CN101531986A - Recombinant strain of mink IFN-Gamma gene - Google Patents

Abstract

The invention relates to a recombinant strain of a mink IFN-Gamma gene, which is characterized by being an IFN-Gamma gene sequence which is cloned from peripheral mink bloodlymph cells (PMBC) simulated by phytohemagglutinin (PHA) and being a recombinant plasmid vector containing a nucleotide sequence; i.e., using a plasmid vector pGM-T which is formed by the cutting of a cloning vector by taking an EcoR V enzyme as the cutting point and then adding a 'T' from the '3' end at both sides; and TA cloning is carried out on the nucleotide sequence of a coding Gamma-interferon which is amplified from the peripheral mink bloodlymph cells so as to construct the recombinant plasmid of the nucleotide sequence of the mink Gamma-interferon. In addition, Escherichia coli conversed from the plasmid vector is used as a host. The recombinant strain aims at laying down foundation for researching and developing genetically engineered mink recombinant interferons biological products with anti-viral activity and immunomodulatory activity.

Description

The recombinant bacterial strain of mink IFN-Gamma gene

Technical field:

The present invention relates to a kind of recombinant bacterial strain of mink IFN-Gamma gene.(PBMC) the gamma-interferon gene that increases is connected on the pGM-T carrier from isolating mink peripheral blood lymphocyte, has made up pT-MiIFN-γ recombinant plasmid, and transformed into escherichia coli JM109 obtains to contain the recombinant bacterial strain of mink IFN-Gamma gene.

Background technology:

(Interferon IFN) is a kind of cytokine with broad-spectrum antiviral, antitumor and immunomodulatory isoreactivity to Interferon, rabbit.It is a class secretor type glycoprotein that is produced by vertebrate cell, is to find the earliest, studies maximum cytokines.It has the effect that broad-spectrum antiviral and enhancing immunity are replied.The propagation of the multiple virus of the non-specific inhibition of energy is in middle cardiac status in the immunne response regulation and control.Its antiviral and antitumorigenic characteristic makes it have the potentiality that are used for immunoprophylaxis and treatment.

According to the gene order of IFN, chromosomal localization, receptor-specific is divided into three types, i.e. I type, II type and type iii interferon, I type IFN mainly contains two types of α, β, is mainly produced by lymphocyte and inoblast; II type IFN is a gamma-interferon, is mainly produced by T cell and NK cell.

IFN compares with the I type, II type IFN has panimmunity active, have the interaction that promotes MHC II class antigen presentation, strengthens APC cell and T cell, the many immunoregulatory activities such as generation that strengthen helper cell and cytotoxic T cell, both can be applied to treatment of diseases as biotechnological formulation separately, also can be used as the immune effect that immunological adjuvant strengthens vaccine.

Biologic activity such as antiviral, antitumor and immunomodulatory that gamma-interferon has, human gama-interferon early has application in the control of clinical disease, the animal gamma-interferon also has application promise in clinical practice as biotechnological formulation or vaccine adjuvant, many countries with the development and use of the zooblast factor as research emphasis.Present medically Interferon, rabbit has been widely used in the treatment of virus disease.Discover that IFN can not only be applied to the control of some diseases separately as biotechnological formulation; and can be used as immunological adjuvant; strengthen the immune effect of vaccine, can also with the protective antigen gene coexpression of some pathogeny microorganisms, thereby strengthen and improve the immune effect of vaccine.

Animal interferon mainly rests on fundamental research and clinical experimental stage.The interferon gene of animal such as dog, ox, chicken, duck is also cloned in succession since Vandenbroeck K in 1981 etc. have cloned pig IFN-γ gene first, and obtained certain progress, recombinant interferon products such as existing at present commercial pig, dog, chicken are used on market.But the report that uses of gamma-interferon gene clone of water breakthrough ermine (Mink) and related preparations not both at home and abroad.Mink (Martes, Mustela vison) belongs to Mammalia, Carnivora on zoological taxonomy, Mustelidae, a kind of small-sized precious furbearer that ermine belongs to is under wild state, two kinds of american mink and European minks are arranged, and the mink of the present artificial breeding of China belongs to american mink.In September, 2007 Canadian Ochi, A. has reported the gene order of the ferret IFN-γ that raises and train.Because gamma-interferon has species specificity, the indivedual sites of gene order through relatively finding mink IFN-Gamma of the present invention and ferret IFN-γ have notable difference.

