CN101531982A - Bacillus thuringiensis YWC2-8 and application thereof - Google Patents
Bacillus thuringiensis YWC2-8 and application thereof Download PDFInfo
- Publication number
- CN101531982A CN101531982A CN200910081599A CN200910081599A CN101531982A CN 101531982 A CN101531982 A CN 101531982A CN 200910081599 A CN200910081599 A CN 200910081599A CN 200910081599 A CN200910081599 A CN 200910081599A CN 101531982 A CN101531982 A CN 101531982A
- Authority
- CN
- China
- Prior art keywords
- ywc2
- bacillus thuringiensis
- bacterial strain
- gene
- insect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention provides a Bacillus thuringiensis new bacterial strain YWC2-8 with the preserving number CGMCC No.2860. Shown by the toxicity test of YWC2-8, the YWC2-8 has enormous toxicity towards Lepidoptera and Diptera insets. The Bacillus thuringiensis YWC2-8 can be prepared into insecticides for the prevention and control of major crop insects, thus facilitating the diversification and systemization of Bacillus thuringiensis insecticide products, enlarging the usage scope of Bacillus thuringiensis insecticides, reducing the use of agricultural chemical, alleviating environment pollution, and having significant economic value and application prospect.
Description
Technical field
The present invention relates to new bacterial strain of a kind of microorganism and application thereof, specifically a kind of bacillus thuringiensis and the application in agricultural insect pest's control thereof.
Background technology
In the human being's production process, insect pest is the important factor that causes agriculture production loss and influence human health, adds up according to FAO, and the financial loss that whole world agriculture production every year causes because of insect pest is up to 14%, and disease is with a toll of 12%, and crop smothering is with a toll of 11%.The amount of loss is equivalent to half of the Chinese agriculture gross output value up to 1,260 hundred million dollars, more than 4 times of Britain.In addition, mosquito matchmaker disease is occupied critical positions in preventive medicine, wherein the sick transmissibility of mosquito such as singapore hemorrhagic fever and yellow jack matchmaker strong, popular wide, sickness rate is high, hazardness is big.According to the WHO statistics, the annual singapore hemorrhagic fever number that infects in the whole world reached 8,000 ten thousand, and Hainan Province of China once broke out twice singapore hemorrhagic fever in 1980 and 1986, and morbidity reaches 437469 example and 113589 examples respectively.Singapore hemorrhagic fever and yellow jack are mainly propagated by Aedes aegypti.
In order to reduce these losses, for many years, generally adopt the chemical prevention means to prevent and treat to crop pests and mosquito, but because the long-term, a large amount of of chemical pesticide use, caused the pollution to environment, pesticide residue increases in the agricultural byproducts, has brought harm for human existence and health.In addition, chemical pesticide has has also killed and wounded natural enemy and other useful thing in kill pests, destroyed the eubiosis.Compare safe, effective, persistent characteristics that biological control has with chemical prevention.And a series of problems of having avoided chemical prevention to bring.Therefore, biological control technology has become the focus of people's researchs.In biotic pesticide, bacillus thuringiensis is the quasi-microorganism sterilant that purposes is the widest in the world, output is maximum at present.
Bacillus thuringiensis (Bacillus thuringiensis, be called for short Bt) be a kind of gram positive bacterium, its distribution is very extensive, when forming, gemma can form the parasporal crystal of forming by protein with insecticidal activity, have another name called insecticidal crystal protein (Insectididal crystal proteins is called for short ICPs), ICPs is by the cry genes encoding, sensitive insect there is strong toxicity, and to higher animal and people's nontoxicity.In recent decades, Bt has been widely used in controlling insects such as multiple lepidopteran, Diptera, Coleoptera.In addition, Bt also has the effect of control evil to various pests such as Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon.At present Bt has become the strong substitute of chemical synthetic pesticide in the control of agricultural pests, injurious forest-insect and sanitary insect pest, and Bt still be that transgenic pest-resistant engineered plant important function of gene is originated.
