or preparation as effective object, to find the medicine that can suppress or promote people PBX1 genetic expression as the oncotherapy drug candidate.As after described people PBX1 gene small molecules interference RNA be that effective object screening obtains promptly with people PBX1 gene, can be used as and have the medicine that suppresses the tumor cell proliferation effect.Such as antibody drug, small-molecule drug etc. also can be with the PBX1 gene as effective object.
Said people PBX1 gene is used to prepare the diagnosing tumor medicine, is meant the preparation that people PBX1 gene expression product is applied to the diagnosing tumor medicine as a diagnosing tumor index.
Any tumour that described tumour is can be for the propagation of its tumour cell relevant with people PBX1 expression of gene, further, be a kind of malignant tumour, for example be selected from: lung cancer, liver cancer and mammary cancer.
Said anti-tumor medicine can be small molecules chemistry medicine, and the antibody medicine also can be nucleic acid drug.
Further, thus said anti-tumor medicine can reduce the propagation that people PBX1 expression of gene level suppresses tumour cell.
Adopting the method for aforementioned anti-tumor medicine treatment tumour, mainly is to reach therapeutic purpose through the propagation that reduces people PBX1 expression of gene level inhibition tumour cell.
Concrete, during treatment, the material that can effectively reduce people PBX1 gene expression dose delivers medicine to the patient.
Further, the described material that can effectively reduce people PBX1 gene expression dose, comprise can specificity the small molecules interference RNA (siRNA) of reticent people PBX1 genetic expression.This small molecules interference RNA (siRNA) can play the effect of endogenous PBX1 expression of gene in the reticent tumour cell of specificity.
Further, said small molecules interference RNA is with arbitrary sequence of being selected from SEQ ID NO:1-29 target sequence as the reticent people PBX1 of specificity genetic expression.
Said small molecules interference RNA is meant with arbitrary sequence of being selected from SEQ ID NO:1-29 target sequence as the reticent people PBX1 of specificity genetic expression: this small molecules interference RNA can combine with the coded mRNA fragments specific of any sequence among the SEQ ID NO:1-29, and specificity silence people PBX1 expression of gene.
Further, said can specificity the small molecules interference RNA (siRNA) of reticent people PBX1 genetic expression express via lentiviral vectors.Particularly; This process comprises: the dna fragmentation of the said people PBX1 gene small molecules interference RNA of will encoding is cloned into lentiviral vectors and obtains people PBX1 gene interference lentiviral vectors; And then utilize this people PBX1 gene to disturb lentiviral vectors to dress up to behind the infectious virion through virus packets, infected tumor's cell and the said siRNA of final expression.
People PBX1 gene disturbs lentiviral vectors for the dna fragmentation of the said people PBX1 gene small molecules interference RNA of will encoding obtains after being cloned into lentiviral vectors, can produce people PBX1 gene small molecules interference RNA.
Further; Described lentiviral vectors can be selected from: it is carrier that any lentiviral vectors among pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ, the embodiment of the invention have specifically been enumerated with pGCSIL-GFP.
Lentiviral vectors can be following assisting of slow virus packaging plasmid, clone, dresses up through virus packets to be infectious virion.
The present invention; The aspect discloses a kind of isolating people PBX1 gene small molecules interference RNA (siRNA) target fragment, and its sequence is any sequence among the SEQ ID NO:1-29.
Said isolating people PBX1 gene small molecules interference RNA (siRNA) target fragment can be applicable to the screening and the preparation of people PBX1 gene small molecules interference RNA.
Third aspect present invention discloses a kind of people PBX1 gene small molecules interference RNA (siRNA), can the reticent people PBX1 of specificity expression of gene.
Said people PBX1 gene small molecules interference RNA is with arbitrary sequence of being selected from SEQ ID NO:1-29 target sequence as the reticent people PBX1 of specificity genetic expression.
Further, said people PBX1 gene small molecules interference RNA comprises just RNA fragment and sense-rna fragment, said just RNA fragment and said sense-rna fragment complementation, and said just RNA fragment contains the RNA of the arbitrary sequence encoding among the SEQ ID NO:1-29.
Said just RNA fragment is present on two different RNA chains with the sense-rna fragment or is present on same the RNA chain.
Said just RNA fragment and the segmental length of sense-rna are 15-27 Nucleotide; Preferable, length is 19-23 Nucleotide; Best, length is 19,20 or 21 Nucleotide.
Further, said people PBX1 gene small molecules interference RNA is the hair clip type single stranded RNA, comprises just RNA fragment, stem ring plate section and sense-rna fragment, is separated by stem ring plate section in the middle of just RNA fragment and the sense-rna fragment; Wherein, just RNA fragment and sense-rna fragment complementation, just RNA fragments sequence is selected from the arbitrary of SEQ ID NO:1-29.
Said stem ring plate segment structure comprises 6 or 9 bases.Further said stem ring fragments sequence is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.It is the stem ring that the present invention has specifically enumerated with UUCAAGAGA.
