CN101711152A - MC-1R, MC-2R and/or [mu stimulation - Google Patents
MC-1R, MC-2R and/or [mu stimulation Download PDFInfo
- Publication number
- CN101711152A CN101711152A CN200880019188A CN200880019188A CN101711152A CN 101711152 A CN101711152 A CN 101711152A CN 200880019188 A CN200880019188 A CN 200880019188A CN 200880019188 A CN200880019188 A CN 200880019188A CN 101711152 A CN101711152 A CN 101711152A
- Authority
- CN
- China
- Prior art keywords
- skin
- extract
- opposing
- improve
- active substance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/21—Esters, e.g. nitroglycerine, selenocyanates
- A61K31/215—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids
- A61K31/216—Esters, e.g. nitroglycerine, selenocyanates of carboxylic acids of acids having aromatic rings, e.g. benactizyne, clofibrate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
- A61K31/343—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/13—Coniferophyta (gymnosperms)
- A61K36/14—Cupressaceae (Cypress family), e.g. juniper or cypress
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/24—Apocynaceae (Dogbane family), e.g. plumeria or periwinkle
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/28—Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/48—Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/53—Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/73—Rosaceae (Rose family), e.g. strawberry, chokeberry, blackberry, pear or firethorn
- A61K36/736—Prunus, e.g. plum, cherry, peach, apricot or almond
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/75—Rutaceae (Rue family)
- A61K36/752—Citrus, e.g. lime, orange or lemon
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/88—Liliopsida (monocotyledons)
- A61K36/888—Araceae (Arum family), e.g. caladium, calla lily or skunk cabbage
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/88—Liliopsida (monocotyledons)
- A61K36/90—Smilacaceae (Catbrier family), e.g. greenbrier or sarsaparilla
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9755—Gymnosperms [Coniferophyta]
- A61K8/9761—Cupressaceae [Cypress family], e.g. juniper or cypress
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9789—Magnoliopsida [dicotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
- A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
- A61K8/9783—Angiosperms [Magnoliophyta]
- A61K8/9794—Liliopsida [monocotyledons]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/16—Emollients or protectives, e.g. against radiation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
- A61K2236/333—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones using mixed solvents, e.g. 70% EtOH
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Biotechnology (AREA)
- Alternative & Traditional Medicine (AREA)
- Medical Informatics (AREA)
- Birds (AREA)
- Dermatology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Emergency Medicine (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Toxicology (AREA)
- Cosmetics (AREA)
- Medicines Containing Plant Substances (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The present invention relates in Skin Cell to regulate the receptor (MC-1R, MC-2R and [mu) of pomc gene product expression, and regulate the active substance of the expression of POMC possibly, relate to the propagation and the differentiation of reconciliation statement chrotoplast especially, with form epithelium again, keep innervation, nourishes rough skin or opposing are old and feeble or regulate chromogenesis independently or skin is aging.The present invention also relates to screen the method for this type of active substance.
Description
The present invention relates to regulate neural mediation receptor expression by POMC (proopiomelanocortin) gene code, and the active component of regulating corresponding neurohumoral expression possibly.The invention still further relates to the purposes of compositions, said composition comprises at least a neural mediation receptor that pomc gene is encoded at the activated material of the expression of skin level, and a kind of method of screening this type of active component.
Current understanding to theme of the present invention:
Skin has sensory function, therefore is that individual information is originated at first.Peripheral nervous is responsible for the innervation of skin, and they have aixs cylinder, and its cyton distributes along spinal cord.The cutaneous nerve domination comprises, particularly comprises sensory nerve and autonomous sympathetic fiber.The epidermis free nerve endings is unique sensory fiber that gos deep into epidermis inside.There is a kind of important exchange between Skin Cell and cutaneous nerve.The synthetic neurotransmitter (paracrine approach) that acts on cutaneous nerve unit in a large number of Skin Cell.Skin Cell also has the corresponding receptor of some neurotransmitter that discharges with neurocyte and Skin Cell self; Therefore Skin Cell can be accepted these neurotransmitters and they are reacted.
The imbalance of skin aging and skin cell metabolism is relevant, it is characterized by that keratinocyte propagation reduces, keratinocyte differentiation imbalance, dead cell is piled up and the cutaneous nerve domination reduces.
((β-LPH) and β endorphins are the neuro hormone that proopiomelanocortin (POMC) single-gene produces for α-MSH), thyroliberin (ACTH), β lipotropin for α-MSH or α-melanotropin.They are mainly synthetic in hypophysis cerebri, but discovery (WintzenM, Yaar M, Burbach JP, Gilchrest BA.J Invest Dermatol (Dermatology research magazine) .1996 April is also arranged in many peripheral tissues such as skin; 106 (4): 673-8).Pomc gene and protein alpha-MSH, ACTH, β-LPH and β endorphins are expressed by hypodermal cell, fibroblast, Langerhans cell and epidermis cell, melanocyte and keratinocyte.
The receptor corresponding with these protein also expressed by Skin Cell.Melanocortin receptor 1 (MC-1R or MCR-1) is the receptor of α-MSH and ACTH, and melanocortin receptor 2 (MC-2R or MCR-2) is the receptor of ACTH, and [mu ([mu R) is the receptor of β endorphins.
In skin, α-MSH, ACTH and β endorphins suppress the synthetic of inflammatory cytokine IL-1, TNF α and IL-10, so they have inflammatory properties.And, these cytokines excite nerve synthetic (Moustafa M, Szabo M, Ghanem GE, Morandini R, KempEH, MacNeil S, Haycock JW, " Dermatology research magazine " (.J Invest Dermatol) .2002 December of hormone; 119 (6): 1244-53).Therefore, there is the negative oppositely control of cutaneous neurosis disease in the skin.
Known α-MSH and ACTH can regulate the melanin generation by acting on its corresponding receptor in melanocyte.α-MSH and ACTH are the inducers of melanocyte propagation.In addition, known β endorphins has the mitotic effect of the melanocyte of promotion, and the dendron that can increase melanocyte forms (Kauser S, Schallreuter KU, Thody AJ, Gummer C, TobinDJ, " Dermatology research magazine " (J Invest Dermatol) .2003 June; 120 (6): 1073-80).
Known α-MSH and ACTH are also synthetic by keratinocyte.These two kinds of protein induce skin keratin to form the propagation and differentiation (the Chakraborty AK of cell, Funasaka Y, SlominskiA, Ermak G, Hwang J, Pawelek JM, Ichihashi M., " biochemistry and biophysics's journal " (Biochim Biophys Acta) .1996 August 28; 1313 (2): 130-8).
The different cells of skin (keratinocyte, melanocyte and fibroblast) can synthesize other neurotransmitters, for example nerve growth factor neurotrophic factors such as (NGF).Keratinocyte and fibroblast produce the receptor of NGF, TrkA and p75NTR.By combining with TrkA, NGF induces the propagation of these cells, in case the keratinocyte apoptosis.As everyone knows, NGF can induce the neuron differentiation and make its survival; Therefore NGF is playing an important role aspect the maintenance neuron density.In addition, in mice, demonstrate the existence of POMCmRNA in the dorsal root ganglion neurons, this shows that melanocortin system, particularly α-MSH have participated in the peripheral nervous reparation.Therefore, α-MSH is played a role in the neurotrophy function (Gispen WH, Adan RA., " institute of NYAS newspaper " (Ann N Y Acad Sci.) on October 20th, 1999; 885:342-9, van der KraanM, Tatro JB, Entwistle ML, Brakkee JH, Burbach JP, Adan PA, GispenWH. " brain research with molecule brain research " (Brain Res Mol Brain Res.) on January 8th, 1999; 63 (2): 276-86).In addition, known β endorphins and its derivant can make the people produce the health and happiness sense by combining with the [mu of neurocyte.
Up to now, the professional once attempted to regulate neurohumoral releases such as α-MSH or β endorphins or simulated their function, with cutaneous homeostasis and/or improve the innervation of skin.
In addition, the professional attempts to solve the skin aging problem by not exclusively suitable different metabolic approach always.But still exist some new ways to demand urgently exploring now.
A previous patent application WO2007/039058 discloses opioid receptor antagonists has been used for reducing the overall purposes that the melanocyte Opioid Receptors is expressed.Another previous patent application US2004/0214851 discloses a kind of raising Opioid Receptors and has expressed to be used for the method for diagnosis and/or treatment (only being used for damaged tissues).These disclosed contents do not provide the method that solves the skin aging described in the context.
Goal of the invention:
The inventor has found creative method, the homeostasis that is used to recover the cutaneous nerve domination or keeps or promote Skin Cell, particularly general aging and mottle problem.
The present invention also is intended to be provided for a kind of evaluation criteria, is used for assessing the influence of the active component of beautifying skin to innervation, skin homeostasis and the melanin generation of skin.
Main purpose of the present invention provides at least a active substance, particularly in the skin level, with:
-promote cell homeostasis, particularly promote keratinocyte propagation, form again to allow epithelium,
-directly or indirectly recover or keep the innervation of skin, keep the neutral net of epidermis and obtain the health and happiness sense allowing,
-directly or indirectly recover or keep angiogenesis, nourish to keep gratifying blood,
-regulate melanin to generate.
All these purposes all are in order to prevent or resist the influence of variation of observed stress-induced in skin aging and/or the opposing ageing processes of skin, and are for example photoinduced aging or chronobiology is aging.
Therefore, an object of the present invention is to prevent and/or resist the forfeiture of skin attribute, particularly epidermis, and the change of prevention and/or opposing natural beige, mottle particularly formed, for example white macula or brown macules.
The present invention also is intended to provide a kind of material, and this material allows the synthetic cascade of other media (innervation, vascularization and the epithelium that participate in skin form) is induced.
The present invention also is intended to provide a kind of material, and this material can prevent and/or resist the vegetative function forfeiture of skin level.
Some active substances in cosmetic conduct and learning and/or the pharmacy, particularly Dermatology field that the present invention also is intended to provide mentioned above.
A special purpose of the present invention provides can be partly and/or nourishing healthy ground (neutraceutically) active substance of using, particularly at least a plant extract, it may be transformed by biotechnology, the perhaps at least a molecule that has characterized.
For biotechnology, the present invention refers to that this process comprises the step that at least one carries out in the presence of microorganism.
Summary of the invention:
Inventor research be used for relax above-mentioned technical problem and realize the object of the invention new and innovative ways, the inventor finds, very ironically, the scalable and at least a receptor of at least a medium that more preferably improves pomc gene coding are in the expression of skin level.
The method of identified activity component to be inducing the basis that is expressed as of hormone α MSH or β endorphins, or adding the material that can simulate these neurohormonal effects, but these materials can not cause the receptor expression of these hormones by any way.
The inventor finds, in chronobiologic ageing process, the expression decreased of the gene level of receptor MC-1R, MC-2R and [mu R about 4 times, the expression of pomc gene has increased about 5 times in the keratinocyte.In addition, because MC-1R and [mu are expressed the pigmentation that therefore can use active substance prevention of the present invention and/or opposing skin aging and/or modify skin by melanocyte.
The present invention relates to regulate the material of expression at least a in MC-1R, MC-2R and these three kinds of receptors of [mu R, particularly in the expression of skin level, improving neurohumoral influence, thereby allow the synthetic cascade that participates in cutaneous nerve domination, vascularization and epitheliogenic other media is induced.
The present invention relates to the material of at least a expression of gene at least a gene of regulating MC-1R, MC-2R and these three kinds of receptors of [mu R, particularly in the expression of skin level, to keep or to promote the cell homeostasis of skin level, the innervation or the blood that recover skin nourish, and regulate the melanin generation.
For regulating MC-1R, at least a receptor expression in MC-2R or the [mu, the inventor refers to regulate (to be stimulated or inhibition, may be that part stimulates or inhibition) difference coded protein MC-1R, at least a in the gene of MC-2R or [mu R, and adjusting (stimulates or inhibition, may be that part stimulates or suppresses) corresponding messenger RNA is to protein MC-1R, at least a synthesizing in MC-2R or the [mu, and adjusting (stimulating or inhibition, may be that part stimulates or inhibition) protein MC-1R, the activity of MC-2R or [mu R.
For at least a receptor expression that stimulates in MC-1R, MC-2R or the [mu, the inventor refers to stimulate, may be that part stimulates, at least a in the gene of coded protein MC-1R, MC-2R or [mu R respectively, and stimulate, may be that part stimulates, corresponding at least a synthetic in to protein MC-1R, MC-2R or [mu from messenger RNA, and stimulate, may be that part stimulates the activity of protein MC-1R, MC-2R or [mu R.
For defying age, about 4 times of preferred costimulatory receptor expression of gene.
For defying age, preferred stimulate about 5 times of the expression that makes protein MC-1R, MC-2R or [mu R.
For " recovery " speech, the inventor is at certain parameter, is meant that this parameter returns to the physiological level that is more suitable for relevant experimenter from being below or above the required level of good physiological function.