(Adang M.J et al from Schnepf in 1981 has cloned first gene that can express insecticidal activity from strain HD-1Dipel since, Characterized full-length and truncated plasmidclones of the crystal protein of Bacillus thuringiensis subsp.kurstaki HD-73 andtheir toxicity to Manduca sexta, Gene, 1985,36 (3): 289~300.), people separating clone the gene of more than 390 kind of coded insect-killing crystallin, they are defined as different groups respectively according to the amino acid sequence coded homology, subgroup, class and subclass (Crickmore N, Zeigler D R, Feitelson J, et al.Revision of the nomencl ature for the Bacillus thuringiensispesticidal crystal proteins.Microbiol Mol Biol Rev, 1998,62:807-813; Http:// www.biols.susx.ac.uk/Home/Neil_Crickmore/Bt/).Generally speaking, Cry1, toxalbumin such as Cry2 and Cry9 are effective to lepidoptera pest; Wherein the maximum of research are Cry1 and Cry9 proteinoid, the insecticidal crystal protein molecular weight of their codings is 130-140kD, many genes have been widely used in the control (Kozie of the lepidoptera pest of plant at present, M.G., Beland, G.L., Bowman, C., et al.Field performance of elite transgenic maize plants expressing aninsecticidal protein derived from Bacillus thuringiensis.Bio/Technology, 1993,11:194-200; Perlak, F.J., Deaton, R.W., Armstrong, T.A., et al.Insect resistantcotton plants.bio/technology, 1990; 8:939-943; Van Frankenhuyzen, K., Gringorten, L., and Gauhier, D.1997.Cry9Cal toxin, a Bacillus thuringiensisinsecticidal crystal protein with highactivity against the spruce bud worm (Choristoneura fnniferana) .Appl.Environ, Microbviol.63:4132-4134; Wang Fei, 2001, the research of bacillus thuringiensis specific strain biological characteristics and the new gene of cry9, Master's thesis, Nankai University).Tribactur Israel subclass (B.thuringiensis subsp.israelensis, abbreviation Bti) toxin protein that produces has fine insecticidal activity to mosquito, extensively applied to control (the Goldberg L J of mosquito, and Margalit J, 1977.A bacterial spore demonstrating rapidlarvicidal activityagainst Anophelessergentii, Uranotaenia unguiculata, Culexunivitattus, Aedes aegypti, and Culexpipiens.Mosqito News, 37:355-358; ).Simultaneously, Cyt albumen has cytolytic, some Cry albumen is had synergism and delays the resistance (Wu of insect, D., Johnson, J.J., and Federici, B.A.1994.Synergism ofmosquitocidal toxicity between CytA and CryIVD Proteins using inclusionsproduced from cloned genes of Bacillus thuringiensis.Mol.Microbiol.13:965-972; Wirth, M.C., Georghiou, G.P, and Federeci, B.A.1997.CytA enables CryIV endotoxins of Bacillusthuringiensis to overcome highlevels of CryIV resistance in the mosquito, Culex quinquefasciatus.Proc.Natl.Acad.Sci.94:10536-10540)
Find the history in existing so far more than 100 year of Tribactur from the beginning of this century, aspect the preventing and treating of farm crop and gardening plant insect, injurious forest-insect and sanitary insect pest, be widely used, also play good effect.But owing to use Tribactur on a large scale and repeatedly, many insect populations are producing resistance to insecticidal crystal protein in succession in varying degrees.The history in existing more than 50 year of Utilization of pesticides based on the Bt insecticidal crystal protein, the initial resistance of insect that never detect to Bt, but, begin mid-term 80 year last century, resistance problem (the M cGaughey that constantly in laboratory and field test, is confirmed, W.H.1985.Insect resistance to the biological insecticidcBacillus thuringiensis.Science.229:193-195), reason mainly is continue to use single variety and inferiorly cause the Bt of dosage and the application of Bt transgenic anti-insect plants causes insect population to be subjected to the selective pressure of sterilant for a long time.1985, McGaughey report warehouse grain pest Indian meal moth (Plodiainterpunctella) under the selective pressure of Dipel (the commodity preparation of Bt subsp.kurstaik HD-1), bred for 15 generations after, resistance increases by 97 times; Under the high dosage selective pressure, resistance can increase by 250 times.Nineteen ninety, the small cabbage moth that confirms