Enumerate like embodiment, the sequence of said people PBX1 gene small molecules interference RNA is SEQ ID NO:30:GCAUCAGUGCUAAUGGAGGUUUUCAAGAGAAACCUCCAUUAGCACUGAUG C.
Fourth aspect present invention discloses a kind of people PBX1 gene RNA construct, comprises the gene fragment of the aforementioned people PBX1 gene small molecules interference RNA of encoding, and can express aforementioned people PBX1 gene small molecules interference RNA.
Described people PBX1 gene RNA construct can be the gene fragment clone of the aforementioned people PBX1 gene small molecules interference RNA of coding to be gone into known carrier obtain.
Further; Said people PBX1 gene RNA construct behaviour PBX1 gene disturbs lentiviral vectors; For the gene fragment clone of the said people PBX1 gene small molecules interference RNA of will encoding obtains after going into lentiviral vectors, can produce people PBX1 gene small molecules interference RNA.
Said lentiviral vectors can be selected from: pLKO.1-puro; PLKO.1-CMV-tGFP; PLKO.1-puro-CMV-tGFP; PLKO.1-CMV-Neo; PLKO.1-Neo; PLKO.1-Neo-CMV-tGFP; PLKO.1-puro-CMV-TagCFP; PLKO.1-puro-CMV-TagYFP; PLKO.1-puro-CMV-TagRFP; PLKO.1-puro-CMV-TagFP635; PLKO.1-puro-UbC-TurboGFP; PLKO.1-puro-UbC-TagFP635; PLKO-puro-IPTG-1xLacO; PLKO-puro-IPTG-3xLacO; PLP1; PLP2; PLP/VSV-G; PENTR/U6; PLenti6/BLOCK-iT-DEST; PLenti6-GW/U6-laminshrna; PcDNA1.2/V5-GW/lacZ; PLenti6.2/N-Lumio/V5-DEST; Arbitrary among pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
It is the people PBX1 gene RNA construct of vector construction with pGCSIL-GFP that the embodiment of the invention has specifically been enumerated, called after pGCSIL-GFP-PBX1-shRNA.
Further, the encode sequence of gene fragment of said people PBX1 gene small molecules interference RNA contains arbitrary sequence and complementary sequence thereof among the SEQ IDNO:1-29.
People PBX1 gene small molecules interference RNA of the present invention can be used for suppressing the propagation of tumour cell, further can be as the medicine or the preparation of treatment or diagnosing tumour.People PBX1 gene RNA construct then can be used for preparing said people PBX1 gene small molecules interference RNA.
When as medicine or the preparation of treatment tumour, be that the people PBX1 gene small molecules interference RNA with safe and effective amount is applied to Mammals.Certainly, concrete dosage is factor such as considered route of administration, patient health situation also, and these all are within the skilled practitioners skill.
Fifth aspect present invention discloses a kind of people PBX1 gene and has disturbed slow virus, disturbs lentiviral vectors down auxiliary in slow virus packaging plasmid, clone by aforementioned people PBX1 gene, forms through the virus packing.But this slow virus infected tumor cell also produces people PBX1 gene small molecules interference RNA, thereby suppresses the propagation of tumour cell.
Sixth aspect present invention also discloses a kind of pharmaceutical composition, contains the people PBX1 gene small molecules interference RNA or the people PBX1 gene of treating significant quantity and disturbs slow virus.
Further, said pharmaceutical composition contains the foregoing people PBX1 of 1~99wt% gene small molecules interference RNA or people PBX1 gene disturbs slow virus, and pharmaceutically acceptable carrier, thinner or vehicle.
In preparation during these compsns, usually with activeconstituents and mixed with excipients, or with the vehicle dilution, wrap in can capsule or the carrier that exists of anther sac form in.Do the time spent when vehicle plays thinner, it can be solid, semisolid or the fluent material medium as vehicle, carrier or activeconstituents.Therefore, compsn can be tablet, pill, pulvis, solution, syrup, sterilizing injecting solution etc.The example of suitable vehicle comprises: lactose, glucose, sucrose, sorbyl alcohol, N.F,USP MANNITOL, starch, Microcrystalline Cellulose, Vinylpyrrolidone polymer, Mierocrystalline cellulose, water, etc.Preparation also can comprise: wetting agent, emulsifying agent, sanitas (like methyl hydroxybenzoate and propyl ester), sweeting agent etc.
In sum; The present invention has designed 29 RNAi target sequences to people PBX1 gene; Make up corresponding PBX1RNAi carrier, wherein the RNAi carrier pGCSIL-GFP-PBX1-shRNA of encoding sequence SEQ ID NO:27 can significantly reduce the expression of PBX1 gene at mRNA level and protein level.Use slow virus (lentivirus; Be abbreviated as Lv) carry RNAi carrier pGCSIL-GFP-PBX1-shRNA as the genetic manipulation instrument and can will efficiently import people's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell, cancer of the stomach SGC7901 cell and carcinoma of the pancreas Panc-1 cell to the RNAi sequence of PBX1 gene in target ground; Reduce PBX1 expression of gene level, significantly suppress the multiplication capacity of above-mentioned tumour cell.Therefore the PBX1 gene silencing of slow virus mediation is the clinical non-operative treatment mode of malignant tumour potential.
