CN102363632A

CN102363632A - Pesticide Bt protein Cry8Kb1 and coding gene and use thereof

Info

Publication number: CN102363632A
Application number: CN2011103520790A
Authority: CN
Inventors: 朱军; 李平; 郑爱萍; 梁红霞; 王世全; 邓其明; 李双成; 王玲霞; 刘怀年
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2011-11-09
Filing date: 2011-11-09
Publication date: 2012-02-29

Abstract

The invention provides a new Bt protein Cry8Kb1 and a coding gene thereof. The protein has an amino acid sequence represented by SEQ ID No.2 or an amino acid sequence which has one or more amino acids substituted, lost and/or added compared with the amino acid sequence represented by SEQ ID No.2 and has the same activity. The Bt protein Cry8Kb1 provided by the invention can be used for preparing Bt pesticide, and the gene coding the protein can be used for converting various plants such as grains, cotton, oil, vegetable and other economic crops, flowers and lawns to enable the plants to have a corresponding anti-pest activity, so the dose of pesticide can be reduced and environment pollution can be reduced. The Bt protein Cry8Kb1 has a high economic value and a bright application prospect.

Description

A kind of disinsection Bt protein Cry8Kb1, its encoding sox and application

Technical field

The present invention relates to biological technical field, be specifically related to a kind of new Bt albumen and encoding sox and application.

Background technology

In the human being's production process, insect pest is the important factor that causes agriculture prodn loss and influence human health, adds up according to FAO, and the financial loss that whole world agriculture prodn every year causes because of insect pest is up to 14%, and disease is with a toll of 12%, and crop smothering is with a toll of 11%.The amount of loss is equivalent to the half the of the Chinese agriculture gross output value, more than 4 times of Britain up to 1,260 hundred million dollars.The agriculture insect mainly concentrates among lepidopteran and the Homoptera, and part insect in the Coleoptera scarab beetle Superfamily is like grub; Also be important worldwide distribution subterranean pest-insect, endanger seed and seedling that dicotyledonous and unifacial leaf food crop, various vegetables, oil plant, taro, cotton, herbage and flowers and fruit, woods etc. are sowed, and the phase of causing harm be long; All can cause harm from being seeded into results; Cause the disconnected ridge that is short of seedling, even total crop failure, also can influence quality.A large amount of investigation show that grub is caused harm and ranks first in subterranean pest-insect, account on the 70-80% of total subterranean pest-insect amount.Mainly contain Holotrichia parallela (Holotrichia parallela Motschulsky), holotrichia oblita (Holotrichia oblita faldermann), anomala corpulenta (Anomala carpulenta Motsch) etc., harm is comparatively serious on China North China such as Hebei, Shandong and other places.

Bacillus thuringiensis (Bacillus thuringiensis is called for short Bt) is a kind of gram positive bacterium, and its distribution is very extensive;, gemma can form the parasporal crystal of forming by protein when forming with insecticidal activity; Have another name called insecticidal crystal protein (Insectididal crystal proteins is called for short ICPs), ICPs is by the cry genes encoding; This albumen has strong toxicity to sensitive insect, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide in the control of agricultural pests, injurious forest-insect and sanitary insect pest, and Bt still be that transgenic pest-resistant engineered plant important function of gene is originated.