big Tanaka in Hawaii has first produced tangible resistance (Tabashnik to the Bt sterilant, B.E., Finson, N., Groeters, F.R., et al.1994.Reversal ofresistance to Bacillus thuringiensisin Plutella xylostella.Proc.Natl.Acad.Sci.USA.91:4120-4124), since the nineties in last century, use long Shenzhen of Bt sterilant time in China, Guangzhou, ground such as Shanghai find that the Bt sterilant obviously descends to the small cabbage moth prevention effect, mean that resistance forms that (Feng Xia .1996. Guangdong small cabbage moth is to the resistance research of Bacillus thuringiensis.The insect journal, 39 (3): 238-244; Hofte, H., Van Rie, J., Jansens, S., Van Houtven, A., Vanderbruggen, H., and Vaeck, M., 1988.Monoclonalantibody analysis and insecticidal spectrum of three types oflepidopteran-specific insecticidal crystal proteins of Bacillus thuringiensis.Appl.Environ.Microbiol.54:2010-2017).Find at present in the laboratory and the field has at least tens kinds of insects that Bt and insecticidal crystal protein thereof have been produced resistance, arrive with the selective pressure mathematical model prediction, under the condition of Bt transgenic anti-insect plants selective pressure, insect will produce resistance (Schnepf, E., Crickmore, N., Van Pie, J., et al.1998.Bacillus thuringiensis and its pesticidalCrystal proteins.Microbiol.Mol.Biol.Rev.65 (3): 775-806).In addition, there are some researches prove that Bti does not find resistance problem (Regis L as yet in the use in land for growing field crops, et al., 2000.The use ofbacterial larvicides in mosquito and black fly control programsin Brazil.Mem.Instituto Oswaldo Cruz, 95:207-210.), but mosquito constantly is confirmed in the laboratory to its resistance problem, this situation also may (Georghiou G P occur big Tanaka, and Wirth MC, 1997.Influence of exposure to single versus multiple toxins of Bacillusthuringiensis subsp.israelensis on development of resistance in the mosquitoCulex quinquefasciatus (Diptera:Culicidae) .Applied and EnvironmentalMicrobiology, 63:1095-1101.).
Be the loss of avoiding resistant insects to cause, seeking new supper toxic strain and genetic resources is the effective way that addresses this problem, and this biological control to China also has crucial meaning.
Summary of the invention
The purpose of this invention is to provide the new bacterial strain YWC2-8 of bacillus thuringiensis that the Diptera pest of a kind of Homopteras such as some primary pests, particularly vegetables, cotton, corn, paddy rice and forest to agriculture production and hygienic safety field, Coleoptera, lepidoptera pest and mosquito matchmaker diseases such as propagation singapore hemorrhagic fever and yellow jack has higher virulence.
Bacterial strain of the present invention is to separate the new bacterial strain of the bacillus thuringiensis (Bacillus thuringiensis) that obtains in Sichuan Province's Chengdu Plain soil, this bacterial strain on January 12nd, 2009 at China Committee for Culture Collection of Microorganisms common micro-organisms center (address: No. 3, A, DaTun Road, Chaoyang District, BeiJing City, Institute of Microorganism, Academia Sinica, postcode 100101) preservation, classification called after bacillus thuringiensis (Bacillus thuringiensis), preserving number is CGMCC No.2860.
YWC2-8 is screening acquisition by the following method specifically: adopt sodium-acetate-microbiotic partition method, take by weighing the 10g soil sample and put into the bottle that shakes that 50ml sodium-acetate substratum is housed, add each 400 μ g/ml of penicillin sodium salt and gentamicin sulphate respectively, shaking table is cultivated (200r/min, 30 ℃) 4h.The earth suspension 10ml that fetches earth after cultivate finishing adds the aseptic centrifugal 15min of centrifuge tube 3000r/min, gets the muddy liquid 2ml in upper strata in 65 ℃ of water-bath 15min, and the muddy liquid 0.1ml after the heat-obtaining processing is coated with flat board, flat board is put in 30 ℃ of incubators cultivated.Behind the 48h from the flat board the bacterial strain smear of the similar Bt of picking.Find that a strain contains the Bt bacterial strain of spherulite form, with its called after YWC2-8.
Through identifying, comprise about the information of this bacterial strain: can form the brood cell, can form spherical parasporal crystal (seeing accompanying drawing 1) simultaneously, the SDS-PAGE electrophoresis shows, it is about 130 that bacterial strain YWC2-8 mainly produces, big or small 2 kinds of albumen (seeing accompanying drawing 2) about 70kDa; Its crystallin began at 16 hours to express, and growth curve shows its 16 hours and enters lag phase (seeing accompanying drawing 3), showed that this crystallin promotor may gemma forms in order to rely on; Biology is measured and to be shown, this bacterial strain is to the highest to lepidopteran bollworm insecticidal activity, LC
50Be 3.7 μ g/mL; LC to Homoptera small brown rice planthopper insecticidal activity
50Be 13.6 μ g/mL; LC to Coleoptera Holotrichia parallela insecticidal activity
50Be 25.7cfu/mL; LC to the Diptera yellow-fever mosquito
50Be 15.02 μ g/mL (seeing Table 1).
The insecticidal activity of table 1 YWC2-8
The present invention further identifies the cry gene among the bacterial strain YWC2-8.The result shows, has cry4 and cry56 genoid among the YWC2-8.Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain YWC2-8; Design the full-length gene primer respectively and be template with the total DNA of bacterial strain YWC2-8, the full-length gene of increase respectively cry56 and cry4, the result shows that their total length is about 2kb and 3.5kb (Fig. 4) respectively.Respectively the PCR product behind the purifying is connected with the pGEM-T carrier, transforms, picking has the segmental positive colony of purpose respectively, checks order.With sequencing result at the enterprising line retrieval of GenBank, the result show obtained gene be new gene.The nucleotide sequence of cry56 and cry4 gene is respectively shown in sequence table SEQ ID No.1 and 3.Now with them difference called after cry56Aal, cry4Cb2.
By the virulence test shows to YWC2-8, YWC2-8 all has high virulence to lepidoptera pest, Coleoptera and Diptera pest or the like.Thereby, bacillus thuringiensis YWC 2-8 of the present invention or its fermented liquid can be made sterilant, be used for the control of crop pests.Thereby make the product diversification and the seriation of thuringiensis cladosporioides bacillus insecticide, enlarged the use range of thuringiensis cladosporioides bacillus insecticide.Those skilled in the art can also with farm crop such as its converting cotton, corn, paddy rice, vegetables, make it possess corresponding anti-insect activity according to gene disclosed by the invention.Thereby reduce the usage quantity of agricultural chemicals, reduce environmental pollution, have important economic value and application prospect.
Description of drawings
Fig. 1 is spherical parasporal crystal, gemma and the vegetative cell (5000 *) of YWC2-8 bacterial strain;
Fig. 2 is YWC2-8 bacterial strain SDS-PAGE electrophoretic analysis, and wherein: M is protein Marker;
Fig. 3 is the growth curve of YWC2-8 bacterial strain;
Fig. 4 is that the genotypic PCR of cry identifies that wherein: M is DNA Marker100bp in the YWC2-8 bacterial strain, and 1 is cry4 genoid amplified production, and 2 is cry56 genoid amplified production;
The pcr amplification product of cry56 and cry4 full-length gene among Fig. 5 bacterial strain YWC2-8, wherein: M is a dna molecular amount standard, and 1 is the PCR product of cry4, and 2 is the PCR product of cry56.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.