Nucleic acid construct, slow virus that siRNA provided by the invention perhaps comprises this siRNA sequence can specificity suppress people PBX1 expression of gene; Especially slow virus; Can efficiently infect target cell, suppress PBX1 expression of gene in the target cell expeditiously, and then suppress the growth of tumour cell; Promote apoptosis of tumor cells, significant in oncotherapy.
Description of drawings
Fig. 1 representes pGCSIL-GFP DNA collection of illustrative plates.
Fig. 2 representes that the PBX1-shRNA slow virus infects people's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell, cancer of the stomach SGC7901 cell and carcinoma of the pancreas Panc-1 cell after 5 days, and the expression level of PBX1mRNA significantly reduces.
Fig. 3 representes that the PBX1-shRNA slow virus infects people's lung cancer H1299 cell after 5 days, significantly suppresses cell proliferation.
Fig. 4 representes that the PBX1-shRNA slow virus infects people's liver cancer SMMC-7721 cell after 5 days, significantly suppresses cell proliferation.
Fig. 5 representes that the PBX1-shRNA slow virus infects human breast carcinoma MCF-7 cell after 5 days, significantly suppresses cell proliferation.
Fig. 6 representes that the PBX1-shRNA slow virus infects people's cancer of the stomach SGC7901 cell after 5 days, significantly suppresses cell proliferation
Fig. 7 representes that the PBX1-shRNA slow virus infects human pancreas cancer Panc-1 cell after 5 days, significantly suppresses cell proliferation.
Fig. 8 uses the immunohistochemical methods detected result of PBX-1 antibody on the tumor tissues sample
A, b human breast carcinoma, c carcinoma of the pancreas, d, e lung cancer, f, g, h, i cancer of the stomach
Embodiment
The present invention is based on PBX1 remarkable high expression level in people's esophageal squamous cell carcinoma, prostate cancer and oophoroma tumor tissue, think that PBX1 also possibly participate in the generation and the development of people's lung cancer, liver cancer and mammary cancer.
The present invention relates to one group of small molecules interference RNA (siRNA) sequence, rna interference vector and RNA and disturbed slow virus to people PBX1 gene.Choose the target site of people PBX1mRNA coding region sequence, according to the individual base sequence design of successive 10-30 in the target site (preferred 15-27, more preferably 19-23) siRNA target sequence as siRNA.Through gene clone, the nucleic acid construct of the above-mentioned siRNA of construction expression, the slow virus of the above-mentioned siRNA of packaging expression.Cell experiment proves, above-mentioned siRNA sequence can the reticent human tumor cells of specificity in endogenous PBX1 expression of gene.
The contriver finds, adopts the propagation that can suppress tumour cell under the RNAi method after the mediator PBX1 expression of gene effectively, and this achievement in research shows that the PBX1 gene is a proto-oncogene, can be used as the target spot of oncotherapy.The contriver is further synthetic and tested multiple siRNA to the PBX1 gene; Filter out the expression that can effectively suppress PBX1 and then suppressed the siRNA of people's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell cancer of the stomach SGC7901 and carcinoma of the pancreas Panc-1 cell proliferation and growth, accomplished the present invention on this basis.
The invention provides siRNA (siRNA) sequence of a series of specificitys, but made up the slow virus of the reticent PBX1 genetic expression of specificity to people PBX1 gene.The present invention discovers, to the siRNA and the RNAi slow virus of people PBX1 gene design, stablizes also and reduces the PBX1 expression of gene specifically, and suppress the propagation of human tumor cells effectively.The present invention shows that the PBX1 gene can promote growth of tumour cell, is expected to become the target spot of early diagnosis of tumor and treatment.And, through the reticent PBX1 expression of gene of RNAi mode, can be used as the effective means that suppresses tumor development.
Mentality of designing of the present invention is:
The present invention screens through following method and obtains a kind of people PBX1 gene RNAi slow virus: from Genbank, transfer people PBX1 gene order; Prediction siRNA site; Synthetic effective siRNA sequence to the PBX1 gene, two ends contain the double-stranded DNA Oligo of restriction enzyme site cohesive end; Be connected the RNAi plasmid of construction expression PBX1 gene siRNA sequence behind the lentiviral vectors double digestion with double-stranded DNA Oligo; Assistant carrier (Packing Mix, Sigma-aldrich company) cotransfection HEKC 293T with RNAi plasmid and slow virus packing needs produces the recombinant slow virus particle, can make the slow virus of efficient reticent PBX1 gene.
Based on aforesaid method, the invention provides 29 effective target spots (specifically shown in SEQ IDNO:1-29) that disturb the PBX1 gene, made up the slow virus of special interference people PBX1 gene.