For " producing a health and happiness sense " speech, the inventor refers to by the health and happiness sense that discharges easily and the bonded β endorphins of μ-Opioid Receptors produces.
The present invention be more particularly directed to regulate and more preferably be to stimulate MC-1R gene and/or MC-2R gene and/or [mu R expression of gene, and/or respectively by the protein expression of these gene codes, particularly in the mankind.
The present invention also is particularly related to and regulates the pomc gene product, and MC-1R and/or MC-2R receptor, and/or [mu R, to improve the effectiveness of receptor-ligand complex; The active component of therefore also regulating the pomc gene expression also is preferred.Aging for opposing, may make the inhibition that pomc gene is expressed be about 5 times and realize, but according to the present invention, preferably keep or improve pomc gene and express, to strengthen neurohumoral effect.Generate for melanin, preferably stimulate or keep the expression of pomc gene.
Regulating action preferably is enough to realize to the target skin cell proliferation of expressing at least a receptor in these receptors and/or the stimulation of differentiation, and/or recovers, and recovers the innervation of skin to small part.
Compare with the expression of MC-1R, MC-2R and/or [mu in the contrast model (not contacting active component), the expression of these acceptor genes in the model is improved at least about 1.2 times, preferably at least about 2 times, this model comprises at least a cell type, can express these receptors when this cell type contacts with active component, such active component is considered to the energy effective stimulus or activates above-mentioned acceptor gene.
Compare with the expression of MC-1R, MC-2R and/or [mu in the contrast model (not contacting active component), these protein expressions are improved at least about 1.1 times, preferably at least about 1.2 times, this model comprises at least a cell type, can express these receptors when this cell type contacts with active component, such active component is considered to the energy effective stimulus or activates above-mentioned receptor expression.
Compare with the expression of MC-1R, MC-2R and/or [mu R in the contrast model (not contacting active component), these expression of gene levels are less than about or equal its 0.95 times in the model, preferred 0.8 times, this model comprises at least a cell type, can express these receptors when this cell type contacts with active component, such active component is considered to effectively to suppress or to reduce above-mentioned receptor expression.
Compare with the expression of MC-1R, MC-2R and/or [mu R in the contrast model (not contacting active component), these expression of gene levels are less than about or equal its 0.95 times in the model, preferred 0.8 times, this model comprises at least a cell type, can express these receptors when this cell type contacts with active component, such active component is considered to effectively to suppress or to reduce above-mentioned receptor expression.
According to a kind of specific implementation method, the preferred activation or stimulation MC-1R, MC-2R, and/or [mu gene, and/or MC-1R, MC-2R and/or [mu protein expression, and may keep or stimulate the neurotransmitter of encoding by pomc gene in pomc gene and/or the keratinocyte.
According to another kind of implementation method, at least a expression in keratinocyte in these receptors of being expressed increases, to reduce inflammatory reaction, particularly relevant with the hyper-proliferative of these Skin Cells a part of pathology.
According to another kind of specific implementation method, extraly to MC-1R in the melanocyte and/or [mu expression of gene, and/or MC-1R and/or [mu protein expression, and the neurohumoral expression of the expression of possible pomc gene and/or pomc gene coding is regulated.
An aspect of of the present present invention relates to the method for identified activity material, and this material can be regulated the propagation and the differentiation of at least a living cells, and the [mu that this cell can be expressed MC-1R, MC-2R and/or characterized is characterized in that it comprises:
-make and at least aly can express MC-1R, MC-2R and/or [mu, contact this active substance with the living cells that may express pomc gene;
-analyze the expression of MC-1R, MC-2R and/or [mu, its special purpose is to identify scalable, the active substance that preferably stimulates MC-1R, MC-2R and/or [mu to express.
Preferably carry out qualitative and/or quantitative analysis, analyze the gene expression of receptor MC-1R, MC-2R and/or [mu by expression to the nucleotide sequence of coding MC-1R, MC-2R and/or [mu.
RT-PCR preferably include use with SEQ ID No.1,2,3,4 the complementary dna nucleotide sequence of sequence in primer amplification coding MC-1R, MC-2R and/or the [mu of at least a portion hybridization and at least a portion of the nucleotide sequence of the pomc gene of may encoding.
SEQ?ID?N
o1:MC-1R?NM_002386
SEQ?ID?N
o2:MC-2RNM_000529
SEQ ID N
o3: [mu NM_000914
SEQ?ID?N
o4:POMCNM_000939
Used living cells preferably includes keratinocyte and/or melanocyte, particularly extracts the skin from the human experimenter's specific part (abdominal part, chest etc.) of growing up.Preferred so-called " normally " cell that uses, that is, for example non-transformed cell (tumor cell of non-conversion or the transgenic cell of non-conversion) has remarkable representativeness, can be used for being studied the cell type test of group of objects.
Preferably classify according to the age, with set up age/gene relationship and the age/protein synthesis relation.Young experimenter's age is between 17 to 40 years old; Middle age experimenter's age between 40 to 50 years old, surpass 50 years old be old experimenter.
Authentication method preferably includes the step of an analysing protein MC-1R (34.7kDa), MC-2R (33.9kDa) and/or [mu (44.8kDa) expression, this step is carried out by this method, promptly, protein transduction in the gel is moved on to (western blotting) on the nitrocellulose filter, the method is used in particular for detecting when active substance contacts with above-mentioned living cells, to the adjusting of respective egg white matter expression.
According to first preferred implementation method, the living cells type that can express MC-1R, MC-2R and/or [mu is a keratinocyte.In this case, described competent cell is found expression that can stimulate or improve MC-1R, MC-2R and/or [mu and the expression that may reduce pomc gene.
According to second implementation method, the living cells type that can express MC-1R and/or [mu is a melanocyte.In this case, described competent cell is found the expression of scalable MC-1R and/or [mu and may regulates the expression of pomc gene.
When acting on keratinocyte, described active substance preferably includes to be increased NGF and the synthetic a kind of cascade of VEGF, and therefore excite nerve respectively domination (neuron density and dendron form) and neovascularity generation.
Second aspect of the present invention relates to the purposes of above-mentioned active substance; Promptly, this material can be confirmed to be according to above-mentioned screening technique has activity, can be used as active substance and be used for cosmetic composition or nourishing healthy compositions, or be used to produce pharmaceutical composition, preferably dermatologic medicine compositions, be used for especially regulating, preferably stimulating protein MC-1R, MC-2R and/or [mu is synthetic, especially to be used for inducing keratinocyte propagation and/or differentiation and/or ripe.
A third aspect of the present invention relates to the purposes of above-mentioned active substance, be used for cosmetic composition or nourishing healthy compositions as active substance, or be used to produce pharmaceutical composition, preferably dermatologic medicine compositions, be used for especially preventing and/or the biological skin aging of resistance time or aging and/or opposing inductive variation of observed stress in ageing processes of skin of causing by daylight, or prevention and/or opposing epidermis homeostasis weaken, or promote epithelium to form, or improve cell proliferation and differentiation, particularly in the epidermis level, or the minimizing of prevention or the formation of opposing skin heart, or improve skin heart and form, or it is too high to improve vascular permeability, or the angiogenesis during improving skin and scabbing, or prevention and/or the domination of opposing cutaneous nerve weaken, or improve cutaneous nerve and arrange, or produce a kind of health and happiness sense, and or improve the colour of skin and/or color and luster and/or regulate skin pigment and form, particularly show as local flaw for example during pigmented spots when described chromogenesis.
A fourth aspect of the present invention relates to cosmetic composition or nourishing healthy compositions, be used for preventing and/or opposing skin aging and/or opposing inductive variation of observed stress in ageing processes of skin, or prevention and/or opposing epidermis homeostasis weaken, or promote epithelium to form, or improve cell proliferation and differentiation, particularly in the epidermis level, or the minimizing of prevention or the formation of opposing skin heart, or improve skin heart and form, or it is too high to improve vascular permeability, or the angiogenesis during improving skin and scabbing, or prevention and/or opposing cutaneous nerve domination weaken, or improve the cutaneous nerve domination, or produce a kind of health and happiness sense, or improve the colour of skin and/or color and luster and/or regulate skin pigment and form, particularly show as local flaw for example during pigmented spots when described chromogenesis; Above-mentioned composition comprises the active substance as active component, as previously described, may use with the combinations of substances of describing before.
A fifth aspect of the present invention relates to pharmaceutical composition, be used for especially preventing and/or opposing skin aging or opposing inductive variation of observed stress in ageing processes of skin, or prevention and/or opposing epidermis homeostasis weaken, or promote epithelium to form, or improve cell proliferation and differentiation, particularly in the epidermis level, or the minimizing of prevention and/or the formation of opposing skin heart, or it is too high to improve vascular permeability, or the angiogenesis during improving skin and scabbing, or prevention or opposing cutaneous nerve domination weaken, or improve cutaneous nerve and arrange, or produce a kind of health and happiness sense, and or improve the colour of skin and/or color and luster and/or regulate skin pigment and form, particularly show as local flaw for example during pigmented spots when described chromogenesis; Above-mentioned composition comprises the active substance as active component, as previously described, may use with the combinations of substances of describing before.
A sixth aspect of the present invention relates to a kind of cosmetic care method, it is characterized in that, above-mentioned cosmetic composition or above-mentioned active substance are used for the beautify effect of skin to be improved.
Determine the effective dose of described active substance by simple conventional way by the professional.
The invention still further relates to the method for preventative processing or therapeutic treatment, as the part of above-mentioned whole purposes and application.
Detailed description of the invention:
The inventor has shown that first the expression of receptor MC-1R, MC-2R and [mu R can reduce in biological ageing processes of skin of time, particularly when these receptors are expressed by the keratinocyte of human skin.
The inventor has also determined the raising that pomc gene is expressed in biological ageing processes of skin of time first, particularly in the human skin keratinocyte.
Therefore the inventor has formulated the screening technique in the keratinocyte, in order to seek active substance, the active substance in plant extract or the chemical molecular that has characterized or the molecule that is transformed by biotechnology particularly, these active substances can stimulate, particularly encode receptor MC-1R, MC-2R and [mu R mRNA expression and may keep, stimulate or suppress the expression of the mRNA of coding neurotransmitter (by pomc gene coding).Test the effect that selected active substance is expressed the respective egg white matter of mRNA then.
The present invention has also characterized the characteristic that MC-1R, MC-2R and [mu express in the keratinocyte.Before, only confirmed mRNA (Moustafa M, Szabo M, Ghanem GE, Morandini R, Kemp EH, MacNellS, Haycock JW., the Invest Dermatol.2002 December of MC-2R in the keratinocyte; 119 (6): 1244-53), so the inventor confirmed the protein MC-2R in the keratinocyte at first, and points out that ACTH not only by to combine performance active with MC-1R in the keratinocyte, also combines to bring into play activity with MC-2R.
Therefore, the invention describes the purposes of material, at least a expression of gene in the gene of described material incentive coding neurotransmitter (by the pomc gene coding) receptor, this receptor is preferably selected from MC-1R, MC-2R and the [mu R at least a Skin Cell type, and this Skin Cell can be expressed at least a in these receptors.The invention describes the purposes of material, be used for preparation of compositions, be selected from least a interaction between the corresponding receptor of a kind of neurotransmitter in α-MSH, ACTH and the beta-endorphin with it with stimulation as active substance.
Cosmetic composition, nourishing healthy compositions and pharmaceutical composition selected active substance have been used for, preferably dermatologic medicine compositions, be used in particular for the epidermis attenuation in prevention and/or the biological or photoinduced ageing processes of skin of opposing epidermis attenuation, particularly time.
Above-mentioned substance preferably can improve or the expression of gene of the receptor of stimulus encoding neurotransmitter (by the pomc gene coding), with equilibrated imbalance between part and receptor in opposing or the prevention keratinocyte.
Above-mentioned substance preferably can reduce the expression of pomc gene, to resist or to prevent to distinguish the imbalance that observed part and receptor balance are expressed in keratinocyte, particularly in ageing process.
Above-mentioned substance preferably can be used in combination, to suppress the expression and the costimulatory receptor expression of gene of pomc gene.
Above-mentioned substance preferably can improve or keep the expression of pomc gene to improve the above-mentioned effect of α-MSH, ACTH and beta-endorphin.
Fortunately, above-mentioned substance has improved the neurohumoral at least a receptor expression of being encoded by pomc gene in the keratinocyte, can prevent and/or resist the various variations that skin aging or stress cause, as viewed variation in the ageing processes of skin.
Therefore, the present invention relates to regulate these receptors, preferably stimulate these receptors, particularly to alleviate imbalance, especially reduce the interaction of α-MSH and/or ACTH and/or beta-endorphin receptor corresponding with it, wherein said interaction is relevant with cell senescence, and influences keratinocyte.
Above-mentioned substance preferably can increase the synthetic of NGF, thereby may increase the growth of peripheral nervous in the skin level.Therefore the present invention relates to the purposes of following substances, this material allows the increase of cutaneous nerve domination, reduces in the variation that wherein said cutaneous nerve domination is observed in ageing process or stress causes, as viewed in ageing processes of skin.