Screening and the evaluation of embodiment 1 bacillus thuringiensis
Soil picks up from area, Wenjiang, Chengdu, Sichuan Province.Adopt sodium-acetate-microbiotic partition method, take by weighing the 10g soil sample and put into the bottle that shakes that 50ml sodium-acetate substratum is housed, add each 400 μ g/ml of penicillin sodium salt and gentamicin sulphate respectively, shaking table is cultivated (200r/min, 30 ℃) 4h.The earth suspension 10ml that fetches earth after cultivate finishing adds the aseptic centrifugal 15min of centrifuge tube 3000r/min, gets the muddy liquid 2ml in upper strata in 65 ℃ of water-bath 15min, and the muddy liquid 0.1ml after the heat-obtaining processing is coated with flat board, flat board is put in 30 ℃ of incubators cultivated.Behind the 48h from the flat board the bacterial strain smear of the similar Bt of picking.Find that a strain contains the Bt bacterial strain of spherulite form (seeing accompanying drawing 1).Through using opticmicroscope and electron microscope observation, this strain cell is shaft-like, the blunt circle in two ends, the bacterial strain size is 1.2-1.5 μ m * 3.5-4.4 μ m, single usually or two or the existence of short chain cell, and a vegetative cell is a sporocyst, each sporocyst contains a gemma, inferior end is given birth to, and the other end has a parasporal crystal, and sporocyst does not expand.With this Bt bacterial strain called after YWC2-8, and carried out preservation, preserving number is CGMCC No.2860.
The evaluation of cry gene among the embodiment 2 bacterial strain YWC2-8
Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain YWC2-8.It is special right to design according to cry4 and cry56 genoid conserved sequence respectively.
Design a pair of special primer according to the cry4 genoid:
5-GTGTCAAGAGAACCAACAGTATG-3
5-ACTAAGTCTCCTCCTGTATGACCAG-3
Design a pair of universal primer according to the cry56 genoid:
5-AATAAAAATGAATATGAAATATT-3
5-TTTCACAGCCGGAATTTGTGTAAT-3
Identify with following PCR reaction system:
10×buffer 2.5μl
MgCl
2(25mM) 1.5μl
Taq enzyme 0.2 μ l
dNTPs(2.5mM) 2μl
Primer 2 μ l
End reaction volume 25 μ l
Thermal cycle reaction: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 56 ℃ of annealing 1min, 72 ℃ are extended 2min, 30 circulations; 72 ℃ are extended 5min; 4 ℃ of stopped reaction.The amplified reaction product is electrophoresis on 1% sepharose, puts and observes pcr amplification result (seeing accompanying drawing 4) in the gel imaging system.
The clone of cry4 and cry56 gene among the embodiment 3 bacterial strain YWC2-8
Adopt genomic dna purification kit (available from match Parkson company) to extract total DNA of bacterial strain YWC2-8; Design its full-length gene primer P1, P2, P3, P4 (primer sequence is as follows); With the total DNA of bacterial strain YWC2-8 is that template is carried out pcr amplification with described primer respectively, and reaction system and response procedures are with embodiment 2; With the total DNA of bacterial strain YWC2-8 is template, with P1 and P2 amplification cry56 full-length gene, obtains being about the fragment of 2kb; With P3 and P4 amplification cry4 full-length gene, obtain being about the fragment of 3.5kb.Respectively the PCR product behind the purifying is connected with the pGEM-T carrier, transforms, one of picking has the segmental positive colony of purpose respectively, and order-checking obtains sequence SEQ ID NO1 and SEQ ID NO3 respectively.
P1:5’ATGAATTCATATCAAAATAAAAATGA3’
P2:5’CTAGAGATTATTGGTAAACAAATCGT3’
P3:5’ATGTCTAATCGTTATCAACGGTACCC3’
P4:5’TCACTCGTTCATACAAATCAACTCGA3’
1.cry56Aa Gene Sequence Analysis
The total length of sequence SEQ ID NO1 is 1992bp, and analysis revealed, GC content are 37.15%, the albumen that 663 amino acid of encoding are formed.After measured, its aminoacid sequence is shown in SEQ ID No.2.Adopt bacterial sigma7.0promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream, its called after cry56Aal.The present invention has further analyzed the proteic amino acid of Cry56Aal and has formed (seeing Table 2).
The proteic amino acid of table 2 Cry56Aal is formed
Amino acid | Per-cent % | Amino acid | Per-cent % |
Ala(A): | 2.02 | Met(M): | 1.01 |
Cys(C): | 6.73 | Asn(N): | 5.05 |
Asp(D): | 1.68 | Pro(P): | 5.69 |
Glu(E): | 1.85 | Gln(Q): | 1.68 |
Phe(F): | 7.24 | Arg(R): | 11.62 |
Gly(G): | 4.38 | Ser(S): | 13.64 |
His(H): | 1.01 | Thr(T): | 6.23 |
Ile(I): | 8.42 | Val(V): | 2.69 |
Lys(K): | 6.40 | Trp(W): | 2.86 |
Leu(L): | 6.06 | Tyr(Y): | 6.73 |
2.cry4Cb2 Gene Sequence Analysis
The total length of sequence SEQ ID NO3 is 3474bp, and analysis revealed, GC content are 35.90%, the albumen that 1157 amino acid of encoding are formed.After measured, its aminoacid sequence is shown in SEQ ID NO4.Adopt bacterial sigma7.0promoter program that complete sequence is predicted in the softberry website and show, contain the sequence in RNA polymerase activation site in the gene coding region upstream.With its called after cry4Cb2.The present invention has further analyzed the proteic amino acid of Cry4Cb2 and has formed (seeing Table 3).
The proteic amino acid of table 3 Cry4Cb2 is formed
Amino acid | Per-cent % | Amino acid | Per-cent % |
Ala(A): | 5.96 | Met(M): | 2.07 |
Cys(C): | 1.12 | Asn(N): | 7.78 |
Asp(D): | 5.53 | Pro(P): | 3.98 |
Glu(E): | 5.01 | Gln(Q): | 4.67 |
Phe(F): | 3.28 | Arg(R): | 3.37 |
Gly(G): | 5.96 | Ser(S): | 6.91 |
His(H): | 2.68 | Thr(T): | 7.95 |
Ile(I): | 6.40 | Val(V): | 5.70 |
Lys(K): | 5.70 | Trp(W): | 1.30 |
Leu(L): | 8.82 | Tyr(Y): | 5.79 |
The activity of embodiment 4 bacterial strain YWC2-8 detects
To lepidoptera pest: with bacterial strain YWC2-8 in liquid LB substratum 30 ℃, 200r/min shaking culture 30h; Centrifugal collection thalline (12,000r/min, 15min, 4 ℃), Bechtop is air-dry, metering thalline weight; Then bacterial strain is suspended in the distilled water, is mixed with from 1 μ g/ml to 100ng/ml6 different concns; The old tender moderate Caulis et Folium Brassicae capitatae blade of choosing is cleaned, and dries; Ultraviolet lamp is irradiation 15min down, is cut into 2 * 2cm
2Size divides to be placed in the different concns bacterium liquid, soaks 5min; Take out drop and go excess liquid, be placed in the disinfectant culture dish and dry, soak blade in contrast with LB, each culture dish is put 4 blades; 30 of healthy 2-3 bollworms in age are put in choosing; Every processing repeats 3 times, put indoor, in 3d " Invest, Then Investigate " larva death condition, with SPSS10.0 computed in software LC
50Result such as table 1 show that bacterial strain has cytotoxicity to this class pest.
To Diptera pest: with bacterial strain YWC2-8 in liquid LB substratum 30 ℃, 200r/min shaking culture 30h; Centrifugal collection thalline (12,000r/min, 15min, 4 ℃), Bechtop is air-dry, metering thalline weight; Then bacterial strain is suspended in the distilled water, is mixed with from 1 μ g/ml to 100ng/ml6 different concns; Choosing put healthy 4 age 30 of ant mosquitos contain in the different cell concentration suspension in 1L; Every processing repeats 3 times, puts in 28 ℃ of incubators, in 24h " Invest, Then Investigate " larva death condition, with SPSS10.0 computed in software LC
50Result such as table 1 show that bacterial strain is to ant mosquito tool cytotoxicity.
To coleopteran pest: the Bt bacterial strain scrapes and is suspended in the sterilized water after cultivating 3 days on the LB substratum, adopts the method for lactose suspension acetone precipitation, and it is standby to be prepared into pulvis.Above-mentioned pulvis is diluted according to 2 times of differential gradient concentrations of geometric ratio.With diluent, join mixing in the sterilization fine earth of even thickness potato silk, with the 20d Holotrichia parallela as for examination worm master, each processing connects 30 of worms, triplicate, with the processing that adds clear water as blank, infect to raise and checked dead borer population in 7 days, 14 days, with SPSS10.0 computed in software LC
50Result such as table 1 show that bacterial strain is to Holotrichia parallela tool cytotoxicity.
To homoptera pest: the Bt bacterial strain scrapes and is suspended in the sterilized water after cultivating 3 days on the LB substratum, adopts the method for lactose suspension acetone precipitation, and it is standby to be prepared into pulvis.Above-mentioned pulvis is diluted with 10% white sugar water according to 2 times of differential gradient concentrations of geometric ratio.Make the solid figure post that diameter is 3mm with the yellow thieving paper of sterilizing, after in Bt suspension, soaking 30sec, be put in the culture dish that diameter is 25cm, try the worm master with 3d small brown rice planthopper in age as confession, each processing connects 30 of worms, and triplicate is right as blank with the processing that adds clear water, check dead borer population according to 72h, with SPSS 10.0 computed in software LC
50Result such as table 1 show that bacterial strain is to small brown rice planthopper tool cytotoxicity.
The sequence table explanation:
SEQ ID No.1﹠amp; 2, SEQ ID No.3﹠amp; 4 is respectively nucleotide sequence and the amino acid sequence coded thereof of cry56Aal gene and cry4Cb2; SEQ ID No.5﹠amp; 6, SEQ ID No.7﹠amp; The 8th, the Auele Specific Primer of be used to increase cry4 class and cry56 gene conserved sequence; SEQ ID No.7﹠amp; 8, SEQ ID No.9﹠amp; 10 Auele Specific Primers that are used to increase cry56Aal and cry4Cb2 gene.
Sequence table
<110〉Sichuan Agricultural University
<120〉Tribactur YWC2-8 and application thereof
<130>KHP09112224.0
<160>12
<170>PatentIn version3.5
<210>1
<211>1992
<212>DNA
<213>Bacillus thuringiensis YWC2-8
<220>
<221>CDS
<222>(1)..(1992)
<400>1
<210>2
<211>663
<212>PRT
<213>Baci llus thuringiensis YWC2-8
<400>2
<210>3
<211>3411
<212>DNA
<213>Bacillus thuringiensis YWC2-8
<220>
<221>CDS
<222>(1)..(3411)
<400>3
<210>4
<211>1136
<212>PRT
<213>Bacillus thuringicnsis YWC2-8
<400>4
<210>5
<211>23
<212>DNA
<213〉artificial sequence
<400>5
<210>6
<211>25
<212>DNA
<213〉artificial sequence
<400>6
<210>7
<211>23
<212>DNA
<213〉artificial sequence
<400>7
<210>8
<211>24
<212>DNA
<213〉artificial sequence
<400>8
<210>9
<211>26
<212>DNA
<213〉artificial sequence
<400>9
<210>10
<211>26
<212>DNA
<213〉artificial sequence
<400>10
<210>11
<211>26
<212>DNA
<213〉artificial sequence
<400>11
<210>12
<211>26
<212>DNA
<213〉artificial sequence
<400>12
Claims (4)
1, bacillus thuringiensis (Bacillus thuringiensis) YWC2-8, preserving number is CGMCC No.2860.
2, the sterilant that contains the described bacterial strain of claim 1 or its tunning.
3, described bacterial strain of claim 1 or the described sterilant of claim 2 application in the crop pests control.
4, application as claimed in claim 3 is characterized in that, described insect pest is Homoptera, Coleoptera, lepidopteran or Diptera pest.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100815995A CN101531982B (en) | 2009-04-13 | 2009-04-13 | Bacillus thuringiensis YWC2-8 and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100815995A CN101531982B (en) | 2009-04-13 | 2009-04-13 | Bacillus thuringiensis YWC2-8 and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101531982A true CN101531982A (en) | 2009-09-16 |
CN101531982B CN101531982B (en) | 2010-08-04 |
Family
ID=41102848
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100815995A Expired - Fee Related CN101531982B (en) | 2009-04-13 | 2009-04-13 | Bacillus thuringiensis YWC2-8 and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101531982B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010118631A1 (en) * | 2009-04-13 | 2010-10-21 | 四川农业大学 | Insecticidal crystal protein gene cry56aa1, its encoded protein and uses |
CN108070534A (en) * | 2016-11-14 | 2018-05-25 | 华中农业大学 | The bacillus thuringiensis of prevention phyllotreta striolata and preparation and application |
-
2009
- 2009-04-13 CN CN2009100815995A patent/CN101531982B/en not_active Expired - Fee Related
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2010118631A1 (en) * | 2009-04-13 | 2010-10-21 | 四川农业大学 | Insecticidal crystal protein gene cry56aa1, its encoded protein and uses |
CN108070534A (en) * | 2016-11-14 | 2018-05-25 | 华中农业大学 | The bacillus thuringiensis of prevention phyllotreta striolata and preparation and application |
Also Published As
Publication number | Publication date |
---|---|
CN101531982B (en) | 2010-08-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101531980B (en) | Bacillus thuringiensis HS18-1 and application thereof | |
CN101503666B (en) | Novel strain of Bacillus thuringiensis bacterial strain and use thereof | |
CN105367633B (en) | A kind of BT PROTEIN C RY2Ab32, its encoding gene and application | |
CN105368733B (en) | One bacillus thuringiensis strain new strains and its application | |
CN101497658B (en) | Novel Bt protein Cry4Cc1, coding gene thereof and use | |
CN101497657B (en) | Novel disinsection Bt protein Cry54Aa1, coding gene thereof and use | |
CN101503463B (en) | Novel Bt protein Cry53Ab1, coding gene thereof and use | |
CN101531981B (en) | Bacillus thuringiensis BM59-2 and application thereof | |
CN101531982B (en) | Bacillus thuringiensis YWC2-8 and application thereof | |
CN101503464A (en) | Novel Bt protein Cry30Fa1, coding gene thereof and use | |
CN102781955B (en) | Bt protein Cry4Cb2, encoding gene of same and use thereof | |
CN105367636B (en) | A kind of Bt PROTEIN C ry1Dd1, its encoding gene and application | |
CN101531711B (en) | Bt protein Cry52Bal as well as encoding gene thereof and application thereof | |
CN101591381A (en) | Bt PROTEIN C ry4Cb1, its encoding gene and application | |
CN102363631B (en) | Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof | |
CN101531713B (en) | Bt protein Cry56Aal as well as encoding gene thereof and application thereof | |
CN101531712B (en) | Bt protein Cry30Bal as well as encoding gene thereof and application thereof | |
CN105367635B (en) | A kind of Bt PROTEIN C ry1Hc1, its encoding gene and application | |
CN102363760B (en) | Bacillus thuringiensis ST8, insecticidal genes thereof and applications thereof | |
CN102603876B (en) | Bt protein Cry59Bal, coding gene and application of Bt protein Cry59Bal | |
CN102363630B (en) | Pesticide Bt protein Cry8Pa1 and coding gene and use thereof | |
CN102408474B (en) | Bt protein Cry69Aa1, and coding gene and application thereof | |
CN102584959B (en) | Bt (Bacillus thuringiensis) protein Cry70Ba1 as well as encoding gene and application thereof | |
CN102417538B (en) | Bt protein Cry68Aa1 and encoding gene and application thereof | |
CN102532285B (en) | Bt protein Cry2Ac-like and coding gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100804 Termination date: 20200413 |