The present invention simultaneously also discloses a kind of people PBX1 gene RNAi slow virus (PBX1-RNAi) and preparation thereof and uses.
Originally discover, utilize the RNAi method of slow virus mediation, after reducing the expression of PBX1 gene in tumour cell, can effectively suppress the propagation of tumour cell.This research shows; The PBX1 gene is a proto-oncogene, can promote tumor cell proliferation, in tumour takes place and develops, has important biological function; The PBX1 gene can be the target of oncotherapy, and the PBX1 gene specific silence of slow virus mediation can be used as a kind of new tool of oncotherapy.
Further set forth the present invention below in conjunction with embodiment.Should be understood that embodiment only is used to explain the present invention, and unrestricted scope of the present invention.The reagent of the experimental technique of unreceipted actual conditions and undeclared prescription is according to normal condition among the embodiment, like works such as [U.S.A] Sambrook.J; Huang Peitang etc. translate.The molecular cloning test guide, the third edition.Beijing: the condition of the condition described in the Science Press 2002 or manufacturers's suggestion is carried out or is disposed.
Embodiment 1: to the preparation of people PBX1 gene RNAi slow virus
1. screening is to the effective siRNA target spot of people PBX1 gene
Transfer PBX1 (NM_002585) gene information from Genbank; Utilize the effective siRNA target spot of the design software Genechem design of Shanghai JiKai Gene Chemical Technology Co., Ltd to the PBX1 gene.In encoding sequence (CDS) zone of PBX1 gene, whenever at a distance from the sequence of 21 bases of an initial acquisition of base, table 1 has been listed wherein 29 effective siRNA target sequences to the PBX1 gene.
Table 1 target is in the siRNA target sequence of people PBX1 gene
The double-stranded DNA Oligo sequence (table 2) that contains AgeI and EcoRI restriction enzyme site cohesive end to the synthetic two ends of siRNA target spot (is example with SEQ ID NO:27); (Shanghai JiKai Gene Chemical Technology Co., Ltd provides, and Fig. 1), makes its linearizing, and agarose gel electrophoresis is identified endonuclease bamhi to act on the pGCSIL-GFP carrier with AgeI and EcoRI restriction enzyme.
Table 2 two ends contain the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
(it is as shown in table 4 that enzyme is cut system with the double digestion linearizing through the T4DNA ligase enzyme; 37 ℃; Reaction 1h) carrier DNA is connected with the good double-stranded DNA Oligo of purifying, in suitable buffer system (linked system is as shown in table 5), spends the night in 16 ℃ of connections, reclaims to connect product.With connecting the fresh competent escherichia coli cell that product transforms the calcium chloride preparation (conversion operation reference: molecular cloning experiment guide the; Version 55-56 page or leaf).Grow bacterium clone surface at the connection converted product and be stained with, be dissolved in 10 μ l LB substratum, mixing is got 1 μ l as template; The upstream and downstream of RNAi sequence in lentiviral vectors, design universal PC R primer upstream primer sequence: 5 '-CCTATTTCCCATGATTCCTTCATA-3 ' (SEQ ID NO:31); Downstream primer sequence: 5 '-GTAATACGGTTATCCACGCG-3 ' (SEQ ID NO:32) carries out PCR identification experiment (the PCR reaction system is like table 6-1, and reaction conditions is like table 6-2).PCR is identified that the male clone checks order and compare of analysis, be the RNAi carrier that contains SEQ ID NO:27 that makes up successfully, called after pGCSIL-GFP-PBX1-shRNA than the clone of correct.
Make up pGCSIL-GFP-control negative control plasmid, negative control siRNA target sequence is 5 '-TTCTCCGAACGTGTCACGT-3 ' (SEQ IDNO:33).When making up pGCSIL-GFP-control negative control plasmid; Synthesize the double-stranded DNA Oligo sequence (table 3) that two ends contain AgeI and EcoRI restriction enzyme site cohesive end, all same pGCSIL-GFP-PBX1-shRNA of all the other construction processs, authentication method and condition to negative control siRNA target spot.