Above-mentioned substance preferably can increase the synthetic of VEGF, thereby may increase the vascularization of skin level.Therefore the present invention relates to the purposes of following substances, this material can make skin better be nourished, and reduces in the variation that wherein said skin nourishing is observed in ageing process or stress causes, as viewed in ageing processes of skin.
The material that can stimulate MC-1R in the keratinocyte and/or MC-2R and/or [mu to express is preferably selected from:
4 kinds of molecules that characterized:
-phenylacetic acid 3,6,9-trimethyl-2,7-dioxy-2,3,3a, 4,5,7,9a, 9b-octahydro-azulene be [4,5-b] furan-4-base also,
-Z-decahydro-6,8a-dihydroxy-1-isopropyl-3a, 6-dimethyl azulene-5-base-2-methyl but-2-ene acid esters
-2,6 dimethyl-4 (2-methyl butene acid esters) 5-6 (1-isopropyl-1-hydroxy-cyclopentane)) 1,2 epoxide ring heptane (CAS 352220-52-1) and ester thereof,
-7-acetas-2,6 dimethyl-4 (2-methyl butene acid esters) 5-6 (1-isopropyl-1-hydroxy-cyclopentane) particularly) 1,2 epoxide ring heptane, known its CAS number is 86992-41-8, its general lapiferrin by name;
And the plant extract that contains this type of molecule that has characterized.
6 kind of plant extracts: Galeopsis ochroleuca (Galeopsis ochroleuca) (wild Fructus Cannabis), common common milfoil (Achillea millefolium), wild Fructus Colocasiae Esculentae (Colocasia esculenta), sour cherry (Prunus cerasus), Prunus spinosa Linn. (Prunus spinosa), vinburnine extract (Apocynaceae (Apocynacea) Amsonia Abrenaemontan);
4 kinds of biotechnology hydrolyzate, by obtaining: with lactic acid bacteria lactobacillus particularly with existing microbial fermentation plant extract, Lactobacillus plantarum (lactobacillus plantarum) for example, transform the extract of Fructus Mangifera Indicae, nipa palm or Fructus Caricae, or with lactic acid bacteria lactobacillus particularly, Lactobacillus paracasei (lactobacillus paracasei) for example, the Fructus Musae extract of conversion; With their mixture.
In the molecule that these have characterized, in lapiferin, particularly many stone Resina Ferulae (Ferula lapidosa) extract, or from many stone Resina Ferulae extract, and phenylacetic acid 3,6,9-trimethyl-2,7-dioxy-2,3,3a, 4,5,7,9a, 9b-octahydro-azulene also [4,5-b] furan-4-base are preferred substances of the present invention.
In plant extract, common common milfoil (Achillea millefolium) and Prunus spinosa Linn. (Prunusspinosa) are preferred substances of the present invention.
According to a preferred implementation, described plant extract is preferably by in a kind of solvent that plant (preferably root, root stock, stem, skin, flower, fruit, seed, plumule or leaf) is soaked in 1-10% (p/p) (being generally 1-5%) or obtain in the solvent mixture, be generally the mixture of water and alcohol, glycol or polyhydric alcohol (for example ethanol, glycerol, butanediol and other glycol, xylitol etc.), its ratio is 100/0 to 0/100, preferably is soaked in the water.At last the extract that obtains is filtered or distillation,, this part is filtered, preferably use the filter membrane of 0.45 μ m to reclaim soluble fraction.Being used for the fermenting plant extract belongs to from lactic acid bacteria usually with the microorganism that obtains the biotechnology hydrolyzate, particularly Lactobacillus plantarum or Lactobacillus paracasei, and Bifidobacterium (bifidobacterium), particularly bifidobacterium longum (bifidobacterium longum), or Saccharomyces (Saccharomyces).Preferably these hydrolyzate are further filtered, preferably use the filter membrane of 0.45 μ m, to obtain active component.
The described molecule that has characterized of preparation (comprises lapiferin and phenylacetic acid 3,6,9-trimethyl-2 in the solvent by being dissolved in, 7-dioxy-2,3,3a, 4,5,7,9a, 9b-octahydro-azulene also [4,5-b] furan-4-yl), this solvent is generally DMSO, ethanol, glycol, particularly is dissolved in concentration and is among 0.1% the DMSO.
When above-mentioned active substance was used for cosmetic composition, for plant extract and biotechnology hydrolyzate, its content was preferably between 0.01% to 5% (v/v), and for the molecule that has characterized, its content is between 1.10
-7% to 1% (v/v) is preferably between 1.10
-5% to 1.10
-1%.
The present invention be more particularly directed to a kind of compositions that is used for cosmetic care or preventative processing or therapeutic treatment, permeability during being used to improve skin and scabbing is too high, improves cell proliferation and differentiation, particularly in the epidermis level, form thereby improve the skin epithelium, promote to keep the cutaneous nerve domination.
Above-mentioned substance also shows the stimulation to the MC-1R in the neurocyte and/or MC-2R and/or [mu expression, particularly in the cutaneous nerve network.
Above-mentioned active substance advantageously uses with following other active substance combination:
The active component of-chafe neurotrophy function and/or activation sensitive skin nerve, the component quoted of patent application FR 2825273 for example, the extract of Capsicum tetragonum (Capsicum annuum), red pigment (Fructus Capsici) or Fructus Piperis (Piper nigrum) or glutamy amido ethylindole (Exsymol);
-have the active component of simulation β endorphins effect, to improve the barrier function of skin, the component quoted of patent application US 2006069032 for example, cacao bean hull extract;
-stimulate the synthetic active component of β endorphins, can make the people obtain the health and happiness sense, Tephroline for example, from plant ass green soyabeans (tephrosia purpurea) (Soliance);
-stimulate cellular proliferation and/or the active component of cell differentiation, have the aging resistance activity, for example following molecule: NGF, α-MSH, β endorphins or derivant, the material described in the patent application FR 2857874 for example, P3-endorphins.
The active component that-protection fibroblast growth factor (particularly FGF2) is not degraded, for example plant extract, particularly Radix seu folium abelmoschi moschati (Hibiscus Abelmoscus) extract described in GB 244036 patent applications of applicant's submission and announcement;
-stimulate the active component of the movable and/or propagation of fibroblast, fermented soybean polypeptide for example, this is that the applicant is with Phytokine
TMThis trade name product sold can use with the Radix seu folium abelmoschi moschati extract combination;
-stimulate hyaluronidase synthase (Hyaluronase synthase), the particularly active component of hyaluronidase synthase 2, as described in patent FR2893252;
-stimulating the active and/or synthetic active component of lysyloxidase (for example LOXL), the described component of patent FR2855968 for example is especially for the Fructus anethi extract that stimulates elastic fiber to generate.
-have inflammatory properties an active component of (for example suppressing PLA2), the particularly component described in the patent FR2847267, particularly Radix Puerariae extract
-can change the active substance of the colour of skin, for example be used for the active component of brightening and/or skin whitening;
-have the active substance of eliminating the edema characteristic, for example a hesperetin laurate
Or Tricetin caprylate
In addition, above-mentioned active substance stimulates the expression of MC-1R and/or MC-2R and/or [mu, preferably in keratinocyte, can use with another kind of active substance combination, this material is regulated, preferably improve or reduce following at least a receptor expression, i.e. the MC-1R and the [mu of melanocyte expression, and/or adjusting is by the expression of the pomc gene of melanocyte expression.The target of this embodiment is to improve the colour of skin and/or color and luster and/or regulates skin pigment and forms, particularly show as local flaw for example during pigmented spots when described chromogenesis, with prevention and/or opposing pigmentation or depigmentation, as mentioned below with the aging relevant or special color vegetarian refreshments that has nothing to do.
The inventor has also worked out a kind of screening technique that is used for melanocyte, in order to seek active substance, particularly plant extract or the chemical molecular that has characterized or the molecule isoreactivity material that is transformed by biotechnology, be used for especially regulating coding MC-1R and [mu R mRNA expression and may regulate the expression of the mRNA of coding neurotransmitter (by the pomc gene coding).The active substance selected according to this of test effect that the respective egg white matter of mRNA is expressed then.
Selected active substance has been used for cosmetic composition, nourishing healthy compositions and pharmaceutical composition, preferably the dermatologic medicine preparation is used in particular for prevention and/or opposing pigmentation or depigmentation.
A kind of neurohumoral at least a receptor expression of being encoded by pomc gene in the above-mentioned substance preferred tunable joint melanocyte is with prevention or opposing pigmentation or depigmentation.
The expression of above-mentioned substance preferred tunable joint pomc gene is with prevention or opposing pigmentation or depigmentation; Particularly, reservation simultaneously the POMC in the stimulation melanin cell and receptor material with increase pigmentation and keep the POMC that can reduce simultaneously or suppress in the melanocyte and the material of receptor with the minimizing pigmentation.The use capable of being combined of these materials is to stimulate POMC expression and/or expression of receptor and to increase pigmentation or suppress POMC and receptor and reduce pigmentation.
According to an embodiment, but in the stimulation melanin cell in MC-1R and/or the [mu at least a expression and/or the material that stimulates POMC to express can be following material:
-a kind of molecule that has characterized: 1-methyl-B-carboline-3-carboxylic acid;
-following plants extract: Semen sojae atricolor powder, (redness) Rhizoma Smilacis Chinensis (salsaparilla) (beautiful colored Rhizoma Smilacis Chinensis (Smilax ornata)), common common milfoil (Achillea millefolium), Cecropia obtusa, Radix Oenotherae erythrosepalae (Oenothera biennis), Radix Dauci Sativae extract, bracken, sour cherry or their any mixture, and;
-biotechnology hydrolyzate by obtaining with existing microbial fermentation plant extract is selected from: the yeast of fermentation or lupin, and particularly with the lactic acid bacteria fermentation, Lactobacillus plantarum for example; The extract of Fructus Caricae, nipa palm or the Semen sojae atricolor that transforms with lactic acid bacteria particularly transforms with lactobacillus, for example Lactobacillus plantarum; With the bacillus bifidus citron extract of bifidobacterium longum fermentation for example; With their any mixture.
According to the present invention, but the active substance that above-mentioned MC-1R of stimulation and/or MC-2R and/or [mu are expressed and the MC-1R and/or being used in combination of [mu and/or POMC material of above-mentioned stimulation melanin cellular expression can increase cutaneous pigmentation, have and increase black effect, with prevention and/or opposing and depigmentation speckle aging relevant or that have nothing to do.
According to second embodiment, reduce water extract or water-alcohol extraction that pomc gene is expressed in the melanocyte material can be Galeopsis ochroleuca (Galeopsis ochroleuca) (wild Fructus Cannabis) and Juniperus communis (Juniperuscommunis) (gin), and/or can reduce expression at least a in MC-1R in the melanocyte and/or the [mu material be the water extract or the water-alcohol extraction of Juniperus communis (gin).According to the present invention, the active substance of above-mentioned MC-1R of stimulation and/or MC-2R and/or [mu and above-mentionedly reduce MC-1R and/or the [mu that melanocyte expresses and/or being used in combination of material of reducing the pomc gene in the melanocyte can be reduced cutaneous pigmentation, has the brilliant white effect, to improve colour of skin brightness, prevention and/or opposing and aging relevant or irrelevant pigmentation point.
The present invention be more particularly directed to a kind of compositions that is used for cosmetics or skin cosmetic care or preventative processing or therapeutic treatment, be used for changing skin brightness and pigmentation, particularly with aging relevant or irrelevant pigment point.
Chemical compound of the present invention is made into the form of topical compositions, particularly cosmetic composition or pharmaceutical composition, preferably can be used for the skin composition of skin.Therefore, for these compositionss, excipient comprises for example following at least a, comprises antiseptic, softening agent, emulsifying agent, surfactant, wetting agent, thickening agent, regulator, delustring inorganic agent, stabilizing agent, antioxidant, adjusting material, glitter, film former, solubilizing agent, pigment, dyestuff, spice and opacifier.These excipient preferred amino acid and its derivant, the polyglycereol class, esters, polymer and cellulose derivative, lanolin derivative, phospholipid, lactoferrin, lactoperoxidase, stabilizing agent based on sucrose, vitamin E and its derivant, natural and synthetic wax, vegetable oil, triglyceride, saponifiable matter not, the phytosterol class, the plant esters, siloxanes and its derivant, protein hydrolysate, Jojoba oil and its derivant, fat-soluble/soluble ester, betaines, aminate, the sucrose ester plant extract, titanium dioxide, glycine, metagin, more preferably butanediol, stearyl alcohol polyethers-2, stearyl alcohol polyethers-21, ethylene glycol-15 stearyl ether, 16/octadecanol, phenoxyethanol, methyl parahydroxybenzoate, propyl p-hydroxybenzoate, butyl p-hydroxybenzoate, butanediol, natural tocopherol, glycerol, dihydroxy cetyl sodium phosphate, hydroxyl cetyl diisopropyl ether, glycol stearate, three different azelatins, the coconut oil monooctyl ester, polyacrylamide, isoparaffin, lauryl polyoxyethylene (7) ether, carbomer, propylene glycol, glycerol, bisabolol, polydimethylsiloxane, sodium hydroxide, PEG 30-dimerization hydroxy stearic acid, capric acid/Trivent OCG, 16/octadecanol caprylate, dibutyl adipate, Oleum Vitis viniferae, Jojoba oil, magnesium sulfate, EDTA, annular dimethyl polysiloxane, Xanthan gum, citric acid, sodium lauryl sulphate, mineral wax and mineral oil, the isooctadecanol isostearate, propylene glycol two n-nonanoic acids, the propylene glycol isostearate, PEG 8, Cera Flava, hydrogenated palm kernel oil glyceride, lanolin oil, Oleum sesami, the spermol lactate, lanolin alcohol, titanium dioxide, lactose, sucrose, low density polyethylene (LDPE) and isotonic saline solution.