Mink has very important medicinal and economic worth, the three big pillars in its hide and raw fox skin and fur coat market, the Persian lamb hair called after world.The foster ermine of present China is already developed rapider, the important industry that has become China's structural readjustment of rural industry and increased farmers' income.Along with this industry development, the transmissible disease of parvovirus enteritis, canine distemper, the medium virus disease serious harm of Ah staying mink farming industry takes place often, causes serious financial loss, has limited the development of mink farming industry; Because these viral infectious death rate of the onset height, the common drug result of treatment is undesirable, therefore development and exploitation have the genetically engineered mink recombinant interferon kind biological product of antiviral activity and immunoregulatory activity, have crucial meaning in the control of mink virus disease.

Summary of the invention:

The object of the present invention is to provide a kind of recombinant bacterial strain of mink IFN-Gamma gene, overcome the deficiency on the prior art, from isolating mink lymphocyte, amplify mink gamma-interferon gene, and be inserted into cloning vector, transformed into escherichia coli, carry out the mono-clonal Screening and Identification, obtain to contain the recon of mink gamma-interferon gene, lay the foundation for developing and develop genetically engineered mink recombinant interferon kind biological product with antiviral activity and immunoregulatory activity.

Technical scheme of the present invention is achieved in that the recombinant bacterial strain of mink IFN-Gamma gene; ： ( PHA ) ( PMBC ) IFN-γ,：ATGAATTATACAAACTATATCTTAGCTTTTCAGCTTTGCGTGATTTTCTGTTCTTCTGGCTATTACTGTCAGGCCATGTTTTTTAAAGAAATAGAAGACCTAAAGGAATATTTTAATGCAAGTAATCCAGATGTAGCAGATGGTGGGCCTCTTTTCTTAGATATTTTGAAGAACTGGAGAGAGGAGAGTGACAAAACAATCATTCAAAGCCAAATTGTCTCCTTCTACTTGAAACTGTTTGAAAACTTCAAAGATAACCAGATCATTCAAAGGAGCATGGATACCATCAAGGAAGACATGCTTGTCAGGTTCTTCAATAACAGCAGCAGTAAGCGGGAGGACTTCCTTAAGCTGATTCGAATTCCCGTGAATGATCTGCAGGTCCAGCGCAAAGCGATAAATGAACTCATCAAAGTGATGAATGATCTCTCACCAAGATCTAACCTAAGGAAGCGGAAAAGGAGTCACAGTGTGTTTCCCGGCCGCAGAGCATCGAAATAAGGCCGCAGAGCATCGAAATAA； Promptly used plasmid vector pGM-T, be cut at EcoR V enzyme by a kind of cloning vector and locate to cut, 3 ' of both sides end adds " T " and forms again; The nucleotide sequence of the described coding gamma-interferon that increases from the mink lymphocyte carries out the TA clone, makes up the recombinant plasmid of the nucleotide sequence that contains the mink gamma-interferon.And the intestinal bacteria that plasmid vector is transformed, escherichia coli host.

Positively effect of the present invention is to lay the foundation for developing and develop the genetically engineered mink recombinant interferon kind biological product with antiviral activity and immunoregulatory activity.

Description of drawings:

Fig. 1, mink gamma-interferon aminopeptidase gene acid sequence

Fig. 2, RT-PCR product are identified the RT-PCR amplified production; 1, mink IFN-Gamma amplified production, 2, negative control, 3, dna molecular amount standard

Fig. 3, pT-MiIFN-γ plasmid enzyme restriction are identified the evaluation of EcoR I double digestion product agarose gel electrophoresis; 1, enzyme is cut product, and 2,3, dna molecular amount standard

Fig. 4, pT-MiIFN-γ plasmid PCR identify; 1, dna molecular amount standard, 2,3, plasmid PCR product, 4, negative control

Fig. 5, mink gamma-interferon gene sequencing collection of illustrative plates

Fig. 6, mink and ferret (accession number: EF492064), (accession number: the aminoacid sequence of IFN-γ gene AF126247) relatively for dog

Embodiment:

1, materials and methods

(1) restriction enzyme, Taq enzyme, dna molecular amount standard are all available from precious biological (Dalian) company limited.Microbial culture yeast extract, peptone are available from Britain Oxford.Inorganic salt century is homemade analytical pure.