Table 3 two ends contain the double-stranded DNA Oligo of AgeI and EcoRI restriction enzyme site cohesive end
Through the carrier of T4DNA ligase enzyme with double digestion linearizing (it is as shown in table 4 that enzyme is cut system, 37 ℃, reacts 1h)
Table 4pGCSIL-GFP plasmid enzyme restriction reaction system
Reagent | Volume (μ l) |
PGCSIL-GFP plasmid (1 μ g/ μ l) | 2.0 |
10×buffer | 5.0 |
100×BSA | 0.5 |
AgeI(10U/μl) | 1.0 |
EcoRI(10U/μl) | 1.0 |
ddH 2O | 40.5 |
Total | 50.0 |
Table 5 carrier DNA and double-stranded double-stranded DNA Oligo ligation system
Reagent | Positive control (μ l) | From connecting contrast (μ l) | Connection group (μ l) |
Linearizing carrier DNA (100ng/ μ l) | 1.0 | 1.0 | 1.0 |
Annealed double-stranded DNA Oligo (100ng/ μ l) | 1.0 | - | 1.0 |
10 * T4 phage DNA ligase enzyme damping fluid | 1.0 | 1.0 | 1.0 |
T4 phage DNA ligase enzyme | 1.0 | 1.0 | 1.0 |
ddH 2O | 16.0 | 17.0 | 16.0 |
Total | 20.0 | 20.0 | 20.0 |
Table 6-1PCR reaction system
Reagent | Volume (μ l) |
10×buffer | 2.0 |
dNTPs(2.5mM) | 0.8 |
Upstream primer | 0.4 |
Downstream primer | 0.4 |
The Taq polysaccharase | 0.2 |
Template | 1.0 |
ddH 2O | 15.2 |
Total | 20.0 |
Table 6-2PCR reaction system program setting
2. pack the PBX1-shRNA slow virus
Extract the DNA of RNAi plasmid pGCSIL-GFP-PBX1-shRNA with the plasmid extraction test kit of Qiagen company, be mixed with 100ng/ μ l storage liquid.24h before the transfection with the HEKC 293T cell of tryptic digestion logarithmic phase, is 1.5 * 10 with the DMEM perfect medium adjustment cell density that contains 10% foetal calf serum
5Cell/ml is inoculated in 6 orifice plates, and 37 ℃, 5%CO
2Cultivate in the incubator.Treat to can be used for when cell density reaches 70%-80% transfection.2h before the transfection, the original substratum of sucking-off adds the fresh perfect medium of 1.5ml.Explanation according to the MISSION Lentiviral Packaging Mix test kit of Sigma-aldrich company; In a sterilization centrifuge tube, add Packing Mix (PVM) 20 μ l; PEI 12 μ l; Serum-free DMEM substratum 400 μ l get the above-mentioned extractive DNA of 20 μ l, add to above-mentioned PVM/PEI/DMEM mixed solution.Above-mentioned transfection miscellany is at room temperature hatched 15min, be transferred in the substratum of HEKC 293T cell, 37 ℃, 5%CO
2Cultivate 16h in the incubator.Discard the developing medium that contains the transfection miscellany, the PBS solution washing adds perfect medium 2ml, continues to cultivate 48h.The collecting cell supernatant, Centricon Plus-20 centrifugal ultrafiltration device (Millipore) purifying and concentrated slow virus, step is following: (1) 4 ℃, the centrifugal 10min of 4000g removes cell debris; (2) 0.45 μ m filter filtering supernatant are in 40ml ultracentrifugation pipe; (3) 4000g is centrifugal, and 10-15min is to the concentrated volume of the virus that needs; (4) after the centrifugal end, filtering cup and following filtered solution collection cups are separated, filtering cup is tipped upside down on the sample collection cup, centrifugal 2min cf-is no more than 1000g; (5) remove Centrifuge Cup from the sample collection cup, be viral liquid concentrator in the sample collection cup.With after the viral liquid concentrator packing in-80 degrees centigrade of preservations.The siRNA sequence that contains in the virus liquid concentrator is SEQ ID NO:27.The wrapping process of contrast slow virus (control) only replaces the pGCSIL-GFP-PBX1-shRNA carrier with the pGCSIL-GFP-control carrier with the PBX1-siRNA slow virus.
Embodiment 2: the real-time fluorescence quantitative RT-PCR method detects the reticent efficient of PBX1 gene
The people's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell, people's cancer of the stomach SGC7901 cell and the human pancreas cancer Panc-1 cell that are in logarithmic phase carry out trysinization, and (cell count is about 5 * 10 to process cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to the cytogamy degree and reach about 30%.According to infecting plural number (MOI of SGC7901 and H1299 is 10, and the MOI of Panc-1, SMMC-7721 and MCF-7 is 20) value, add the virus of embodiment 1 preparation of sufficient quantity, change substratum after cultivating 24h, treat that time of infection reaches 5 days after, collecting cell.According to the Trizol process specifications of Invitrogen company, extracted total RNA.According to the M-MLV process specifications of Promega company, the RNA rt is obtained cDNA (the reverse transcription reaction system is seen table 7, and 42 ℃ are reacted 1h, and water-bath 10min makes the reversed transcriptive enzyme inactivation in 70 ℃ of water-baths then).
Adopting TP800 type Real time PCR appearance (TAKARA) to carry out real-time quantitative detects.The primer of PBX1 gene is following: upstream primer 5 '-ATCAGTGCTAATGGAGGTTGG-3 ' (SEQ ID NO:34) and downstream primer 5 '-ATCAGTTGGAGGTATCAGAGTG-3 ' (SEQ ID NO:35).With house-keeping gene GAPDH is confidential reference items, and primer sequence is following: upstream primer 5 '-TGACTTCAACAGCGACACCCA-3 ' (SEQ ID NO:36) and downstream primer 5 '-CACCCTGTTGCTGTAGCCAAA-3 ' (SEQ ID NO:37).Press the proportional arrangement reaction system in the table 8.