Above-claimed cpd is made following dosage forms ideally, comprise aqueous solution or based on the solution of oil, based on emulsifiable paste or the gel or the oil-base gel of water, particularly bottled or pipe is adorned, particularly bath foam, shampoo, emulsion, Emulsion, microemulsion or nano-emulsion, particularly oil-in-water or Water-In-Oil or various based on siloxanes; Skin lotion, particularly glass bottle or plastic bottle or spraying dress, plastic uptake dress, liquid soap, skin usefulness soap, pomade, foam, a kind of anhydrous product, preferred liquid, ointment or solid, for example bar-shaped, lip pomade particularly.
" topical application " used herein speech refers to compositions of the present invention is used for or be sprayed on skin surface.
" can be used for skin " used herein vocabulary shows that compound used therefor is fit to the contact skin with the people, can not produce unnecessary toxicity, incompatibility, unstability, anaphylaxis or it is equal to situation.
The professional is used to improve skin health and/or outward appearance with many active cosmetic compositions.These professionals know how to prepare these cosmetics or dermal compositions to obtain optimum efficiency.Has synergism when in addition, chemical compound of the present invention and other combinations of substances are used.These are used in combination also within the scope of the present invention.Cosmetics and the medicine trade various cosmetics and the drug ingredient that are particularly suitable for topical application commonly used have at present been described in " CFTA cosmetic composition handbook second edition " (CFTA CosmeticIngredient Handbook Second Edition) (1992).Some examples of this constituents include but not limited to following compounds: grinding agent, absorbent compound, has for example perfume of the purpose of beautifying chemical compound, pigment, dyestuff, quintessence oil, astringents etc. (for example, Oleum Caryophylli, Mentholum, Camphora, Eucalyptus oil, eugenol, methyl lactate, Radix Hamamelidis Mollis rectification liquid), the anti-acne agent, deflocculant, anti-foam agent, antibacterial (for example: iodo propyl butyl carbamate), antioxidant, binding agent, bio-additive, hygroscopic agent, extender, chelating agen, additive, antibacterial, denaturant, outside analgesic, filmogen, polymer, opacifiers, the pH regulator agent, Reducing agent, fade or clarifier (for example, hydroquinone, kojic acid, ascorbic acid, magnesium ascorbyl phosphate, the ascorbic acid glucamine), regulator (for example: wetting agent), skin releive and and/or anti-scar agent (for example: pantothenylol and its derivant, for example: the ethyl pantothenylol), Aloe, pantothenic acid and its derivant, allantoin, bisabolol and glycyrrhizic acid dipotassium salt, thickening agent, vitamin and its derivant or equivalent.
The accompanying drawing summary:
In the drawings:
Fig. 1 has shown in the ageing process the remarkable reduction of receptor MC-1R, MC-2R in the keratinocyte in the human body slicer and/or [mu gene expression.
Fig. 2 has shown by the slicer to the human body normal skin and has partly carried out the remarkable reduction that immunofluorescence checks that observed tubulin β III and 200 neural thread protein NTPs are expressed.
Fig. 3 and 4 has shown that respectively the age leads between 15 to 75 years old experimenter's tubulin β III and 200 neural thread protein NTP relative expressions.
Fig. 5 and 6 shown respectively with Fig. 3 and 4 in the corresponding statistical analysis of research.
When reading explanatory description, these descriptions relate to the embodiment that only is used for illustration purpose and does not limit the present invention in any way the field, and other purposes of the present invention, characteristic and benefit will be apparent to those skilled in the art.
These embodiment are the indispensable parts of the present invention, and for any new features that as herein described and any prior art is compared, its integral body comprises embodiment, are a part that constitutes function of the present invention and general aspect integrity.
Therefore, each embodiment has general range.
Embodiment
Embodiment 1: demonstrate protein MC-1R, MC-2R on the human body slicer and the reduction of expression in ageing process of [mu by immunohistology
The inventor is verified takes from variation in the time that the is expressed in biological aging process of the protein level of MC-1R, MC-2R and [mu in the slicer of young woman's (age is lower than 40 years old) and old women (age was above 50 years old).(see Fig. 1: take from 30 or the human body slicer of 60 years old human patients in expression of receptor-immunohistochemistry result)
This research is carried out with the immunohistology method.Owing to used following antibody: resist-MC-1R (1/500), resist-MC-2R (1/200) and anti--[mu (1/1000), thereby clearly proved.
With the skin model rebuild (
Coletica, Lyons, France) and slicer make freezing transverse section, perhaps, be used for immune labeled then with the paraffin sealing.
Used antibody is: resist-MC-1R, resist-MC-2R and anti--[mu (ChemiconInternational company).Detect with suitable secondary antibodies through puting together.
The results are shown in Figure 1, the result has proved that the expression of the gene level of receptor MC-1R, MC-2R in the keratinocyte and [mu R in the ageing process reduces.
Embodiment 2: demonstrate MC-1R, MC-2R and the reduction of [mu gene expression dose and the raising of pomc gene expression in adult's keratinocyte in ageing process by the real-time RT-PCR method
The invention still further relates to receptor MC-1R, MC-2R and the [mu R gene expression and the variation of pomc gene expression in time biological aging process of the keratinocyte in the human slicer.Analyze the expression of these four kinds of target genes and actin gene with real-time RT-PCR (the quantitative chain reaction of reverse transcriptase polymerase).This technology compares by the expression (being considered as constant) with a kind of gene and actin gene, and accurate quantification is carried out in this gene expression.Thereby the adjusting to this gene expression dose is carried out quantitatively.
With total RNA with " SV 96 total RNA piece-rate systems " test kit (Promega, Charbonnieres, France) total RNA that purifies.Purified RNA is not had at 100 μ l in the water (Promega, Charbonnieres, France) of RNA enzyme and make suspension, assign to after the mensuration (96 hole microtitration plates, the total RNA of 10 μ l (the every PCR of 5ng/ μ l)) in two plates.The primer of selecting for use in this project is as shown in table 1:
Table 1:
Actin has justice (SEQ ID N o5) actin antisense (SEQ ID N o6) | ??GTGGGGCGCCCCAGGCACCA??CTCCTTAATGTCACGCACGATTTC |
MC-1R has justice (SEQ ID N o7) MC-1R antisense (SEQ ID N o8) | ??GGGCTCTGAGAACGACTTTT??CCGGGCTCCTGTCTGGTTGG |
MC-2R has justice (SEQ ID N o9) MC-2R antisense (SEQ ID N o10) | ??TCACGTCGCTGTTCCCGCTGAT??AAGAGAGACATGTAGCAGGCGCAGTA |
[mu has justice (SEQ ID N o11) [mu antisense (SEQ ID N o12) | ??CTCAGCCAGGACTGGTTTCTGTAAGA??TCGGACAGGTTGCCATCTAAGTG |
POMC has justice (SEQ ID N o13) POMC antisense (SEQ ID N o14) | ??CGCCCAGTGAAGGTGTACCC??GGCGTCTGGCTCTTCTCGGAGGTC |
In the OPTICON thermocycler, carry out amplification cycles to containing the firm and hard real-time RT-PCR technology of executing of mRNA with " Quanti Tect SYBR Green RT-PCR " test kit (Qiagen, France).50 ℃ of reverse transcriptions (RT) 30 minutes, kept 15 minutes at 95 ℃ then, to suppress reverse transcriptase, activate polymerase, the complementary DNA (cDNA) that degeneration obtains.Carry out 50 circulation sequential polymerisation reactions (PCR) (95 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 30 seconds).During each loop ends, read fluorescent value, this value is proportional with segments.With the ratio definition expression of each expression of gene level with the actin expression.
The inventor shows that the age surpasses that the MC-1R expression of gene is than low 4 times of the young woman among 52 years old the women, and this value has statistical significance.
The inventor shows that the age surpasses that the MC-2R expression of gene is than low 8 times of the young woman among 5 years old the women, and this value has statistical significance.
The inventor shows that the age surpasses that the [mu expression of gene is than low 6.5 times of the young woman among 55 years old the women, and this value has statistical significance.
The inventor shows that the age surpasses expression ratio young woman high 5 times of pomc gene among 50 years old the women, and this value has statistical significance.
In a word, the present invention allows receptor in the human keratinous formation cell and the balance between ligand expression thereof disturbance to occur, to support part to increase and all receptors reduce.
Embodiment 3: the expression of the messenger RNA of analysis receptor MC-1R, MC-2R and [mu R and the mRNAs of POMC, for example under the condition that makes keratinocyte contact or not be in contact with it, analyze by quantitative RT-PCR with active component
The present invention be more particularly directed to a kind of recruit's of screening method, this molecule can be induced the synthetic of 3 kinds of receptor MC-1R, MC-2R and/or [mu, with restoration and reconstruction skin, recover the physiology of associated receptor in the aging cutin formation cell in the human body skin slicer and express, this physiology is expressed and can be observed in the keratinocyte in young skin.
Described active component has separate sources (for example plant or synthetic molecules).
Particularly, described plant extract is by in a kind of solvent that plant (preferred root, root stock, stem, skin, flower, fruit, seed, plumule or leaf) is soaked in 1-10% (p/p) (being generally 1-5%) or obtain in the solvent mixture, be generally the mixture of water and alcohol, glycol or polyhydric alcohol (for example ethanol, glycerol, butanediol and other glycol, xylitol etc.), its ratio is 100/0 to 0/100, preferably is soaked in the water.Then the extract that obtains is filtered or distillation,, this part is filtered the filter membrane of preferred 0.45 μ m to reclaim soluble fraction.Obtain the biotechnology hydrolyzate by the fermenting plant extract in the presence of microorganism, wherein said microorganism belongs to from lactic acid bacteria usually, particularly Lactobacillus plantarum or Lactobacillus paracasei, and Bifidobacterium, particularly bifidobacterium longum; Or yeast.Then these hydrolyzate are further filtered, the filter membrane of preferred 0.45 μ m is to obtain active component.
By being dissolved in the solvent the described molecule that has characterized of preparation, described solvent is generally DMSO, ethanol, glycol, particularly is dissolved in concentration and is among 0.1% the DMSO.
Active component is dissolved in the culture environment, then keratinocyte is tested: for plant extract and biotechnology hydrolyzate, its content is usually between 0.1% to 2% (v/v), particularly between 0.5% to 1%, for the molecule that has characterized, usually between 0.001% to 0.01% (v/v).In the culture environment of present embodiment, for plant extract and biotechnology hydrolyzate, employing be 1% content, for the molecule that has characterized, employing be 0.01% content.
From the plastic operation of normal adult, obtain keratinocyte by enzymic digestion, make this keratinocyte propagation in the specific environment that is used for keratinocyte, inoculation (for example 50000 every square centimeter) in 24 orifice plates, is cultivated in lamina in strict serum-free environment then then.After converging, cell is contacted with the active substance that dilutes with culture medium, contact 24 hours usually.
Carry out parallel test with untreated control sample (only culture medium) and 3 positive control sample (1ng/mlTGF-β, 50pg/ml IL-1 α and 100ng/ml TNF-α), for example on same culture plate.Before tested 1ng/ml TGF-β, these three samples of 100ng/ml TNF-α and 50pg/mlIL-1 α, (for example pass through quantitative RT-PCR by analyzing mRNA, for these 3 kinds of derivants with x2 or x.08), the cytokine of these three kinds of concentration of empirical tests is to 3 kinds of synthetic stimulations of receptor mRNA.
With cell with after active substance contacts, for example contact 24 hours after, remove culture environment, preserve cell, for example earlier with the phosphate solution rinsing of pH 7.4, then-80 ℃ of lyophilizations.Extract total RNA, for example extract test kit, assign to then on the spectrophotometer of 96-hole, measure (purity index: the proteinic amount in 280nm place) at the 260nm place with silica column 96-hole.With the RNA dilution, for example be diluted to 5ng/ μ l.Carry out the quantitative RT-PCR in the 1st step, for example on the 96-orifice plate, 50ng Initial R NA is carried out, actin, MC-1R, MC-2R, [mu R and pomc gene are carried out.Use the specific primer of every kind of gene, for example 0.5 μ M sees the above table offering some clarification in 1.