From strain HD-1Dipel, cloned since first can express the gene of insecticidal activity from Schnepf in 1981; People separating clone the gene of more than 470 kind of ICPs; They are confirmed as different crowd, subgroup, class and subclass (Crickmore N. respectively according to the amino acid sequence coded homology; Et al.1998.Microbiol Mol Biol Rev, 62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).The Bt gene of finding so far that grub is had an insecticidal activity mainly contains genoid (Shu C. such as cry3, cry8, cry18, cry23, cry37, cry43; Et al.2009.Current Microbiology; 58 (4): 389-392.), wherein studying maximum is the cry8 genoid, and the cry8 genoid is made up of 1160-1210 amino acid; Molecular weight is 128-137kDa; To multiple coleopteran pests such as Scarabaeidae, Culculionidae, Chrysomelidae have special insecticidal activity (Crickmore N., et al.1998.Microbiol Mol Biol Rev, 62:807-813).1992; Ohba etc. filter out new bacterial strain (Bt.subsp.japonensis BuiBui) (the Ohba M. that the chafer larva is had special insecticidal activity in the world first from the Bt bacterial strain; Et al.1992.Letters in Applied Microbiology; 14:54-57), therefrom cloned a kind of new killing gene cry8Ca (Sato R., et al.1994.Curr.Microbiol.28:15-19) in 1994.U.S. Mycogen company has tangible insecticidal activity (US Patent 5554534) from isolating Cry8Aa1 of Bt bacterial strain PS50C and Cry8Ba1 to brevitarsis Cotinis sp.The U.S. has separated two kinds of gene cry8Bb1 and cry8Bc1 gene from the Bt bacterial strain; Discovery is to colorado potato bug; The west corn root leaf A, the chrysomelid exploitation (Abad, et al.2002.WO 02/34774 A2) that has significant insecticidal effect and be used for transgenic insect-resistant corn of southern corn root.In China; The screening successively in recent years of Plant Protection Office of Hebei Academy of Agricultural Sciences and Agricultural University Of Hebei obtains the Bt bacterial strain that many strains have special insecticidal activity to the larva of yellowish-brown rutelian (A.exoleta) and anomala corpulenta (A.corpulenta); The indoor biometrics mortality ratio all reach 100% (Feng Shuliang etc. a strain has the new strain isolated of Bacillus thuringiensis of insecticidal activity to cockchafer subclass larva. the Chinese biological control; 2000,16 (2): 74-78).The Bt185 of plant protection institute of the Chinese Academy of Agricultural Sciences had separated a strain to the efficient (LC50 of Holotrichia parallela larva in 2004; 0.94cfu/ml) bacterial strain Bt185, and therefrom cloned four cry8 genoids that kind is new: cry8Ea1, cry8Ea2; Cry8Fa1, cry8Ha1.This type of killing gene of the overwhelming majority has all been carried out patent protection by research mechanism of external section or seeds company at present; Therefore, these Bt resources are excavated and exploitation is a urgent and valuable job, had independent intellectual property right, make up and insect-resistant transgenic plants all has important significance for theories and using value for gene clone, engineering bacteria.

Find the history in existing so far more than 100 year of Tribactur from the beginning of this century, aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, be widely used, also play good effect.But the inevitable outcome that makes single Bt insecticidal proteins continually is the adaptation because of insect produces the resistance to the Cry proteinoid; At present, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.Begin mid-term 80 year last century; Resistance problem (the Mc Gaughey W.H. that constantly in laboratory and field test, is confirmed; 1985.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to receive the selective pressure of sterilant for a long time.1985, Mc Gaughey report warehouse grain pest Indian meal moth (Plodia interpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety; The small cabbage moth that confirms big Tanaka in Hawaii has first produced tangible resistance (Tabashnik B.E. to the Bt sterilant; Et al.1994.Proc.Natl.Acad.Sci.USA.91:4120-4124); Since the nineties in last century,, found that the Bt sterilant obviously descends to the small cabbage moth control effect on China Application of B t sterilant time long Shenzhen and Guangzhou, Shanghai and other places; Mean resistance form (Feng Xia .1996. Guangdong small cabbage moth is to the resistance research of Bacillus thuringiensis. insect journal, 39 (3): 238-244; Hofte H., et al.1988.Appl.Environ.Microbiol.54:2010-2017).Find at present in the laboratory and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance; Arrive with the selective pressure mathematical model prediction; Under the condition of Bt transgenic anti-insect plants selective pressure; Insect will produce resistance (Schnepf E., et al.1998.Mol.Biol.Rev.65 (3): 775-806).