Table 7 reverse transcription reaction system
Reagent | Volume (μ l) |
5×RT?buffer | 4.0 |
10mM?dNTPs | 2.0 |
RNasin | 0.5 |
M-MLV-RTase | 1.0 |
DEPC?H 2O | 3.5 |
Total | 11.0 |
Table 8Real-time PCR reaction system
Reagent | Volume (μ l) |
SYBR?premix?ex?taq: | 10.0 |
Upstream primer (2.5 μ M): | 0.5 |
Downstream primer (2.5 μ M): | 0.5 |
cDNA | 1.0 |
ddH 2O | 8.0 |
Total | 20.0 |
Setting program is two-step approach Real-time PCR: sex change is 95 ℃ in advance, 15s; 95 ℃ of each step sex change afterwards, 5s; Annealing is extended 60 ℃, 30s; Carry out 45 circulations altogether.Read light absorption value in the extension stage at every turn.After PCR finished, 95 ℃ of sex change 1min were cooled to 55 ℃ then, and the dna double chain is fully combined.Since 55 ℃ to 95 ℃, each step increases by 0.5 ℃, keeps 4s, reads light absorption value simultaneously, makes melting curve.Adopt 2-
Δ Δ CtAnalytical method is calculated the expression abundance that has infected PBX1mRNA.The cell that infects contrast virus (control) is as contrast.Experimental result (Fig. 2) shows, the PBX1mRNA expression level of people's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell, people's cancer of the stomach SGC7901 cell and human pancreas cancer Panc-1 cell 58.7%, 87.6,90.3%, 78.6% and 44.4% (result sees Fig. 2) that descended respectively.
Embodiment 3: the multiplication capacity that detects the tumour cell that infects the PBX1-shRNA slow virus
The people's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell, people's cancer of the stomach SGC7901 cell and the human pancreas cancer Panc-1 cell that are in logarithmic phase carry out trysinization, and (cell count is about 5 * 10 to process cell suspension
4/ ml) be inoculated in 6 orifice plates, be cultured to the cytogamy degree and reach about 30%.According to infecting plural number (MOI, the MOI of H1299 and SGC7901 are 10, and the MOI of Panc-1, SMMC-7721 and MCF-7 is 20); The PBX1-shRNA virus that adds sufficient quantity; Change substratum after cultivating 24h, treat that time of infection reaches 5 days after, collect each the experimental group cell that is in logarithmic phase.The resuspended one-tenth cell suspension (2 * 10 of perfect medium
4/ ml), be about 2000/hole with cell density, inoculate 96 orifice plates.Every group 5 multiple holes, every hole 100 μ l.After completing plate, put 37 ℃, 5%CO
2Incubator is cultivated.Beginning in second day behind the bed board, read plate once with Cellomics instrument (Thermo Fisher) detection every day, and continuous detecting was read plate 5 days.Through the input parameter of adjustment Cellomics arrayscan, calculate the quantity of the cell of the band green fluorescence in each scanning orifice plate exactly, data are carried out Statistic Plotting, draw cell proliferation curve (result such as Fig. 3-shown in Figure 7).The result shows; People's lung cancer H1299 cell, liver cancer SMMC-7721 cell, mammary cancer MCF-7 cell and human pancreas cancer Panc-1 cell that the PBX1-shRNA slow virus is infected are in vitro culture after 5 days; The vigor cell number has descended 78.2%, 89.0%, 99.9%, 76% and 93% respectively; Show that the PBX1 gene silencing causes the tumor cell proliferation ability to be suppressed, the PBX1 gene is participated in the malignant proliferation of tumour cell.
The test of PBX-1 gene overexpression in embodiment 4 tumour cells
Tissue samples: human pancreas cancer, mammary cancer, lung cancer, the tissue samples of cancer of the stomach
PBX-1 antibody: available from Sigma company
TP:
Take out organization chip, organization chip was toasted 30 minutes in 60 ℃ of thermostat containers.To the organization chip dewaxing, dewaxing process is then: YLENE 15 minutes, and YLENE: ethanol=mix in liquid at 1: 1, in the absolute ethyl alcohol, in 95% ethanol, in 85% ethanol, in 75% ethanol, soaked in the zero(ppm) water 10 minutes successively; Then with zero(ppm) water or the fresh 3%H of PBS configuration
2O
2, room temperature sealing 10 minutes; Antigen retrieval is put into organization chip to boiling in high fire heating 0.01M sodium citrate buffer (pH6.0) in the microwave oven, and low fire was kept 20 minutes; After naturally cooling to room temperature, insert in the zero(ppm) water and soaked 10 minutes; 10% serum (TBS preparation) sealing 30 minutes; Serum is abandoned in suction, does not wash to add PBX-1 antibody (dilution in 1: 100) incubated overnight; TBS washes 2 times, each 5 minutes; The goat-anti rabbit two that adds the HRP mark is anti-, incubated at room 60 minutes; TBS washes 4 times, each 5 minutes; Add DAB dyeing, up to show light yellow till, put into the zero(ppm) water termination reaction; Soaked 30 seconds clear water rinsing 7-8 time with bush; The dehydration mounting, in 75% ethanol, 85% ethanol, 95% ethanol, absolute ethyl alcohol, YLENE: ethanol=mix liquid at 1: 1, in the YLENE, soak successively and put 5 minutes; After the taking-up, drip the 30ul neutral gum, use the deckglass mounting, dry, observations is taken pictures.(result such as Fig. 8)
The result shows:
Use PBX-1 antibody that different tumor tissues are carried out the immunohistochemical methods detection of expression, result's discovery, at human pancreas cancer, mammary cancer, lung cancer in the tissue samples of cancer of the stomach, can both be found the high expression level of PBX-1 gene coded protein.The representative of figure Oxford gray is expressed positive.