The parameters of amplification is as follows: carry out amplification cycles with " Quanti TectSYBR Green RT-PCR " test kit (Qiagen, France) to containing the firm and hard real-time RT-PCR technology of executing of mRNA in the OPTICON thermocycler.50 ℃ of reverse transcriptions (RT) 30 minutes, kept 15 minutes at 95 ℃ then, to suppress reverse transcriptase, activate polymerase, the complementary DNA (cDNA) that degeneration obtains.Order carry out 50 circulation polymerizations (PCR) (95 ℃ 15 seconds, 60 ℃ 30 seconds, 72 ℃ 30 seconds).During each loop ends, read fluorescent value, this value is proportional with the segments of amplification.With the ratio definition expression of each expression of gene level with the actin gene expression.
The expression of gene M C-1R, MC-2R, [mu and POMC is used and is compared the percent change that draws with negative control (being untreated) and represent.Shown in the following Table II of these active substances of being tried thing:
Table II
Title (latin name) | Plant parts | The MC-1R contrast *: | The MC-2R contrast *: | [mu R contrast *: | The POMC contrast *: |
Common common milfoil (Achillea millefolium) | Plant | ??2.73 | ??3.0 | ??23.0 | ??3.38 |
Galeopsis ochroleuca (Galeopsis ochroleuca) | Plant | ??2.9 | ??1.0 | ??1.0 | ??1 |
Wild Fructus Colocasiae Esculentae (Colocasia esculenta) | Tuber | ??2.0 | ??1.0 | ??24.0 | ??1 |
Title (latin name) | Plant parts | The MC-1R contrast *: | The MC-2R contrast *: | [mu R contrast *: | The POMC contrast *: |
Sour cherry (Prunus cerasus) | Stem | ??1.0 | ??1.0 | ??5.3 | ??2.6 |
Radix Oenotherae erythrosepalae (Oenothera biennis) | Seed | ??0.67 | ??1.0 | ??1.0 | ??0.36 |
Prunus spinosa Linn. (Prunus spinosa) | Fruit | ??1.0 | ??2.3 | ??6.0 | ??1 |
(Z)-and decahydro-6,8a-dihydroxy-1-isopropyl-3a, 6-dimethyl azulene-5-base-2-methyl but-2-ene acid esters | Molecule | ??1.0 | ??18.5 | ??1.0 | ??1 |
Phenylacetic acid-3,6,9-trimethyl-2,7-dioxy-2,3,3a, 4,5,7,9a, 9b-octahydro-azulene be [4,5-b] furan-4-base also | Molecule | ??20.0 | ??20.0 | ??1.0 | ??1 |
The Fructus Mangifera Indicae Lactobacillus plantarum | Fruit | ??1.0 | ??10 | ??3 | ??0.4 |
The nipa palm Lactobacillus plantarum | Fruit | ??1.0 | ??1 | ??60 | ??1 |
The Fructus Caricae lactic acid bacteria | Fruit | ??1.1 | ??4 | ??5 | ??0.6 |
The Fructus Musae lactic acid bacteria | Fruit | ??1.2 | ??10 | ??42 | ??0.4 |
??Lapiferin | Molecule | ??1.0 | ??2.8 | ??4.0 | ??1.0 |
" contrast * " refers to " contrast be multiply by "
Conclusion: 13 kinds of active substances in 960 kinds can significantly improve the expression rate of mRNA of the gene of encode in the keratinocyte MC-1R, MC-2R or [mu R under the condition of being considered.In addition, 4 kinds of active substances have suppressed the expression of pomc gene especially.
Embodiment 4: analyze the expression of the messenger RNA of receptor MC-1R and [mu R, for example undertaken by quantitative RT-PCR under the condition that makes melanocyte contact or not be in contact with it with active component
Except cell culture, other experiment conditions of this experiment are identical with a last embodiment.
From the plastic operation of normal adult, obtain melanocyte by enzymic digestion, in the melanocyte particular environment, make melanocyte propagation, inoculation (for example 50000 every square centimeter) in 24 orifice plates, is cultivated in the melanocyte particular environment then then.After converging, cell is contacted with the active substance that dilutes with culture medium, contact 24 hours usually.
Table III
Title (latin name) | Plant parts | The MC-1R contrast *: | [mu R contrast *: | The POMC contrast *; |
Common common milfoil (Achillea millefolium) | Plant | ??1.0 | ??1.0 | ??4.3 |
Galeopsis ochroleuca (Galeopsis och roleuca) | Plant | ??1.0 | ??1.0 | ??0.47 |
Radix Oenotherae erythrosepalae (Oenothera biennis) | Seed | ??4.0 | ??1.0 | ??1.96 |
1-methyl-β carboline-3-carboxylic acid | ??1.0 | ??1.0 | ??3.3 | |
The yeast milk acetic bacterial | ??1.0 | ??1 | ??2.18 | |
The Fructus Citri Limoniae bifidobacterium longum | ??1.0 | ??1.0 | ??2.18 | |
Rhizoma Smilacis Chinensis (beautiful colored Rhizoma Smilacis Chinensis (Smilax | Root | ??3.9 | ??1.0 | ??2.74 |
??ornata)) |
Title (latin name) | Plant parts | The MC-1R contrast *: | [mu R contrast *: | The POMC contrast *; |
Juniperus communis (Juniperus communis) | Fruit | ??0.4 | ??1.0 | ??0.25 |
??Cecropia?obtusia | Bud | ??3.2 | ??1.0 | ??2.18 |
The Fructus Caricae lactic acid bacteria | ??2.58 | ??1.0 | ??1.0 | |
Radix Dauci Sativae | Fruit | ??1.97 | ??1.0 | ??1.0 |
Sour cherry | Fruit | ??2.0 | ??1.0 | ??1.0 |
The lupin Lactobacillus plantarum | ??1.0 | ??1.0 | ??2.15 | |
Semen sojae atricolor powder | ??// | ??1.0 | ??1.0 | ??2.42 |
The nipa palm Lactobacillus plantarum | Fruit | ??3.23 | ??1.0 | ??1.0 |
The plumula sojae atricolor lactobacillus | ??2.0 | ??1.0 | ??1.0 |
" contrast * " refers to " contrast be multiply by "
Conclusion: 10 kinds of active substances have improved MC-1R expression of gene in the melanocyte; 9 kinds of active substances have improved the expression of pomc gene, and 2 kinds of active substances have reduced the expression of pomc gene in the melanocyte.
Embodiment 5: MC-1R, MC-2R after the effect of detection of active component in the keratinocyte and [mu albumen
Determine the characteristic of protein MC-1R, MC-2R and [mu: OPA1-15013 (Affinity biological reagent), AB5128 (Chemicon International) and AB5511 (Chemicon International) respectively by electrophoresis with following business-like polyclonal antibody.
In the K-SFM environment, containing 5%CO
2Atmosphere at 37 ℃ of cultured cells, contain BPE (25mg), EGF (2.5 μ g) and normocin among the K-SFM (Invitrogen).
Wash cell with PBS solution, (pH 7.5 for Tris50mM, NaCl 250mM, 1%triton) extract 30 minutes, extract protein with lysate in the presence of protease inhibitor at 4 ℃.With the pyrolysis product centrifugalize (15 minutes, 13,000g).In the presence of beta-mercaptoethanol, use Laemmli solution dilution floating thing, then electrophoresis.
With protein electrophoretic separation in the 4-12%SDS-polyacrylamide gel, be used for immune detection.The gained protein transduction is moved on on the nitrocellulose filter (Biorad).At room temperature film is dipped in the TBS solution that contains 3%BSA then, soaked one hour.4 ℃ with an anti-overnight incubation, at room temperature use coupling then Alexa 488 (invitrogen) two anti-above-mentioned protein is carried out immune detection, the time is 1 hour.
Above-mentioned antibody uses with following dilution factor: and 5 μ g/mL are anti--and MC-1R, 5 μ g/mL are anti--MC-2R and 1/1000 anti--[mu R.
Carrying out semidefinite by graphical analysis quantizes.Shown in the following Table IV of these active substances of being tried thing:
Table IV
Title | Plant parts: | The MC-2R contrast *: | [mu R contrast *: |
Common common milfoil | Plant | ??18.2 | ??2.81 |
Galeopsis ochroleuca | Plant | ??1.0 | ??2.54 |
Wild Fructus Colocasiae Esculentae | Tuber | ??1.0 | ??1.52 |
Sour cherry | Stem | ??1.0 | ??1.44 |
Radix Oenotherae erythrosepalae | Seed | ??1.0 | ??1.46 |
Prunus spinosa Linn. | Fruit | ??8.26 | ??2.02 |
(Z)-and decahydro-6,8a-dihydroxy-1-isopropyl-3a, 6-dimethyl azulene-5-base-2-methyl but-2-ene acid esters | ??1.99 | ??1.37 | |
Phenylacetic acid 3,6,9-trimethyl-2,7-dioxy-2,3,3a, 4,5,7,9a, 9b-octahydro azulene be [4,5-b] furan-4-base also | ??1.96 | ??1.66 |
" contrast * " refers to " contrast be multiply by "
Conclusion: the raising by protein level has confirmed at gene level viewed by the inductive raising of active substance.Though Galeopsis ochroleuca, Radix Oenotherae erythrosepalae and two kinds of molecules that characterized do not improve [mu R expression of gene, have induced the raising of its protein expression.
Embodiment 6: the immune detection of β III tubulin and neural thread protein NTP 200 in the human body slicer
The inventor shows in time biological aging process by immunofluorescence that tubulin β III and neural thread protein NTP 200 can reduce (Fig. 2) in neural biological aging process.The inventor has selected these two kinds of labels to be used for the existence that the detection of skin aixs cylinder prolongs.Label tubulin β III can be used for the pair cell nuclear volume and neutral net density is carried out quantification, and label neural thread protein NTP 200 is more suitable for indicating sophisticated neutral net.By 80 ages are checked between the immunofluorescence that 17 years old to 75 years old women's mammography slicer carries out, the inventor has confirmed to surpass 38 years old women's the expression of tubulin β III will hang down 3.7 times, then low 3.5 times of the expression of neural thread protein NTP 200.Above-mentioned antibody uses following dilution factor: 1: 500 (anti--tubulin β III) and 1: 500 (anti--neural thread protein NTP 200).Anti-mice IgG (goat) with combining ALEXA 594 is diluted to 1: 100 and detects immune complex.
Fig. 2 has shown the detection of the tubulin β III in the human body normal skin and neural thread protein NTP 200 being carried out by immunofluorescence.
The immune detection of tubulin β III is seen figure A among the so-called young experimenter (26 years old), and the immune detection of tubulin β III is seen figure B among the so-called old experimenter (56 years old).The immune detection of neural thread protein NTP 200 is seen figure C among the so-called young experimenter (26 years old), and the immune detection of neural thread protein NTP 200 is seen figure D among the so-called old experimenter (56 years old).The intersection of representing corium-epidermis with white line.The upper left square of each figure represents to use the negative control of contrast homotype antibody.
Fig. 3 and 4 has shown that respectively the age leads between 15 to 75 years old experimenter's the tubulin β III and the relative expression of neural thread protein NTP 200.Red arrow is represented curve break.
Fig. 5 and 6 shown respectively with Fig. 3 and 4 in the corresponding statistical analysis of research.The result shows, the difference among the young experimenter among 38 years old experimenter of expression ratio of β III tubulin and neural thread protein NTP 200 is high 3.7 and 3.5 times.The gained result has represented on average ± SD, p value=0.05 of t check.
Embodiment 7: excretory NGF of floating thing during keratinocyte is cultivated and the amount of VEGF
Old experimenter's keratinocyte is cultivated, cell is contacted a period of time with active substance, for example 24 hours, recover environment then, detect excretory NGF of keratinocyte or VEGF with elisa technique.Method therefor and development system supplier (DY256) be used for the method for NGF and scheme that Clinisciences (KHG0112) is used for VEGF consistent.In being tried active substance, the following active substance that tried has shown the strongest regulating action, particularly to the regulating action of NGF, as shown in Table V.
Table V
Plant | Plant part | The NGF contrast be multiply by |
Common common milfoil | Plant | ??11.28 |
Sour cherry | Stem | ??17.8 |
Galeopsis ochroleuca | Plant | ??11.24 |
Embodiment 8: the immune detection of β III tubulin and neural thread protein NTP 200 in the human body slicer of survival
In the DMEM culture medium, exist or do not exist under the condition of NGF or active component, the slicer that obtains from adult's plastic operation is kept survival 4 days.Then that slicer is freezing, carry out immunofluorescence research, to identify neuron label, the particularly material described in the embodiment 6.
Embodiment 9: the immune detection of differentiation in the skin model of reconstruction and propagation label
This model combines the additional cultivation of cultivation of rebuilding corium and the reconstruction epidermis that carries out on this basis.