(2) bacterial classification and plasmid, bacillus coli DH 5 alpha is preserved for the applicant.

The preparation of plasmid, competent preparation, the conversion of DNA and the screening of transformant, common methods such as the hydrolysis of restriction enzyme are all referring to (molecular cloning)

2, on zoological taxonomy, belong to relation and the nearer feature of sibship together in view of mink and dog, the Canis animals gamma-interferon gene order of delivering according to GenBank, the sequence accession number is: (NM 001003174), a pair of special primer has been synthesized in design, and primer sequence is

p1：ATGACCAGTAGATGCATC，

p2：TTCAGTTCTGGAGATAAT。

3, asepticly take healthy mink peripheral blood 5mL, place the sterilising vessel that is added with antithrombotics (38g/L Trisodium Citrate), under aseptic condition, add RPMI-1640 nutrient solution 1:1 dilution then; The peripheral blood of getting the 5mL dilution slowly adds on the 5mL human lymphocyte separation medium the centrifugal 40min of 2000r/min horizontal rotor under the room temperature; Sterilization minute hand head with bending carefully moves leukocytic cream in another test tube, add the centrifugal 10min of 2000r/min behind the RPMI-1640 liquid mixing of 2 times of volumes, remove supernatant, throw out adds equivalent RPMI-1640 again, same procedure washing precipitation 2 times, remove supernatant, sedimentation cell suspends with containing the two RPMI-1640 nutrient solutions anti-, the 100mL/L calf serum of 10000U/mL; Get 10 μ L cell suspensions counting, cell suspension is diluted to 1 * 10 by count results ⁷Individual/mL concentration, place 24 porocyte culture plates, 37 ℃, 5%CO ₂Behind the static cultivation 2h, add the PHA inductor and cultivate 24h in the incubator;

4, induce the extraction of back peripheral blood lymphocyte total RNA to collect to induce lymphocyte behind the 24h in the 15ml centrifuge tube with phytohaemagglutinin (PHA), the centrifugal 10min of 2000r/min, abandon supernatant, will precipitate with the resuspended back of 1ml TRIzol Reagent frozen standby in-70 ℃.Lymphocytic frozen pipe is equipped with in taking-up, after room temperature is melted naturally, add the 1/5Trizol volume chloroform, fully leave standstill 3min behind the mixing, the centrifugal 10min of 12000r/min, the careful supernatant of drawing, the Virahol of adding 1/2Trizol volume fully is positioned over-20 ℃ of precipitation 1h behind the mixing, the centrifugal 15min of 12000r/min, the ethanol that precipitates with 75% is slowly washed twice, be inverted the aqua sterilisa dissolution precipitation of the dried back of control, promptly obtain the total RNA of lymphocyte with the DEPC processing of the 1mL/L of 9.5 μ l.

5, the amplification of mink IFN-Gamma gene

Adopt RT-PCR method amplifying target genes, concrete operations are as follows:

(1) in the RNA solution of 9.5 μ l, adds 1 μ l oligo (dT), 15 primers (50pmol/ μ L), the rearmounted 70 ℃ of water-bath effect 5min of mixing, cooling immediately, add 10mmol/L dNTP5 μ L successively, AMV Buffer 4 μ L, RNase Inhibitor 0.5 μ L, the abundant mixing of AMV 1 μ L, 42 ℃ of reaction 1h, 95 ℃ of 3min deactivation ThermoScript II are directly used in next step PCR reaction after the cooling;

(2) PCR reaction system: 10 * ExTaq Buffer, 2.5 μ l, 2.5mmol/ μ l dNTP 2 μ l, each 1 μ l of upstream and downstream primer (25pmol/ μ l), Taq archaeal dna polymerase (2u/ μ l) 0.125 μ l adds the sterilization deionized water to 25ul; Behind 25 μ l reaction solution mixings, on the PCR instrument, increase, loop parameter is: 95 ℃ of pre-sex change 5min; 94 ℃ of 45s, 52.5 ℃ of 1min, 72 ℃ of 1min, after 32 circulations, 72 ℃ are extended 6min; After amplification finishes, get 6 μ l in 1.5% agarose gel electrophoresis observations;

(3) reclaim test kit with glue and reclaim and the identical gene fragment of theoretical value size, make up the TA clone, after PCR and enzyme were cut evaluation, the positive clone of preliminary evaluation served the order-checking of extra large Ying Jun Bioisystech Co., Ltd, and application DNAStar analyzes sequencing result.