Based on this experimental result, think and to come the auxiliary diagnosis cancer through detecting histocyte PBX-1 expression of gene.
Claims (14)
1. people PBX1 gene is in the anti-tumor medicine of preparation or screening lung cancer, liver cancer, mammary cancer, cancer of the stomach and carcinoma of the pancreas, the perhaps purposes in the medicine for preparing diagnosing tumor lung cancer, liver cancer, mammary cancer, cancer of the stomach and carcinoma of the pancreas.
2. isolating people PBX1 gene small molecules interference RNA target fragment, its sequence is any sequence among the SEQ ID NO:1-29.
3. people PBX1 gene small molecules interference RNA; Can specificity reticent people PBX1 expression of gene, said people PBX1 gene small molecules interference RNA is with arbitrary sequence of being selected from SEQ ID NO:1-29 target sequence as the reticent people PBX1 of specificity genetic expression.
4. like the said people PBX1 of claim 3 gene small molecules interference RNA; It is characterized in that; Said people PBX1 gene small molecules interference RNA comprises just RNA fragment and sense-rna fragment; Said just RNA fragment and said sense-rna fragment complementation, said just RNA fragment contains the RNA of the arbitrary sequence encoding among the SEQ ID NO:1-29.
5. like the said people PBX1 of claim 4 gene small molecules interference RNA, it is characterized in that said just RNA fragment and the segmental length of sense-rna are 15-27 Nucleotide.
6. like the said people PBX1 of claim 5 gene small molecules interference RNA, it is characterized in that said people PBX1 gene small molecules interference RNA is the hair clip type single stranded RNA, separate by stem ring plate section in the middle of said just RNA fragment and the said sense-rna fragment.
7. like the said people PBX1 of claim 6 gene small molecules interference RNA, it is characterized in that said stem ring fragments sequence is selected from following arbitrary: UUCAAGAGA, AUG, CCC, UUCG, CCACC, CTCGAG, AAGCUU, CCACACC.
8. like the said people PBX1 of claim 3 gene small molecules interference RNA, it is characterized in that the sequence of said people PBX1 gene small molecules interference RNA is SEQ ID NO:30.
9. people PBX1 gene RNA construct comprises the gene fragment of the said people PBX1 of the coding arbitrary claim of claim 3-8 gene small molecules interference RNA, can expressing human PBX1 gene small molecules interference RNA.
10. like the said people PBX1 of claim 9 gene RNA construct, it is characterized in that said people PBX1 gene RNA construct behaviour PBX1 gene disturbs lentiviral vectors.
11. like the said people PBX1 of claim 10 gene RNA construct; It is characterized in that said lentiviral vectors is selected from: arbitrary among pLKO.1-puro, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, pLP/VSV-G, pENTR/U6, pLenti6/BLOCK-iT-DEST, pLenti6-GW/U6-laminshrna, pcDNA1.2/V5-GW/lacZ, pLenti6.2/N-Lumio/V5-DEST, pGCSIL-GFP or the pLenti6.2/N-Lumio/V5-GW/lacZ.
12. a people PBX1 gene disturbs slow virus, disturbs lentiviral vectors down auxiliary in slow virus packaging plasmid, clone by the said people PBX1 of the arbitrary claim of claim 9-11 gene, forms through the virus packing.
13. pharmaceutical composition; Contain the arbitrary claim of the claim 3-8 that treats significant quantity said people PBX1 gene small molecules interference RNA or the said people PBX1 of claim 12 gene and disturb slow virus, and pharmaceutically acceptable carrier, thinner or vehicle.