Adopt following scheme to create the corium model of rebuilding:
-with 0.5 to 1.10
6Normal human dermal fibroblast is inoculated on the collagen-base base substrate, be generally the glycosaminoglycans chitosan, in nutritive medium, cultivate then, DMEM-Glutamax for example, wherein replenished the preferred 100 μ g/mL of 10% calf serum, the preferred 1mM of ascorbic acid ultimate density, the preferred 10ng/mL of EGF (epidermal growth factor) ultimate density and Normocin ultimate density, cultivated 21 days.
Adopt following scheme to create the skin model of rebuilding:
-with 0.5 to 1.10
6The normal keratinocyte of human body is inoculated on the dermal substitute, in nutritive medium, cultivate then, for example DMEM-Glutamax/Ham F-12 (ratio 3/1v/v) has wherein replenished calf serum, the preferred 1mM of ascorbic acid ultimate density, the preferred 10ng/mL of EGF (epidermal growth factor) ultimate density, the preferred 0.4 μ g/mL of hydrocortisone ultimate density, the preferred 0.12UI/mL of umuline ultimate density, the preferred 0.4 μ g/mL of isoproterenol ultimate density, trilute ultimate density preferred 2.10
-9M, the preferred 24.3 μ g/mL of adenine ultimate density and the preferred 100 μ g/mL of Normocin ultimate density.Under soaking conditions, cultivated 7 days.Place the liquid-vapor interface place to cultivate 14 days culture, the culture environment when used culture medium is cultivated with immersion is identical, except calf serum, hydrocortisone, isoproterenol, trilute and umuline again.
Then the preparation of Boulin fixative (LOX, LOXL, elastin) or 10% formalin (being used for elastin) rebuild skin (
Coletica, Lyons, France), with the paraffin sealing, be used for immunohistochemistry research, or directly use liquid nitrogen freezing then, be used for immunofluorescence analysis.From paraffin, take out 6 μ m slabs, bleaching in glycine-HCl (100mmol/l).The 45th day to rebuild skin carry out Ki67 (propagation label), keratin 14 (label of all cells layer), keratin 10 (epibasal keratinocyte layer label), in drape over one's shoulders albumen, T-5398, nestin immune detection.
Embodiment 10: be used in combination product of the present invention and existing patent molecule
Product of the present invention and the extract combination that particularly can stimulate the cutaneous nerve vegetative function that the sensitive skin nerve is worked can be used, for example Capsicum tetragonum extract (Fructus Capsici) and/or red pigment (Fructus Capsici) and/or Fructus Piperis (L ' OREAL FR2825273), and/or glutamy amido ethylindole (Exsymol).
Product of the present invention and simulation β endorphins can be done to use in order to the extract combination of improving skin barrier function, for example cacao bean hull extract (L ' OREAL US2006069032).
Also product of the present invention and activation β endorphins can be used with the extract combination that produces the health and happiness sense, for example Tephrosia purpurea (Herba Tephrosiae purpureae) extract.
Also product of the present invention and other molecule or derivatives thereofs can be used in combination, for other molecules, for example α-MSH, β endorphins, for its derivant, for example P3 endorphins and quintessence oil, to stimulate the keratinocyte differentiation,, thereby affect the nerves vegetative function with the aging resistance effect (CODIF FR2857874) of acquisition NGF.
Embodiment 11:
The prescription that product of the present invention is used for oil in water emulsion type cosmetics or pharmaceutical preparation
Prescription 11a:
Prescription 11b:
Prescription 11c:
Embodiment 12:
Product of the present invention is used for the water-in-oil type prescription
Embodiment 13:
Product of the present invention is used for shampoo or bath gels type prescription
Embodiment 14:
The prescription that product of the present invention is used for lip pomade type or other anhydrous products
Embodiment 15: the prescription that product of the present invention is used for hydrogel (eye cream, slimming cream etc.)
Embodiment 16:
Product of the present invention is used for triple emulsion type prescription
Elementary newborn W1/O
Secondary breast W1/O/W2
Embodiment 17:
Contain the preparation of the pharmaceutical dosage form of product of the present invention
Prescription 17a: the preparation of pill
*For example, dry then according to the leaching process of describing among the embodiment 3, can obtain product of the present invention.
Prescription 17b: the preparation of pomade
*For example, dry then according to the leaching process of describing among the embodiment 3, can obtain product of the present invention.
Prescription 17c: the preparation of injectable formulation
*For example, dry then according to the leaching process of describing among the embodiment 3, can obtain product of the present invention.
Claims (17)
1. stimulate the purposes of at least a material of in the Skin Cell of at least a type, expressing by the neurohumoral receptor of pomc gene coding, as the active component in the cosmetic composition, perhaps be used to prepare the nourishing healthy compositions as active component, wherein said receptor is selected from MC-1R, MC-2R and [mu R, and the Skin Cell of described at least a type is expressed at least a these receptors and pomc gene product.
2. the purposes of at least a material according to claim 1, wherein said material are also regulated, are preferably improved or keep POMC and express.
3. purposes according to claim 1 and 2 is used for stimulating described receptor expression to increase the cosmetic result of α-MSH and/or ACTH and/or β endorphins.
4. stimulate the purposes of at least a material that the receptor be selected from MC-1R and MC-2R expresses in keratinocyte, be used for pharmaceutical compositions, particularly dermatologic medicine compositions.
5. be selected from the receptor expression of MC-1R, MC-2R and [mu R and adjusting, preferably improve or keep the purposes of at least a material that POMC expresses at the keratinocyte moderate stimulation, be used for pharmaceutical compositions, particularly dermatologic medicine compositions.
6. according to each described purposes in the aforementioned claim, be used to resist or prevent the imbalance of α-MSH and/or ACTH and/or β endorphins effect.
7. according to each described purposes in the aforementioned claim, wherein Skin Cell is a keratinocyte.
8. according to each described purposes in the aforementioned claim, be used for prevention or opposing skin aging and/or opposing in the inductive variation of the observed stress of ageing processes of skin, and/or prevention and/or opposing epidermis homeostasis weaken, and/or promote epithelium to form, and/or improve cell proliferation and differentiation, particularly in the epidermis level, and/or the minimizing of prevention or the formation of opposing skin heart, and/or improve skin heart and form, and/or the permeability that improves blood vessel is too high, and/or the angiogenesis during improving skin and scabbing, and/or prevention and/or opposing cutaneous nerve domination weaken, or improve the cutaneous nerve domination, or produce the health and happiness sense, and/or improve the colour of skin and/or regulate skin pigment and form, particularly show as local flaw for example during pigmented spots when described chromogenesis.
9. according to each described purposes in the claim 1 to 8, it is characterized in that described material is selected from:
The extract of-common common milfoil plant (Achillea millefolium);
The extract of-Prunus spinosa Linn. (Prunus spinosa);
The extract of-sour cherry (Prunus cerasus);
The extract of-wild Fructus Colocasiae Esculentae (Colocasia esculenta);
The extract of-wild Fructus Cannabis (Galeopsis ochroleuca (Galeopsis ochroleuca));
-vinburnine extract (Apocynaceae (Apocynacea) AmsoniaAbrenaemontan);
-(Z)-and decahydro-6,8a-dihydroxy-1-isopropyl-3a, 6-dimethyl azulene-5-base-2-methyl fourth 2-olefin(e) acid ester;
-phenylacetic acid-3,6,9-trimethyl-2,7-dioxy-2,3,3a, 4,5,7,9a, 9b-octahydro azulene be [4,5-b] furan-4-base also;
Under-CAS the 352220-52-1 2,6-dimethyl-4 (2-methyl butene acid esters)-5-6-(1-isopropyl-1-hydroxy-cyclopentane))-1,2-epoxide ring heptane and/or its ester
-known 7-acetas-2 under CAS 86992-41-8,6-dimethyl-4 (2-methyl butene acid esters)-5-6-(1-isopropyl-1-hydroxy-cyclopentane))-1,2-epoxide ring heptane
The mango extract that-usefulness lactobacillus (lactobacillus) transforms
-nipa palm the extract that transforms with lactobacillus
-the melon tree extract that transforms with lactic acid bacteria
-the Fructus Musae extract that transforms with lactic acid bacteria
-and their any mixture.
10. be selected from the purposes of following material:
The extract of-common common milfoil plant (Achillea millefolium);
The extract of-Prunus spinosa Linn. (Prunus spinosa);
The extract of-sour cherry (Prunus cerasus);
The extract of-wild Fructus Colocasiae Esculentae (Colocasia esculenta);
The extract of-wild Fructus Cannabis (Galeopsis ochroleuca (Galeopsis ochroleuca));
-vinburnine extract (Apocynaceae (Apocynacea) AmsoniaAbrenaemontan);
-(Z)-and decahydro-6,8a-dihydroxy-1-isopropyl-3a, 6-dimethyl azulene-5-base-2-methyl but-2-ene acid esters;
-phenylacetic acid-3,6,9-trimethyl-2,7-dioxy-2,3,3a, 4,5,7,9a, 9b-octahydro azulene be [4,5-b] furan-4-base also;
Under-CAS the 352220-52-1 2,6-dimethyl-4 (2-methyl butene acid esters)-5-6-(1-isopropyl-1-hydroxy-cyclopentane))-1,2-epoxide ring heptane and/or its ester
-known 7-acetas-2 under CAS 86992-41-8,6-dimethyl-4 (2-methyl butene acid esters)-5-6-(1-isopropyl-1-hydroxy-cyclopentane))-1,2-epoxide ring heptane
-the mango extract that transforms with lactobacillus
-nipa palm the extract that transforms with lactobacillus
-the melon tree extract that transforms with lactic acid bacteria
-the Fructus Musae extract that transforms with lactic acid bacteria
-and their any mixture,
Be used for prevention or opposing skin aging and/or opposing in the inductive variation of the observed stress of ageing processes of skin, and/or prevention and/or opposing epidermis homeostasis weaken, and/or promote epithelium to form, and/or improve cell proliferation and differentiation, particularly in the epidermis level, and/or the minimizing of prevention or the formation of opposing skin heart, and/or improve skin heart and form, and/or the permeability that improves blood vessel is too high, and/or the angiogenesis during improving skin and scabbing, and/or prevention and/or opposing cutaneous nerve domination weaken, or improve cutaneous nerve and arrange, or produce the health and happiness sense, and and/or improve the colour of skin and/or regulate skin pigment and form, particularly show as local flaw for example during pigmented spots when described chromogenesis.
11. according to each described purposes in the claim 1 to 10, be used for using with other material, wherein said other material improves or reduces by melanocyte at least a receptor expression that express, that be selected from MC-1R and [mu, and may regulate the expression of pomc gene, form to improve the colour of skin and/or to regulate skin pigment, particularly show as local flaw for example during pigmented spots when described chromogenesis.
12. according to the purposes of claim 11, wherein said other material is selected from:
-1-methyl-B-carboline-3-carboxylic acid;
The yeast of-lactic acid bacteria fermentation,
The citron extract of-bacillus bifidus (bifidobacterium) fermentation,
The melon tree extract of-lactic acid bacteria fermentation,
The lupin extract of-lactic acid bacteria fermentation,
The soybean extract of-lactic acid bacteria fermentation,
The nipa palm extract of-lactic acid bacteria fermentation,
-Semen sojae atricolor powder extract,
The extract of-Rhizoma Smilacis Chinensis (beautiful colored Rhizoma Smilacis Chinensis (Smilax ornata)),
-Cecropia obtusa extract,
The extract of-common common milfoil (Achillea millefolium),
The extract of-Radix Oenotherae erythrosepalae (Oenothera biennis),
-Radix Dauci Sativae extract,
-bracken extract,
The extract of-sour cherry (Prunus cerasus),
The water extract or the water-alcohol extraction of-Juniperus communis (Juniperus communis) (gin),
The extract of-Galeopsis ochroleuca (Galeopsis ochroleuca)
The extract of-Radix Oenotherae erythrosepalae (Oenothera biennis)
-and their any mixture.
13., it is characterized in that described material is used for and is selected from following other active component being used in combination according to each described purposes in the aforementioned claim:
-stimulate the active substance of keratinocyte propagation and/or differentiation, be intended to have the aging resistance effect;
The work of-simulation β endorphins is in order to improve the active substance of skin barrier function;
The active substance of-chafe neurotrophy function;
-induce the active substance of health and happiness sense;
-permission changes the active substance of the colour of skin,
The active substance of-stimulation fibroblast activity and/or propagation
-have an enzymatic activity of the active substance of inflammatory properties, particularly inhibition of phospholipase A 2,
-protection fibroblast growth factor is the active substance that is not degraded of FGF2 particularly,
-stimulation hyaluronidase synthase, the particularly active substance of hyaluronidase synthase 2,
-stimulation lysyloxidase is the active and/or synthetic active substance of LOXL for example,
-have an active substance of eliminating the edema characteristic,
-and their any combination.