Be the loss of avoiding resistant insects to cause, seeking new high virulence Bt bacterial strain and genetic resources is the effective way that addresses this problem, and this biological control to China also has crucial meaning.

Summary of the invention

First purpose of the present invention is to provide a kind of new Bt virulence protein resource, to overcome above-mentioned deficiency.

Second purpose of the present invention is to provide the gene of encoding said proteins.

The present invention also aims to provide the application of above-mentioned albumen and gene.

The present invention separates the new bacterial strain ST8 of bacillus thuringiensis that obtains from the soil of Sichuan Province's Chengdu Plain area.This bacterial strain has been deposited in (address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, China Committee for Culture Collection of Microorganisms common micro-organisms center on June 12nd, 2010; Institute of Microorganism, Academia Sinica; Postcode 100101) preservation; Classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCCNo.3923.

Through the virulence test shows to ST8, ST8 is to no insecticidal activities such as lepidopteran bollworm, beet armyworms; Coleopteron had higher insecticidal activity.According to 1 pair of universal primer of cry8 genoid conserved sequence design, its genomic dna that increases, the result shows that there is the cry8 genoid in this bacterial strain; Further its full-length gene primer of design is cloned and is obtained the cry8Kb1 gene, and its nucleotide sequence is shown in sequence table SEQ ID No.1; Total length is 3510bp; Analysis revealed, GC content are 37.35%, the albumen that 1169 amino acid of encoding are formed.Through measuring, its aminoacid sequence is shown in SEQ ID No.2.By the definite designation of international Bt insecticidal crystalline gene NK is Cry8Kb1.The proteic amino acid of Cry8Kb1 is formed like table 1.This proteic active site is positioned at (2) section.

The proteic amino acid of table 1Cry8Kb1 is formed

Amino acid	Per-cent %	Amino acid	Per-cent %
				Ala(A)：	6.59	Met(M)：	1.28
Cys(C)：	0.26	Asn(N)：	7.53
				Asp(D)：	5.13	Pro(P)：	4.28
Glu(E)：	7.10	Gln(Q)：	4.70
				Phe(F)：	3.42	Arg(R)：	4.62
Gly(G)：	6.84	Ser(S)：	6.84
				His(H)：	1.11	Thr(T)：	8.13
Ile(I)：	6.24	Val(V)：	6.07
				Lys(K)：	4.28	Trp(W)：	1.45
Leu(L)：	8.38	Tyr(Y)：	5.73

Be to be understood that; Those skilled in the art can be according to the aminoacid sequence (SEQ ID No.2) of PROTEIN C ry8Kb1 disclosed by the invention; Do not influencing under its active prerequisite, replacing, lack and/or increase one or several amino acid, obtaining said proteic mutant nucleotide sequence.For example, the 22nd Asn is replaced with Ala, the 30th Ala is replaced with Ser,,, do not influence its activity Gln of the 86th increase or increase Trp with the 70th Thr disappearance at nonactive section.Therefore, Bt PROTEIN C ry8Kb1 of the present invention also comprises aminoacid sequence shown in the SEQ ID No.2 through replacing, replace and/or increasing one or several amino acid, has the equal active protein of being derived and being obtained by Cry8Kb1 with Bt PROTEIN C ry8Kb1.

Gene of the present invention comprises the nucleotide sequence of encoding said proteins Cry8Kb1.

The invention provides the gene of the above-mentioned Bt PROTEIN C ry8Kb1 of coding, its nucleotide sequence is shown in sequence table SEQ ID NO.1.

In addition, should be understood that the degeneracy of considering codon and the preferences of different plant species codon, those skilled in the art can use as required and be fit to the codon that specific species are expressed.

Gene of the present invention can be cloned or separate from bacterial strain ST8 with protein and obtained, and perhaps obtains through DNA or peptide synthetic method.

Can gene of the present invention be operably connected with expression vector; Obtain to express the proteic recombinant expression vector of the present invention; And then can said expression vector be imported host, the transformant that obtains changeing the cry8Kb1 gene through such as transgenic methods such as agrobacterium-mediated transformation, particle bombardment, pollen tube passage methods; For example plant such as farm crop or fruit tree makes it possess anti-insect activity.