14., it is characterized in that said tumour is a malignant tumour like the said pharmaceutical composition of claim 13, be selected from the arbitrary of lung cancer, liver cancer, mammary cancer, cancer of the stomach and carcinoma of the pancreas.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210005699.1A CN102534003B (en) | 2011-12-19 | 2012-01-10 | The purposes of people PBX1 gene and related drugs thereof |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201110427758.X | 2011-12-19 | ||
CN201110427758 | 2011-12-19 | ||
CN201210005699.1A CN102534003B (en) | 2011-12-19 | 2012-01-10 | The purposes of people PBX1 gene and related drugs thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102534003A true CN102534003A (en) | 2012-07-04 |
CN102534003B CN102534003B (en) | 2016-01-13 |
Family
ID=46342026
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210005699.1A Active CN102534003B (en) | 2011-12-19 | 2012-01-10 | The purposes of people PBX1 gene and related drugs thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102534003B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115192600A (en) * | 2022-08-25 | 2022-10-18 | 吉林大学 | Application of antisense oligonucleotide of targeted PBX1 promoter region G-quadruplex in preparation of drugs for treating melanoma |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006089091A2 (en) * | 2005-02-18 | 2006-08-24 | Memorial Sloan-Kettering Cancer Center | Methods for detecting minimum residual disease |
WO2009045443A2 (en) * | 2007-10-02 | 2009-04-09 | The University Of Rochester | Methods and compositions related to synergistic responses to oncogenic mutations |
CN102229928A (en) * | 2011-05-11 | 2011-11-02 | 上海吉凯基因化学技术有限公司 | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof |
-
2012
- 2012-01-10 CN CN201210005699.1A patent/CN102534003B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006089091A2 (en) * | 2005-02-18 | 2006-08-24 | Memorial Sloan-Kettering Cancer Center | Methods for detecting minimum residual disease |
WO2009045443A2 (en) * | 2007-10-02 | 2009-04-09 | The University Of Rochester | Methods and compositions related to synergistic responses to oncogenic mutations |
CN102229928A (en) * | 2011-05-11 | 2011-11-02 | 上海吉凯基因化学技术有限公司 | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof |
Non-Patent Citations (2)
Title |
---|
K SHIRAISHI1等: "Pre-B-cell leukemia transcription factor 1 is a major target of promyelocytic leukemia zinc-finger-mediated melanoma cell growth suppression", 《ONCOGENE》, vol. 26, 24 July 2006 (2006-07-24), pages 339 - 347 * |
NCBI: "对比文件2中序列比对结果", 《BLAST》, 24 August 2006 (2006-08-24), pages 1 - 3 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115192600A (en) * | 2022-08-25 | 2022-10-18 | 吉林大学 | Application of antisense oligonucleotide of targeted PBX1 promoter region G-quadruplex in preparation of drugs for treating melanoma |
Also Published As
Publication number | Publication date |
---|---|
CN102534003B (en) | 2016-01-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102277434B (en) | The purposes of people ZFX gene and related drugs thereof | |
CN103173529B (en) | Associated use of human NLK (Neuroleukin) gene and associated medicines | |
CN103421886A (en) | Applications of CIZI gene and relevant medicines | |
CN102433383B (en) | Applications and correlated medicament of human STIM1 gene | |
CN110917357B (en) | Application of human GSDMB gene and related product | |
CN102559895B (en) | The purposes of people NOB1 gene and related drugs thereof | |
CN102534003A (en) | Applications of human pre-B-cell leukemia homeobox 1 (PBX1) gene and related drugs thereof | |
CN104894223A (en) | Use and related drugs of human COPB2 gene | |
CN103305596B (en) | The purposes and its related drugs of people's RNF138 genes | |
CN103468785A (en) | Uses and relevant drugs of human SEMA4C (semaphorin 4C) gene | |
CN102552937B (en) | The purposes of people PAK7 gene and related drugs thereof | |
CN104928354A (en) | Applications of human PTP4A3 gene and related drugs thereof | |
CN103656674A (en) | Use of human eIF5B gene and related drug thereof | |
CN103667422B (en) | The purposes and its related drugs of people's CUL4B genes | |
CN102533982B (en) | The novelty teabag of people KLF8 gene in oncotherapy | |
CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
CN103157115B (en) | The purposes of people RHBDD1 gene and related drugs thereof | |
CN103667430B (en) | A kind of purposes and its related drugs of eight polynucleotides binding protein expression gene | |
CN103468786B (en) | The purposes and its related drugs of people's CDKL3 genes | |
CN103667424A (en) | Usage of human EIF3H gene and related medicaments | |
CN108342389A (en) | The purposes and its related drugs of PLEKHO1 genes | |
CN103421887B (en) | The purposes and its related drugs of CIT gene | |
CN110938630B (en) | Application of human B3GNT5 gene and related products | |
CN103656673B (en) | The purposes and its related drugs of people's YWHAQ genes | |
CN103623426B (en) | The purposes and its related drugs of people's PPP5C gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
TR01 | Transfer of patent right |
Effective date of registration: 20200602 Address after: 201203 room 101-7, No. 332, Edison Road, China (Shanghai) pilot Free Trade Zone, Pudong New Area, Shanghai Patentee after: SHANGHAI JIBEI BIOTECHNOLOGY Co.,Ltd. Address before: 200233, room 680, 619-21 Guiping Road, Shanghai, Xuhui District Patentee before: SHANGHAI GENECHEM Co.,Ltd. |
|
TR01 | Transfer of patent right |