14. cosmetic composition or skin cosmetic composition or nourishing healthy compositions, be used for preventing and/or opposing skin aging and/or opposing inductive variation of observed stress in ageing processes of skin, or prevention and/or opposing epidermis homeostasis weaken, or promote epithelium to form, or improve cell proliferation and differentiation, particularly in the epidermis level, or the minimizing of prevention or the formation of opposing skin heart, or improve skin heart and form, or it is too high to improve vascular permeability, or the angiogenesis during improving skin and scabbing, or prevention and/or opposing cutaneous nerve domination weaken, or improve the cutaneous nerve domination, or produce the health and happiness sense, or improve the colour of skin and/or regulate skin pigment and form, particularly show as local flaw for example during pigmented spots when described chromogenesis; Described compositions comprises the active substance as active component, as in claim 9 or 10 definition active substance, possibly with as each described combinations of substances in the claim 11 to 13.
15. pharmaceutical composition, be preferably used for prevention and/or opposing skin aging and/or opposing inductive variation of observed stress in ageing processes of skin, or prevention and/or opposing epidermis homeostasis weaken, or promote epithelium to form, or improve cell proliferation and differentiation, particularly in the epidermis level, or the minimizing of prevention or the formation of opposing skin heart, or improve skin heart and form, or it is too high to improve vascular permeability, or the angiogenesis during improving skin and scabbing, or prevention and/or opposing cutaneous nerve domination weaken, or improve the cutaneous nerve domination, or produce the health and happiness sense, or improve the colour of skin and/or regulate skin pigment and form, particularly show as local flaw for example during pigmented spots when described chromogenesis; Described compositions comprises the active substance as active component, as in claim 9 or 10 definition active substance, possibly with as each described combinations of substances in the claim 11 to 13.
16. beautifying nursing method, comprise will be in claim 9 or 10 material of definition be applied on the skin, the cosmetic result that is used to improve, possibly with claim 11 to 13 in each described combinations of substances.
17. nucleotide sequence, it has a kind of sequence in the following sequence:
(MC-1R has justice-SEQ ID N to GGGCTCTGAGAACGACTTTT
o7);
CCGGGCTCCTGTCTGGTTGG (MC-1R antisense-SEQ ID N
o8);
(MC-2R has justice-SEQ ID N to TCACGTCGCTGTTCCCGCTGAT
o9);
AAGAGAGACATGTAGCAGGCGCAGTA (MC-2R antisense-SEQ IDN
o10);
([mu has justice-SEQ ID N to CTCAGCCAGGACTGGTTTCTGTAAGA
o11);
TCGGACAGGTTGCCATCTAAGTG ([mu antisense-SEQID N
o12);
(POMC has justice-SEQ ID N to CGCCCAGTGAAGGTGTACCC
o13); With
GGCGTCTGGCTCTTCTCGGAGGTC (POMC antisense-SEQ ID N
o14).
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0755529A FR2916977A1 (en) | 2007-06-06 | 2007-06-06 | STIMULATION OF SYNTHESIS OF MCR1, MCR2 AND μ OPIOID RECEPTORS. |
FR0755529 | 2007-06-06 | ||
PCT/EP2008/057129 WO2008148891A2 (en) | 2007-06-06 | 2008-06-06 | MC-1R, MC-2R, AND/OR µ OPIOID RECEPTORS STIMULATION |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101711152A true CN101711152A (en) | 2010-05-19 |
CN101711152B CN101711152B (en) | 2013-09-11 |
Family
ID=38961885
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2008800191887A Active CN101711152B (en) | 2007-06-06 | 2008-06-06 | Mc-1r, mc-2r, and/or [mu] opioid receptors stimulation |
CN200880101954A Pending CN101772349A (en) | 2007-06-06 | 2008-06-06 | The adjusting of MC-1R, MC-2R and [mu |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN200880101954A Pending CN101772349A (en) | 2007-06-06 | 2008-06-06 | The adjusting of MC-1R, MC-2R and [mu |
Country Status (9)
Country | Link |
---|---|
US (2) | US20100209407A1 (en) |
EP (3) | EP2157966B1 (en) |
JP (4) | JP2010529960A (en) |
KR (3) | KR20100040836A (en) |
CN (2) | CN101711152B (en) |
BR (2) | BRPI0813897A2 (en) |
ES (1) | ES2730836T3 (en) |
FR (1) | FR2916977A1 (en) |
WO (2) | WO2008148891A2 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106146445A (en) * | 2015-04-27 | 2016-11-23 | 中国人民解放军第二军医大学 | The extracting method of monomer dehydrogenation matricarin ketone and application thereof in sagebruss artemisia anomalas |
Families Citing this family (21)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR2916977A1 (en) * | 2007-06-06 | 2008-12-12 | Engelhard Lyon Sa | STIMULATION OF SYNTHESIS OF MCR1, MCR2 AND μ OPIOID RECEPTORS. |
CN101999999B (en) * | 2009-09-01 | 2012-02-01 | 珈侬生化科技(中国)有限公司 | Method for preparing active extract of Juniperus sibirica and whitening and anti-ageing active cosmetic |
CN101691596B (en) * | 2009-10-15 | 2012-02-29 | 哈尔滨商业大学 | Methods of hydrolyzing soyabean protein to produce exorphins |
FR2999933B1 (en) | 2012-12-21 | 2020-01-31 | Société des Produits Nestlé S.A. | USE OF PROBIOTIC MICROORGANISMS AS A MELANIN SYNTHESIS AGENT |
FR2999931A1 (en) * | 2012-12-21 | 2014-06-27 | Oreal | USE OF PROBIOTIC MICROORGANISMS AS AN AGENT PROMOTING MELANIN SYNTHESIS |
FR2999932B1 (en) * | 2012-12-21 | 2020-01-31 | Société des Produits Nestlé S.A. | USE OF PROBIOTIC MICROORGANISMS AS A MELANIN SYNTHESIS AGENT |
FR2999930A1 (en) * | 2012-12-21 | 2014-06-27 | Oreal | USE OF PROBIOTIC MICROORGANISMS AS AN AGENT PROMOTING MELANIN SYNTHESIS |
FR3000488B1 (en) | 2012-12-27 | 2015-10-02 | Basf Beauty Care Solutions F | NOVEL DERIVATIVES OF SINAPIC ACID AND THEIR COSMETIC OR PHARMACEUTICAL USES |
FR3004348A1 (en) * | 2013-04-11 | 2014-10-17 | Limousine D Applic Biolog Soc Ind | USE OF CUTANEOUS CELL AUTOPHAGIC ACTIVATORS TO PROMOTE CELL AND TISSUE LONGEVITY OF THE SKIN |
JP2014062136A (en) * | 2014-01-17 | 2014-04-10 | Oriza Yuka Kk | Melanogenesis inhibitor |
WO2015121092A1 (en) * | 2014-01-30 | 2015-08-20 | Vib Vzw | Opioid receptor binding agents and uses thereof |
JP5629841B1 (en) * | 2014-08-06 | 2014-11-26 | 大高酵素株式会社 | Method for producing fermented cosmetic and lactic acid bacteria strain |
US10093960B2 (en) | 2015-07-24 | 2018-10-09 | Molecular Devices, Llc | Luminescence measurement of biological samples utilizing dual reagents |
US10806769B2 (en) | 2016-03-31 | 2020-10-20 | Gojo Industries, Inc. | Antimicrobial peptide stimulating cleansing composition |
JP2019510036A (en) | 2016-03-31 | 2019-04-11 | ゴジョ・インダストリーズ・インコーポレイテッド | A detergent composition comprising probiotic / prebiotic active ingredients |
CA3043748A1 (en) | 2016-11-23 | 2018-05-31 | Gojo Industries, Inc. | Sanitizer composition with probiotic/prebiotic active ingredient |
EP3651728B1 (en) | 2017-07-12 | 2022-10-26 | Unilever IP Holdings B.V. | Freeze dried active composition |
IT201700089680A1 (en) * | 2017-08-03 | 2019-02-03 | Giuliani Spa | SYNERGIC COMPOSITION AS A SELF-MAGIC PROMOTER / A SYNERGISTIC COMPOSITION AS A PROMOTER OF AUTOPHAGY |
FR3075646B1 (en) * | 2017-12-21 | 2019-12-20 | Robertet S.A. | USE OF ABSOLUTE IN COSMETICS TO DEPIGMENT SKIN |
CN113402506B (en) * | 2021-06-17 | 2023-06-16 | 四川大学 | Intermediate, preparation method and application thereof in synthesizing vinca-bunting |
CN113867252A (en) * | 2021-10-13 | 2021-12-31 | 南京凌华微电子科技有限公司 | PLC data acquisition and processing method and device for dust collector test |
Family Cites Families (68)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NL17479C (en) | 1924-12-08 | 1928-01-16 | ||
US3522350A (en) * | 1969-11-10 | 1970-07-28 | Arthur Goldberg | Process for extracting an anti-inflammatory and anti - irritant principle from yarrow and the product produced thereby |
IT1120139B (en) * | 1979-12-04 | 1986-03-19 | Kibarska Totka | ANTI-WRINKLE AGENT PROCEDURE TO PREPARE IT AND ANTI-WRINKLE COSMETIC PREPARATION CONTAINING THAT AGENT |
FR2557452B1 (en) * | 1983-12-28 | 1986-08-14 | Roussel Uclaf | NOVEL COMPOSITIONS FOR SKIN CARE CONTAINING PRIMER OIL AND RATE TISSUE TRAITS |
FR2559390A1 (en) * | 1984-02-10 | 1985-08-16 | Szilasmenti Mgtsz | Skin regeneration agents |
FR2578422B1 (en) * | 1985-03-05 | 1987-06-26 | Cariel Leon | TREATMENT COMPOSITION FOR EXTERNAL LUTEOLINE-BASED USE AND PREPARATION METHOD |
LU85863A1 (en) * | 1985-04-22 | 1986-11-05 | Oreal | COSMETIC COMPOSITION FOR THE TREATMENT OF HAIR, ESPECIALLY OILY HAIR, BASED ON MILLEFEUILLE EXTRACT (ACHILEA MILLEFOLIUM L) |
US5057502A (en) * | 1987-06-02 | 1991-10-15 | Walsh William E | Composition and topical and systemic treatments of conditions caused by heavy, oily or greasy secretions |
CN1102090A (en) * | 1993-10-23 | 1995-05-03 | 中国科学院大连化学物理研究所 | Cosmetics prepared by using oenothera oil as raw material |
US5932779A (en) * | 1996-06-10 | 1999-08-03 | Millennium Pharmaceuticals, Inc. | Screening methods for compounds useful in the regulation of body weight |
WO1998005294A1 (en) * | 1996-08-02 | 1998-02-12 | Plum Kemi Produktion A/S | An oil-in-water emulsion for use on human skin for cleansing, preserving or improving the condition of the skin |
JPH11158053A (en) * | 1997-12-01 | 1999-06-15 | Nippon Shinyaku Co Ltd | Cosmetic |
JPH11246336A (en) * | 1998-02-27 | 1999-09-14 | Ichimaru Pharcos Co Ltd | Activated oxygen scavenger and skin beautifying cosmetic composition |
WO2000018416A1 (en) * | 1998-09-30 | 2000-04-06 | Industrial Research Limited | Antioxidant compositions and process for their preparation |
JP3522609B2 (en) * | 1999-10-14 | 2004-04-26 | 株式会社ノエビア | Hyaluronic acid production promoter and skin external preparation containing the same |
JP2001233725A (en) * | 2000-02-23 | 2001-08-28 | Shin Nippon Yakugyou Kk | Cosmetic composition containing polyphenol compound derived from oenothera tetraptera |
JP2001302440A (en) * | 2000-04-17 | 2001-10-31 | Masaaki Okubo | Cosmetic |
JP2001335497A (en) * | 2000-05-25 | 2001-12-04 | Kose Corp | Skin care preparation and skin care preparation composition |
JP2002020225A (en) * | 2000-07-10 | 2002-01-23 | Naris Cosmetics Co Ltd | Humectant composition |
JP4402278B2 (en) * | 2000-10-27 | 2010-01-20 | 日本メナード化粧品株式会社 | Whitening cosmetics |
FR2817747B1 (en) * | 2000-12-11 | 2004-12-03 | Oreal | USE OF AT LEAST ONE SAPOGENIN, OR A NATURAL EXTRACT CONTAINING IT, TO PREVENT THE SIGNS OF SKIN AGING |
JP2002193783A (en) * | 2000-12-27 | 2002-07-10 | Kanebo Ltd | Cosmetic composition |
JP2002205950A (en) * | 2001-01-10 | 2002-07-23 | Ichimaru Pharcos Co Ltd | Elastase activity inhibitor and cosmetic composition |