In one embodiment of the invention, the acquisition of Bt PROTEIN C ry8Kb1 recombinant expression vector is to obtain recombinant expression vector pET-8K through the cry8Kb1 gene being inserted into last structure of expression vector pET-32a (+).

In addition, can also obtain containing the proteic fermented liquid of Cry8Kb1, it is prepared into sterilant, be used for the control of crop pests through fermentation bacterial strain ST8 of the present invention.Those skilled in the art can also be with said gene transform bacteria or fungi, through large scale fermentation production Bt albumen of the present invention.Therefore the invention provides Bt PROTEIN C ry8Kb1 or its encoding sox cry8Kb1 or contain the application of recombinant expression vector in the preparation sterilant of this gene.

The present invention also provides Bt PROTEIN C ry8Kb1 or its encoding sox cry8Kb1 or has contained the application of recombinant expression vector in improving plant resistance to insect of this gene.

The application of the recombinant expression vector that the invention provides Bt PROTEIN C ry8Kb1 or its encoding sox cry8Kb1 or contain this gene in the preparation transgenic plant.

Those skilled in the art can also with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity according to cry8Kb1 gene disclosed by the invention.

It is a kind of new Bt albumen that the present invention provides Cry8Kb1 albumen, has insecticidal activity preferably, uses it for the preparation transgenic plant, can the specific killing insect, and reduce the usage quantity of agricultural chemicals, and reduce cost, reduce environmental pollution.Also do not have at present insect or the insect report to this albumen generation resistance, therefore, Bt PROTEIN C ry8Kb1 of the present invention has important economic value and application prospect, is fit to large-scale application in the insect-resistance that improves plant.

Description of drawings

Fig. 1 is the pcr amplification electrophorogram as a result of cry8Kb1 gene, M.DNAmarker wherein, 1.cry8Kb1 gene;

Fig. 2 is that the enzyme of recombinant plasmid PET-8K is cut evaluation figure, 1. recombinant plasmid pET-8K, 2.SacI+NotI double digestion pET-32a, 3.Sac I+Not I double digestion pET-8K, the DNA that 4. inserts, M.DNA marker;

Fig. 3 is that the SDS-PAGE of cry8Kb1 gene in E.coli BL21 (DE3) detects, M. albumen marker wherein, the 1. expression of empty carrier (pET-32a) in E.coii BL21 (DE3), 2. lysate supernatant, 3. the Cry8Kb1 albumen in the inclusion body.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Under the situation that does not deviate from the present invention's spirit and essence, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.

If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.

The clone of embodiment 1cry8Kb1 gene

The present invention separates the new bacterial strain ST8 of bacillus thuringiensis that obtains from the soil of Sichuan Province's Chengdu Plain area; This bacterial strain on June 12nd, 2010 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; Institute of Microorganism, Academia Sinica; Postcode 100101) preservation, classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCCNo.3923.

Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain ST8.And the design primer sequence is following:

P1：5’ATGAGTCCAAATAATCAAAAT?3’

P2：5’TTACTCTACGTCAACAATTAA?3’

25 μ l PCR reaction systems:

Thermal cycle reaction: 94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 1min, 43 ℃ of annealing 50s, 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 10min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes the pcr amplification result in the gel imaging system.The result is as shown in Figure 1, has obtained being about the sequence of 3510bp through amplification, and this sequence is checked order, and its nucleotide sequence is shown in SEQ ID No.1, and is consistent with aim sequence.

The proteic acquisition of embodiment 2Cry8Kb1

According to cry8Kb1 gene ORFs two terminal sequences, design and synthesize a pair of Auele Specific Primer: cry8R:5 '-CG GAGCTCATGAGTCCAAATAATCAAAAT-3 '; Cry8F:5 '-ATTTG CGGCCGCTTACTCTACGTCAACAATTAA-3 ',

5 ' end primer underscore part base is respectively Sac I and Not I restriction enzyme site.With ST8DNA is that template increases, and the product of amplification adopts Sac I and Not I to carry out double digestion, and the carrier pET-32a (+) after enzyme is cut product and carried out double digestion equally is connected, and Transformed E .coliDH5 α competent cell is with recombinant plasmid called after pET-8K.The checking of the restriction enzyme digestion and electrophoresis of recombinant plasmid is inserted the segment size and is met (Fig. 2) after the purpose fragment, changes recipient bacterium E.coli.BL21 (DE3) again over to, contains the recon called after E.coli.BL21 (8k) of recombinant plasmid.Positive transformant transfer then in the LB substratum, under 210r/min, 37 ℃ of culture condition, work as OD ₆₀₀Value is 0.6 o'clock, adds 0.6mmol/L IPTG and carries out abduction delivering 20h.In the deposition of SDS-PAGE analysis revealed cry8Kb1 expression of gene product after the thalline ultrasonication (Fig. 3), molecular weight is about about 131kDa, conforms to the molecular weight of albumen of prediction.

The proteic pest-resistant effect of embodiment 3Cry8Kb1

The cry8Kb1 gene expression product carries out insecticidal activity assay to bollworm, Holotrichia parallela and holotrichia oblita respectively.

To lepidoptera pest: Cry8Kb1 albumen is mixed with from 1 μ g/ml to 100ng/ml6 different concns, and the old tender moderate Caulis et Folium Brassicae capitatae blade of choosing is cleaned, and dries; Uv lamp is irradiation 15min down, is cut into 2 * 2cm ²Size divides to be placed in the different concns Cry8Kb1 protein liquid, soaks 5min; Take out drop and go excess liquid, be placed in the disinfectant petridish and dry, the blade that soaks with the LB liquid nutrient medium is as contrast, and each petridish is put 4 blades; 30 of healthy 2-3 bollworms in age are put in choosing; Every processing repetition 3 times, put indoor, in 3d " Invest, Then Investigate " larva death condition, with SPSS 10.0 computed in software LC ₅₀

To coleopteran pest: with Cry8Kb1 albumen according to Cry8Kb1 albumen being mixed with 0.1,4,6 different concentration gradients such as 8,16,32,64 μ g/mL.Then diluent is joined mixing in the sterilization fine earth of even thickness potato silk; Try the worm master with 5-7 age in days Holotrichia parallela and holotrichia oblita as confession; Each processing connects 30 of worms, repeat 3 times, with the processing that adds clear water as blank; 7d is raised in infection, 14d checks dead borer population, with SPSS 10.0 computed in software LC ₅₀The result shows: expression product does not have insecticidal activity basically to beet armyworm, bollworm, and Beijing University to China deceives the active best of gill cockchafer, LC ₅₀Be 30.3 μ g/g.

Claims

1. disinsection Bt protein Cry8Kb1, its aminoacid sequence is:

1) aminoacid sequence shown in the SEQ ID No.2; Or

2) aminoacid sequence shown in the SEQ ID No.2 is through replacing, lack and/or increase the aminoacid sequence with same function of one or more amino-acid residues formation.

2. coding claim 1 said proteic gene.

3. gene as claimed in claim 2, its nucleotide sequence is shown in SEQ ID No.1 in the sequence table.

4. the recombinant expression vector that contains claim 2 or 3 said genes.

5. by the said expression vector transformed host cells of claim 4.

6. host cell as claimed in claim 5, it is a plant host cell.

7. contain the said proteic sterilant of claim 1.

8. the described albumen of claim 1 or its encoding sox or the said expression vector of claim 4 application in the preparation sterilant

9. the described albumen of claim 1 or its encoding sox or the said expression vector of claim 4 application in the preparation transgenic plant.

10. the described albumen of claim 1 or its encoding sox or the said expression vector of claim 4 application in improving plant resistance to insect.