6, mink IFN-Gamma gene sequential analysis

As template, obtain MiIFN-γ gene with the total RNA of PHA inducing culture mink peripheral blood lymphocyte through RT-PCR.Get RT-PCR product electrophoresis on 1.5% (m/v) sepharose, the result shows that the pcr amplification product of acquisition is the gene fragment of 501bp, conforms to its intended purposes gene fragment size; Sequencing result shows, clone MiIFN-γ gene size is 501bp, the open reading frame that contains 501bp, be respectively 99.4% and 93.8% with the IFN-γ consecutive nucleotides homology of ferret of delivering on the GenBank (EF492064) and dog (AF126247), amino acid identity is respectively 98.2% and 88%; Preceding 20 amino acid by SignalP 3.0Server and SIG-Pred software prediction coding are signal peptide.

Sequence table

Mink (Mustela putorius furo) IFN-γ base sequence:

Sequence length: 501bp

Chain number: two strands

Sequence kind: DNA

Origin is biological: mink

Sequence signature:

The mark of representation feature: CDS

Location: 1-501

The method of decision feature: and Mustelidae and the contrast of other Canis animals

The mark of representation feature: signal polypeptide

Location: 1-60

The method of decision feature: with ferret and Canidae comparison

The mark of representation feature: oligopeptides

Location: 61-501

Mink (Mustela putorius furo) IFN-γ aminoacid sequence:

Claims (5)

1, the recombinant bacterial strain of mink IFN-Gamma gene is characterized in that: be the mink IFN-Gamma gene sequence of clone from the mink peripheral blood lymphocyte (PMBC) that stimulates through phytohaemagglutinin (PHA),

It contains following nucleotide sequence:

ATGAATTATACAAACTATATCTTAGCTTTTCAGCTTTGCGTGATTTTCTGTTCTTCTGGCT

ATTACTGTCAGGCCATGTTTTTTAAAGAAATAGAAGACCTAAAGGAATATTTTAATGCA

AGTAATCCAGATGTAGCAGATGGTGGGCCTCTTTTCTTAGATATTTTGAAGAACTGGAG

AGAGGAGAGTGACAAAACAATCATTCAAAGCCAAATTGTCTCCTTCTACTTGAAACTG

TTTGAAAACTTCAAAGATAACCAGATCATTCAAAGGAGCATGGATACCATCAAGGAAG

ACATGCTTGTCAGGTTCTTCAATAACAGCAGCAGTAAGCGGGAGGACTTCCTTAAGCT

GATTCGAATTCCCGTGAATGATCTGCAGGTCCAGCGCAAAGCGATAAATGAACTCATCA

AAGTGATGAATGATCTCTCACCAAGATCTAACCTAAGGAAGCGGAAAAGGAGTCACA

GTGTGTTTCCCGGCCGCAGAGCATCGAAATAAGGCCGCAGAGCATCGAAATAA

2, the recombinant bacterial strain of mink IFN-Gamma gene according to claim 1 is characterized in that described sequence is the recombinant plasmid vector that contains nucleotide sequence.

3, the recombinant bacterial strain of mink IFN-Gamma gene according to claim 2, the described recombinant plasmid vector of its feature, being to use plasmid vector pGM-T, is to be cut at EcoR V enzyme by a kind of cloning vector to locate to cut, and 3 ' of both sides end adds " T " and forms again; The nucleotide sequence of the described coding gamma-interferon that increases from the mink lymphocyte carries out the TA clone, makes up the recombinant plasmid of the nucleotide sequence that contains the mink gamma-interferon.

4, the recombinant bacterial strain of mink IFN-Gamma gene according to claim 2 is characterized in that the intestinal bacteria that described plasmid vector transforms.

5, the recombinant bacterial strain of mink IFN-Gamma gene according to claim 4 is characterized in that described intestinal bacteria are escherichia coli host.

Images