FR2825273B1 (en) | 2001-05-29 | 2006-11-24 | Oreal | COMPOSITION FOR THE TREATMENT OF SKIN SIGNS OF AGING |
DE20112636U1 (en) * | 2001-07-31 | 2002-01-10 | Kundic Sida | Pasty mass for skin care |
US20030110518A1 (en) * | 2001-09-28 | 2003-06-12 | Houseknecht Karen L. | Melanocortin-5 receptor sequences and uses thereof |
JP2003113066A (en) * | 2001-10-01 | 2003-04-18 | Ai Corporation:Kk | Cosmetic |
JP2003192568A (en) * | 2001-12-27 | 2003-07-09 | Nonogawa Shoji Kk | Fragrant cosmetic composition |
JP2003212770A (en) * | 2002-01-22 | 2003-07-30 | Ichimaru Pharcos Co Ltd | Maillard reaction inhibitor |
US20030186249A1 (en) * | 2002-04-01 | 2003-10-02 | Zairen Sun | Human TARPP genes and polypeptides |
JP3908126B2 (en) * | 2002-08-30 | 2007-04-25 | 株式会社ナリス化粧品 | Epidermal keratinization normalizing agent and skin external preparation containing the same |
JP3544541B2 (en) * | 2002-10-04 | 2004-07-21 | 株式会社アイデアる | Compost cutting stirrer |
JP2004137233A (en) * | 2002-10-21 | 2004-05-13 | Kose Corp | Antiaging agent and external preparation for skin using the same |
FR2847267B1 (en) | 2002-11-19 | 2006-07-28 | Coletica | METHOD FOR TESTING THE ACTIVITY OF A POTENTIALLY ACTIVE SUBSTANCE FOR INHIBITING THE ENZYMATIC ACTIVITY OF A2 PHOSPHOLIPASE |
KR100513082B1 (en) * | 2002-11-27 | 2005-09-07 | 나드리화장품주식회사 | Cosmetic composition containing ceramide liposome with phyto complex extract and ceramide |
JP2004196669A (en) * | 2002-12-16 | 2004-07-15 | Kose Corp | Melanocyte proliferation inhibitor and skin care preparation for external use comprising the same |
WO2004096144A2 (en) * | 2003-04-28 | 2004-11-11 | 3M Innovative Properties Company | Compositions and methods for induction of opioid receptors |
TW200512007A (en) * | 2003-05-30 | 2005-04-01 | Fullerene Internat Corp | Cosmetic compositions containing fullerene clusters |
FR2855968B1 (en) | 2003-06-13 | 2012-11-30 | Coletica | STIMULATION OF THE SYNTHESIS AND ACTIVITY OF A LYSYL OXIDASE-LIKE LOXL ISOFORM TO STIMULATE THE FORMATION OF ELASTIC FIBERS |
JP2005008539A (en) * | 2003-06-17 | 2005-01-13 | Fancl Corp | Matrix metalloproteinase inhibitor |
US20050036974A1 (en) | 2003-07-17 | 2005-02-17 | L'oreal | Beta-endorphin activity in cosmetics and dermatology |
FR2857874A1 (en) | 2003-07-21 | 2005-01-28 | Courtage Et De Diffusion Codif | Use of beta-endorphin, or agents that stimulate its production, for pharmaceutical or cosmetic modification of keratinocyte differentiation |
ATE416012T1 (en) * | 2003-10-14 | 2008-12-15 | Showa Denko Kk | AGENT FOR EXTERNAL USE ON THE SKIN COMPRISING A SALT OF AN ASCORBIC ACID DERIVATIVE, METHOD FOR STABILIZING THE AGENT FOR EXTERNAL USE ON THE SKIN |
US20060233739A1 (en) * | 2003-11-24 | 2006-10-19 | Thornfeldt Carl R | Treatment of mucocutaneous disorders through reversing chronic imflammation and barrier disruption |
AU2004296694C1 (en) * | 2003-12-15 | 2011-05-19 | Kuraray Co., Ltd. | External preparations for skin |
ES2235642B2 (en) * | 2003-12-18 | 2006-03-01 | Gat Formulation Gmbh | CONTINUOUS MULTI-MICROENCAPSULATION PROCESS FOR THE IMPROVEMENT OF STABILITY AND STORAGE OF BIOLOGICALLY ACTIVE INGREDIENTS. |
BG65694B1 (en) * | 2003-12-31 | 2009-07-31 | Владимир НАЙДЕНОВ | Means for the treatment of dermatoses |
JP4569312B2 (en) * | 2004-02-25 | 2010-10-27 | 大正製薬株式会社 | Whitening agent |
FR2867476B1 (en) * | 2004-03-11 | 2006-05-26 | Michel Prost | GENKWANINE AND SAKURANETINE DERIVATIVES, COSMETIC AND THERAPEUTIC USE, AND PREPARATION METHOD |
DE102004049062A1 (en) * | 2004-03-30 | 2005-10-13 | bitop Aktiengesellschaft für biotechnische Optimierung | Topical preparation for application on the skin containing natural oil of the evening primrose (Oenothera biennis) (= Oleum Oenothera) and osmolytes from extremophilic microorganisms |
US20050220744A1 (en) * | 2004-03-31 | 2005-10-06 | Showa Denko K.K. | Polysaccharide/functional compound complex |
JP2005314286A (en) * | 2004-04-28 | 2005-11-10 | Zenzaburo Hara | Bleaching cosmetic |
JP2006001837A (en) * | 2004-06-15 | 2006-01-05 | Nonogawa Shoji Kk | Opioid receptor damage inhibitor |
DE102004038728A1 (en) * | 2004-08-10 | 2006-03-02 | Merck Patent Gmbh | Flavonoid complexes |
JP2006076927A (en) * | 2004-09-09 | 2006-03-23 | Toyo Shinyaku:Kk | Fermented material obtained from mango |
JP4387903B2 (en) * | 2004-09-09 | 2009-12-24 | 株式会社東洋新薬 | Fermented material obtained from papaya |
JP2006117612A (en) * | 2004-10-25 | 2006-05-11 | Ichimaru Pharcos Co Ltd | Active oxygen eliminating agent |
EP1819356A4 (en) * | 2004-11-18 | 2010-07-07 | Biopharmacopae Design Internat | Plant extract having matrix metalloprotease inhibiting activity and dermatological uses thereof |
JP2006176414A (en) * | 2004-12-21 | 2006-07-06 | Noevir Co Ltd | External preparation for skin |
JP2006249000A (en) * | 2005-03-11 | 2006-09-21 | Aging Kenkyusho:Kk | Bleaching cosmetic and bleaching cosmetic set |
JP2006347995A (en) * | 2005-06-20 | 2006-12-28 | Yukihiro Hirose | Composition for makeup |
FI118117B (en) * | 2005-08-12 | 2007-07-13 | Lumene Oy | Cosmetic product for the treatment of the scalp |
WO2007030666A2 (en) * | 2005-09-07 | 2007-03-15 | Herbal Intervention Corporation | Medicated skin care preparation for promoting wound healing |
EP1926490A2 (en) * | 2005-09-23 | 2008-06-04 | DSMIP Assets B.V. | Use of opioid receptor antagonists |
FR2893252B1 (en) | 2005-11-17 | 2008-02-15 | Engelhard Lyon Sa | VEGETABLE EXTRACTS STIMULATING HAS2 |
IL179539A (en) * | 2006-11-23 | 2010-11-30 | Redent Nova Ltd | Dental irrigator |
JP4902747B2 (en) * | 2007-04-02 | 2012-03-21 | ドンウォン カン | Contact lens storage case |
FR2916977A1 (en) * | 2007-06-06 | 2008-12-12 | Engelhard Lyon Sa | STIMULATION OF SYNTHESIS OF MCR1, MCR2 AND μ OPIOID RECEPTORS. |
-
2007
- 2007-06-06 FR FR0755529A patent/FR2916977A1/en not_active Withdrawn
-
2008
- 2008-06-06 WO PCT/EP2008/057129 patent/WO2008148891A2/en active Application Filing
- 2008-06-06 KR KR1020107000086A patent/KR20100040836A/en not_active Application Discontinuation
- 2008-06-06 US US12/663,021 patent/US20100209407A1/en not_active Abandoned
- 2008-06-06 BR BRPI0813897-4A2A patent/BRPI0813897A2/en not_active Application Discontinuation
- 2008-06-06 BR BRPI0812575A patent/BRPI0812575B1/en active IP Right Grant
- 2008-06-06 CN CN2008800191887A patent/CN101711152B/en active Active
- 2008-06-06 WO PCT/EP2008/057130 patent/WO2008148892A2/en active Application Filing
- 2008-06-06 CN CN200880101954A patent/CN101772349A/en active Pending
- 2008-06-06 KR KR1020107000087A patent/KR101661769B1/en active IP Right Grant
- 2008-06-06 EP EP08760698.4A patent/EP2157966B1/en active Active
- 2008-06-06 EP EP08760699A patent/EP2157978A2/en not_active Withdrawn
- 2008-06-06 ES ES08760698T patent/ES2730836T3/en active Active
- 2008-06-06 EP EP12189355A patent/EP2574332A1/en not_active Withdrawn
- 2008-06-06 JP JP2010510829A patent/JP2010529960A/en active Pending
- 2008-06-06 KR KR20157005421A patent/KR20150030281A/en active IP Right Grant
- 2008-06-06 JP JP2010510828A patent/JP5686597B2/en active Active
- 2008-06-06 US US12/663,015 patent/US20100272699A1/en not_active Abandoned
-
2013
- 2013-10-22 JP JP2013218869A patent/JP2014024860A/en active Pending
-
2016
- 2016-01-07 JP JP2016001414A patent/JP6215364B2/en active Active
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106146445A (en) * | 2015-04-27 | 2016-11-23 | 中国人民解放军第二军医大学 | The extracting method of monomer dehydrogenation matricarin ketone and application thereof in sagebruss artemisia anomalas |
CN106146445B (en) * | 2015-04-27 | 2018-10-19 | 中国人民解放军第二军医大学 | The extracting method of monomer dehydrogenation matricarin ketone and its application in sagebruss artemisia anomalas |
Also Published As
Publication number | Publication date |
---|---|
US20100272699A1 (en) | 2010-10-28 |
KR20100040836A (en) | 2010-04-21 |
ES2730836T3 (en) | 2019-11-12 |
EP2157966A2 (en) | 2010-03-03 |
JP6215364B2 (en) | 2017-10-18 |
KR20150030281A (en) | 2015-03-19 |
EP2157978A2 (en) | 2010-03-03 |
WO2008148892A3 (en) | 2009-03-12 |
JP2014024860A (en) | 2014-02-06 |
US20100209407A1 (en) | 2010-08-19 |
EP2574332A1 (en) | 2013-04-03 |
EP2157966B1 (en) | 2019-03-13 |
WO2008148891A2 (en) | 2008-12-11 |
JP2010529960A (en) | 2010-09-02 |
JP2010529092A (en) | 2010-08-26 |
BRPI0812575B1 (en) | 2017-04-11 |
JP5686597B2 (en) | 2015-03-18 |
KR20100029818A (en) | 2010-03-17 |
WO2008148892A2 (en) | 2008-12-11 |
JP2016128438A (en) | 2016-07-14 |
CN101772349A (en) | 2010-07-07 |
FR2916977A1 (en) | 2008-12-12 |
WO2008148891A3 (en) | 2009-03-19 |
CN101711152B (en) | 2013-09-11 |
KR101661769B1 (en) | 2016-10-05 |
BRPI0812575A2 (en) | 2014-09-30 |
BRPI0813897A2 (en) | 2014-12-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101711152B (en) | Mc-1r, mc-2r, and/or [mu] opioid receptors stimulation | |
DE102004045187B4 (en) | Drugs for the conversion of inactive TGFb latent in active TGFb and their use in cosmetic and pharmaceutical compositions | |
EP3060311B1 (en) | Skin lightening cosmetic compositions and methods | |
CN107106480A (en) | Cosmetic composition containing Halomonas extractive from fermentative and application thereof | |
DE102004028302A1 (en) | Stimulating the synthesis and activity of an isoform of lysyl oxidase-like LOXL to stimulate the formation of elastic fibers | |
CN109715183A (en) | The new beauty and make-up and/or nutrition and health care or dermatological use of yeast extract | |
US20160095815A1 (en) | Substance for restoring normal co-expression and interaction between the lox and nrage proteins | |
DE102004028300B4 (en) | Stimulating the activity of an isoform of lysyl oxidase to combat some pathologies caused by incomplete, absent or disorganized elastogenesis | |
CN108778241A (en) | Cosmetics or skincare product composition with and application thereof | |
US11891615B2 (en) | Process to produce Klotho protein in vitro | |
CN102266320B (en) | New application of hesperetin | |
CN113318005A (en) | Anti-aging and anti-wrinkle composition and application thereof | |
EP4238549A1 (en) | Anti-aging composition, skin care product and cosmetic | |
CA2901525C (en) | Cosmetic use of queuine | |
KR101435679B1 (en) | Composition for moisturizing and improving wrinkle on skin | |
TWI331042B (en) | Anti-aging cosmetics comprising chemokine | |
KR20180131104A (en) | Composition comprising Castanea crenata or herbal extract for improving skin wrinkle and moisturizing | |
CN104224561A (en) | New application of hesperetin | |
PORTES et al. | Cosmetic or dermatological composition and use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |