CN101456912B - Anti P selectin single-chain antibody and use thereof - Google Patents
Anti P selectin single-chain antibody and use thereof Download PDFInfo
- Publication number
- CN101456912B CN101456912B CN 200810224769 CN200810224769A CN101456912B CN 101456912 B CN101456912 B CN 101456912B CN 200810224769 CN200810224769 CN 200810224769 CN 200810224769 A CN200810224769 A CN 200810224769A CN 101456912 B CN101456912 B CN 101456912B
- Authority
- CN
- China
- Prior art keywords
- chain antibody
- sequence
- seq
- dna
- selectin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a P lectin resistant single chain antibody and application thereof. The invention aims to provide a P lectin resistant genetic engineering single chain antibody and application of the antibody to the preparation of medicines for treating the human body inflammatory reaction. The P lectin resistant single chain antibody can be one of the following amino acid residue sequences: 1) the SEQ ID NO:1 in a sequence list; 2) the protein which is obtained through the substitution, deletion or addition of 1 to 10 amino acid residues to the amino acid residue sequence and has the special targeting property for P lectin, a better anti-adhesion/anti-inflammation targeted depression effect, and a good treating effect on the human body inflammatory reaction. The protein has the special targeting property for P lectin, the better anti-adhesion/anti-inflammation targeted depression effect, and the good treating effect on the human body inflammatory reaction. The P lectin resistant single chain antibody can be used for preparing medicines for treating the human body inflammatory reaction.
Description
Technical field
The invention belongs to the gene prod field, particularly relate to a kind of anti P selectin phage single chain antibody and application in the medicine of preparation treatment body inflammatory reaction thereof with specific target tropism.
Background technology
Inflammatory reaction be various diseases as tumour, cardiovascular and cerebrovascular diseases, diabetes, autoimmune disorder and wound after common important pathologic process.Although various inflammation have its singularity, from local pathological change, it seems, they have a lot of common ground, a kind of radical response that to be all body produce the damaging action of pro-inflammatory cytokine.Nearest research finds, when the degree of inflammation is serious or develop into chronic inflammatory diseases, it may cause the generation of various diseases.
Inflammatory reaction starts from that inflammatory cell sticks, migration, infiltration, activation and inflammatory factor discharge, and the adhesion of white corpuscle and endotheliocyte is the initial step of inflammation, and this process is that the cell adhesion molecule by inflammatory cell and Surface of Vascular Endothelial Cells is mediated.Adhesion molecule is a kind of composite membrane albumen synthetic by cell, is present in cytolemma or extracellular, in inflammatory process, to white corpuscle and endotheliocyte interphase interaction, plays a part crucial.The adhesion process of adhesion molecule mediation, be at first the white corpuscle of selecting in the plain blood flow that slows down, and makes it be rolled to the blood vessel endothelium surface, and then integrin and immunoglobulin superfamily promote leukocyte adhesion to vessel wall, and make it enter endothelium.
The first stage of selecting the main mediated leucocytes vessel wall of plain family to adhere to.Be that the reversibility adhesion phase slows down the white corpuscle mobility, form and roll, for further adhering to and create conditions.P selects element (P-selectinectin, Ps) to claim again (GMP-140), is the I type membrane glycoprotein that a kind of molecular weight is 140kD, mainly is distributed in the Weibel palade corpusculum of the hematoblastic α particle of tranquillization and endotheliocyte.After stimulated by inflammatory mediator, P selection element inserts to fast cell surface and is expressed, and the antigen on neutrophil leucocyte, monocyte is combined, and mediated leucocytes sticks, rolls, assembles and activate and discharges the inflammation mediator on endothelium, participates in inflammatory reaction.
P selects element as the sign of thrombocyte/activated endothelial cell and sticks acceptor, and mediated leucocytes and activation endotheliocyte etc. sticks at first, is the important component that starts inflammatory reaction and maintain inflammatory conditions.P selects element not express or low the expression under normal circumstances, after the factors such as inflammation, damage that are subject to stimulate, can significantly express, and expressing also appears in original organizing of not expressing.P selects element to participate in the multiple pathophysiological processes such as disease (as sacroiliitis, Alzheimer's disease, osteoporosis etc.) of tumour, cardiovascular disorder, diabetes, autoimmune disorder and age-dependent, its excessively or continuous expression become the sign of some lesion tissue.Therefore, inhibition P selects element expression and cell adhesion thereof to act as above disease diagnosis and treatment provide new strategy.Therefore, further develop the genetic engineering antibody of anti P selectin, there is important value undoubtedly in the diagnosis with inflammation related disease and treatment.
Found that at present some have inhibition P and select the active material of element both at home and abroad, as selected the antibody of plain monoclonal antibody and PSGL-1 in fucoidin, P.Experiment shows that these materials have good effect aspect the inflammation-inhibiting reaction, but also has a lot of problems, and as in application, brought very large side effect, specificity is poor etc.
Summary of the invention
The invention provides the object of the present invention is to provide and a kind ofly can select plain site in P by special target, suppress P and select element to express and the cell adhesion effect, thereby reach the anti P selectin single-chain antibody of the effect of anti-inflammatory treatment.
Anti P selectin single-chain antibody provided by the present invention is one of following amino acid residue sequences:
1) the SEQ ID NO:1 in sequence table;
2) through replacement, disappearance or the interpolation of one to ten amino-acid residue and to P, select element to there is special targeting the amino acid residue sequence of SEQ ID NO:1 in sequence table, there is anti-stick/anti-inflammatory target retarding effect better, the inflammatory reaction of body is there is to the protein of good therapeutic action.
SEQ ID NO:1 in sequence table is comprised of 240 amino-acid residues.
The encode gene of above-mentioned anti P selectin single-chain antibody is one of following nucleotide sequence:
1) DNA sequence dna of SEQ ID NO:2 in sequence table;
2) DNA sequence dna of SEQ ID NO:1 in the code sequence list;
3) with sequence table in the nucleotide sequence that limits of SEQ ID NO:2 there is 90% above homology and P selected to the plain special targeting that has, there is anti-stick/anti-inflammatory target retarding effect better, the inflammatory reaction of body is there is to the nucleotide sequence of good therapeutic action;
4) under the rigorous condition of height can with sequence table in the nucleotide sequence of the DNA sequence dna hybridization that limits of SEQ ID NO:2.
The rigorous condition of described height is washed film with the solution containing 0.1 * SSPE (or 0.1 * SSC), 0.1%SDS for hybridization is rear under 65 ℃.
SEQ ID NO:2 in sequence table is by 720 based compositions, and its encoding sequence is for holding the 1-720 bit base from 5 ', and coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in sequence table.
Specifically, the variable region of heavy chain PV of described anti P selectin single-chain antibody
hthere is the amino acid residue sequence of the SEQ ID NO:3 in sequence table or through replacement, disappearance or the interpolation of one to ten amino-acid residue and to P, select element to there is special targeting the amino acid residue sequence of SEQ ID NO:3 in sequence table, there is anti-stick/anti-inflammatory target retarding effect better, the inflammatory reaction of body is there is to the polypeptide of good therapeutic action; Variable region of light chain PV
lthere is the amino acid residue sequence of the SEQ ID NO:4 in sequence table or through replacement, disappearance or the interpolation of one to ten amino-acid residue and to P, select element to there is special targeting the amino acid residue sequence of SEQ ID NO:4 in sequence table, there is anti-stick/anti-inflammatory target retarding effect better, the inflammatory reaction of body is there is to the polypeptide of good therapeutic action.
SEQ ID NO:3 in sequence table is comprised of 122 amino-acid residues, and the SEQ ID NO:4 in sequence table is comprised of 108 amino-acid residues.
The gene of coding anti P selectin single-chain antibody, its variable region of heavy chain encoding gene has the DNA sequence dna of SEQ ID NO:3 in the DNA sequence dna of SEQ ID NO:5 in sequence table or code sequence list or the nucleotide sequence of the DNA sequence dna hybridization that can limit with SEQ ID NO:5 in sequence table under the rigorous condition of height; The variable region of light chain encoding gene has the DNA sequence dna of SEQ ID NO:4 in the DNA sequence dna of SEQ ID NO:6 in sequence table or code sequence list or the nucleotide sequence of the DNA sequence dna hybridization that can limit with SEQ ID NO:6 in sequence table under the rigorous condition of height.
The rigorous condition of described height is in the solution of 0.1 * SSPE (or 0.1 * SSC), 0.1%SDS, hybridizes under 65 ℃ of conditions and washes film.
SEQ ID NO:5 in sequence table is by 366 based compositions, and its encoding sequence is for holding the 1st to 366 bit bases from 5 ', and coding has the protein of the amino acid residue sequence of SEQ ID NO:3 in sequence table.SEQ ID NO:6 in sequence table is by 324 based compositions, and its encoding sequence is for holding the 1st to 324 bit bases from 5 ', and coding has the protein of the amino acid residue sequence of SEQ ID NO:4 in sequence table.
The expression vector that contains anti P selectin single-chain antibody encoding gene of the present invention, transgenic cell line and Host Strains all belong to protection scope of the present invention.
In amplification anti P selectin single-chain antibody encoding gene, the primer pair of arbitrary fragment is also within protection scope of the present invention.
The present invention also provides for expressing the recombinant expression vector of above-mentioned anti P selectin single-chain antibody.
Provided by the present invention for expressing the recombinant expression vector of above-mentioned anti P selectin single-chain antibody, be the recombinant expression vector that contains the anti P selectin single-chain antibody gene.
Described anti P selectin single-chain antibody gene can be inserted in recombinant expression vector.Build the carrier that sets out of described recombinant expression vector, can be any one and refer to bacterial plasmid, phage, yeast plasmid, vegetable cell virus, the mammalian cell viral (as adenovirus, retrovirus or other carrier) that carries out exogenous gene expression well known in the art.In a word, as long as can copy in host and stably express, any plasmid and carrier can be used.A key character of expression vector is usually to contain copy-point, promotor, marker gene and translation controlling elements.
Described prokaryotic expression carrier can be pET-32a, pET-28a, pET-28b, pET-28c, pET-21a (+) or pET-30a etc.; Described carrier for expression of eukaryon can be pEE14.1, pCMV5, pSilence1.0-U6 (Ambion, Austin, TX, USA), pcDNA, pEGFP-N1, pSV40, pCI-neo (being purchased from Promega company), pTEF1, pPICZ α, pAM82 or pAAh5 etc.
Wherein, with pEE14.1, for the carrier that sets out, the recombinant expression vector that contains described anti P selectin single-chain antibody gene of structure is pEE14.1/V
h-Linker-V
l.
Can adopt method well known to those skilled in the art to build the recombinant expression vector that contains described anti P selectin single-chain antibody gene, as the extracorporeal recombinant DNA technology, (the Sambrook such as the interior recombinant technology of DNA synthetic technology and body, et alMolecular cloing, a Laboratory Manual.Cold spring harbor laboratory.NewYork, 1989).The DNA sequence dna of described anti P selectin single-chain antibody gene can be effectively connected on the suitable promotor in expression vector, synthetic to instruct mRNA's.Described promotor can be: but the promotor that colibacillary lac or trp promotor, phage promoter, retrovirus and some other known controlling gene are expressed in protokaryon or eukaryotic cell or its virus.Described expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, described expression vector also can comprise one or more selected markers, with the phenotype shape of the host cell that is provided for select transforming, as eukaryotic cell is cultivated dihydrofolate reductase gene, neomycin resistance gene and green fluorescent protein (GFP) gene of use or for colibacillary tsiklomitsin or ampicillin resistance gene etc.
Another object of the present invention is to provide a kind of method of expressing above-mentioned anti P selectin single-chain antibody.
The expression method of anti P selectin single-chain antibody provided by the present invention, to transform or the transduction host cell for the recombinant expression vector of expressing anti P selectin single-chain antibody described, cultivate host cell, from substratum or cell, separation and purification albumen, obtain anti P selectin single-chain antibody.
Described host cell can be prokaryotic cell prokaryocyte, as bacterial cell; The low eukaryotic cell that waits, as yeast cell; Higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomycete; The bacterial cell of Salmonella typhimurium; Eukaryotic cell is as yeast, vegetable cell; The insect cells such as fruit bat S2 or Sf9; The zooblasts such as CHO, COS, 293 cells or Bowes melanoma cell.Described host cell is preferably Chinese hamster ovary celI.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, if insert enhancer sequence in carrier, will make to transcribe to be enhanced.Enhanser is the cis acting factor of DNA, and length is generally 10-300 base pair, acts on promotor transcribing with enhancing gene.As the length in replication origin side in late period one be about the SV40 enhanser of 100-270 base pair, at the polyoma enhanser of replication origin side in late period one or adenovirus enhanser etc.
Available routine techniques well known to those skilled in the art, by the recombinant DNA transformed host cell, cultivate transformant, the abduction delivering target protein, and recombinant protein is advanced to separation and purification.
The substratum of the host cell that cultivation contains anti P selectin single-chain antibody encoding gene of the present invention and culture condition, all can be substratum and the culture condition of cultivating the host that sets out.
The present invention also provides a kind of medicine for the treatment of the body inflammatory reaction.
The medicine for the treatment of body provided by the present invention inflammatory reaction, its activeconstituents is above-mentioned anti P selectin single-chain antibody.
When needing, can also add one or more pharmaceutically acceptable carriers in said medicine.Described carrier comprises thinner, vehicle, weighting agent, absorption enhancer or the absorption carrier etc. of pharmaceutical field routine.
Medicine of the present invention can be made the various ways such as injection liquid, tablet, pulvis, granula, capsule, oral liquid.The medicine of above-mentioned various formulations all can be according to the ordinary method preparation of pharmaceutical field.
The consumption of said medicine is generally 200 μ g anti P selectin single-chain antibodies/kg body weight, every 1 day, is administered once, and be 14 days the course for the treatment of.Dosage and the course for the treatment of all can be adjusted according to practical situation.
The invention provides and a kind ofly can select with people P the single-chain antibody of the anti P selectin of plain specific combination, this single-chain antibody is to adopt phage antibody library technique, from a complete set of single-chain antibody gene Phage Antibody Library of the anti P selectin built out, built the carrier for expression of eukaryon of this single-chain antibody simultaneously, and filtered out the Chinese hamster ovary celI strain of high efficient expression anti P selectin single-chain antibody, by expression and purification, obtained the higher single chain antibody protein of purity.This albumen selects element to have special targeting to P, has anti-stick/anti-inflammatory target retarding effect better, and the inflammatory reaction of body is had to good therapeutic action, can be used for the medicine of preparation treatment body inflammatory reaction.
Below in conjunction with specific embodiment, the present invention is described in further details.
The accompanying drawing explanation
The 1.2% agarose electrophoresis detected result that Fig. 1 is light chain and heavy chain variable region gene amplified production
The 1.2% agarose electrophoresis detected result that Fig. 2 is the anti P selectin single-chain antibody gene amplification product
The 12%SDS-PAGE detected result that Fig. 3 is anti P selectin single-chain antibody
The Western Blot qualification result that Fig. 4 is anti P selectin single-chain antibody
Fig. 5 is the biodistribution experimental result
Fig. 6 is results of animal
Embodiment
In following embodiment, method therefor is ordinary method if no special instructions.
The acquisition of embodiment 1, anti P selectin single-chain antibody
With following method screening anti P selectin single-chain antibody, concrete grammar comprises the following steps:
1, cell cultures and evaluation: will secrete the hybridoma that P selects plain antibody (with reference to hybridoma and monoclonal antibody experimental technique, Xu Tinggui, the method in 1982. builds) and be incubated at containing in the complete RPMI1640 substratum of 15% bovine serum.Incubator is containing 5%CO
2mixed gas, humidity is 98%.Identify specificity and the titre of monoclonal antibody in culture supernatant by the ELISA method, antibody titers reaches 1: 3200 as a result, and obvious species specificity is arranged.。
2, the isolation and purification of mRNA: with preparation, purified mRNA test kit (Promega) reference reagent box specification sheets fast from about 2 * 10
7extract total RNA in individual hybridoma, and purified mRNA, concrete grammar is: collect approximately 2 * 10
7individual hybridoma, add 175 μ l lysate lysing cell, 25 ℃ 13, the centrifugal 10min of 000g, collect supernatant, add 200 μ l 95% ethanol, transfer in adsorption column, 13, the centrifugal 1min of 000g, absorption RNA, add 600 μ l RNA rinsing liquids, 13, the centrifugal 1min of 000g, add 50 μ l DNaseI, hatches the 15min DNA digestion for 25 ℃, add again 200 μ l Dnase stop buffers, the centrifugal 1min of 13,000g, 600 μ l RNA rinsing liquid rinsings are once, 250 μ lRNA rinsing liquid rinsings once, 100 μ l Nuclease-Free H
2the total RNA. of O wash-out gets the total RNA of 1.0mg, add RNase-Free Water to 150 μ l, hatch 10min for 65 ℃, add 3 μ l Biotinylated-Oligo (dT) Probe and 13 μ l 20 * SSC, be cooled to room temperature, then RNA is joined in SA-PMPs, incubated at room 10min, use magnet adsorption SA-PMPs, abandons supernatant, with 300 μ l 0.1 * SSC rinsing 4 times, finally with 100 μ l RNase-Free Water wash-outs, collect mRNA.
3, cDNA preparation: the mRNA of purifying of take is template, cDNA is synthesized in reverse transcription, concrete grammar is: 2 μ g mRNA, Random Primers 0.5mg/mL 2 μ l, the water final volume that adds nuclease free is 15 μ l, 70 ℃ are heated 8 minutes, at cooled on ice 5min, of short duration centrifugal to the pipe bottom, add 5 * Buffer, 5 μ l
ribonucleaseInhibitor 40u, 37 ℃ of 5min, add again Sodium Pyrophosphate, 40mM 2.5 μ l, AMV ReverseTranscriptase 30u, add the water of nuclease free to cumulative volume 25 μ l, gentleness mixes, 37 ℃ of 60min, after finishing, reaction takes out 20 μ l as template, add Second Strand 2.5 * Buffer 40 μ l, Acetylated BSA, 1mg/mL 5 μ l, DNA Polymerase I 23u, RNase H 0.8u, the water final volume of nuclease free is 100 μ l, hatch 2 hours for 14 ℃, add 10 μ l 200mM EDTA termination reactions, obtain cDNA.
4, the amplification of antibody variable gene: use PCR method, the synthetic cDNA of the reverse transcription of take is template, adds respectively the variable region of light chain (V of a set of anti P selectin single-chain antibody in the PCR reaction system
l) primer (primer sequence is GACATCCAGATGACCCAGTCT and CCGTTTTATTTCCAACTTTGT) or variable region of heavy chain (V
h) (Pharmac i a) for primer (primer sequence is GTGCAGCTGCAGGAGTCT and TCCTGAGGAGACGGTGACCGT), 10 * PCR damping fluid, 5 μ l, the dNTP final concentration is 2.5mM, mixes by 100 ℃ of sex change 5min, adds 2 Taq of unit archaeal dna polymerases.Total reaction volume is 50 μ l.Add mineral oil after mixing.Carry out 30 circulating reactions, each cycling condition is: 94 ℃ of sex change 30s.55 ℃ of annealing 90s, 72 ℃ are extended 90s, and reaction is incubated 10min at 72 ℃ after proceeding to last circulation.After reaction finishes, take out respectively 3 μ l and carry out 1.2% agarose electrophoresis detection from light chain and heavy chain variable region gene amplified production, detected result as shown in Figure 1, the chain variable region gene of 324bp and the heavy chain variable region gene of 366bp have been obtained through pcr amplification, with expected results, conform to, remaining uses Sephagels
tMbandprep Kit (Pharmacia) reclaims purifying.
5, the connection of single-chain antibody gene: by the light chain that reclaims and heavy chain variable region gene, with being connected primer, (primer sequence is ACCGTCTCCTCAGGAGGCGGTGGCGGCTCGGGTGGCGGCGGCTCT and GGTCATCTGGATGTCAGAGCCGCCGCCACCCGAGCCGCCTCCGCC, and (Gly encodes
4ser)
2dNA sequence dna) under the condition that waits volumetric molar concentration, add the dNTP of 2.5mM and the Taq archaeal dna polymerase of 3 units, 10 * PCR damping fluid, 5 μ l, reaction volume is 50 μ l.With after the Witco 70 sealing, carrying out 7 anneal cycles, the reaction conditions of each circulation is 94 ℃ of sex change 30s, 64 ℃ of annealing 4min.
6, the amplification of single-chain antibody gene: take single-chain antibody gene as template, in above-mentioned reaction system, add a pair of 5 ' end to contain Sfi 1, the primer (primer sequence is TCAGGCCATTATGGCCATGGTGCAGCTGCAGGAG and TCAGCGGCCGCTAACCGTTTTATTTCAAC) that 3 ' end contains Not 1 restriction enzyme site, carry out 30 PCR circulations, each cycling condition is 94 ℃ of sex change 1min, 55 ℃ of annealing 2min, 72 ℃ are extended 2min, and reaction is incubated 10min at 72 ℃ after proceeding to last circulation.The agarose electrophoresis of after reaction finishes, taking out 3 μ L 1.2% from pcr amplification product detects, detected result as shown in Figure 2, obtained the single-chain antibody gene of 720bp through pcr amplification, conformed to expected results, remaining reclaims purifying with SephagelsTM Bandprep Kit.
7, the construction and expression in single-chain antibody library: by expression vector pCANTAB5E (Pharmacia) and the single-chain antibody gene after reclaiming respectively through Sfi 1 and Not 1 double digestion, under the effect of T4 ligase enzyme, pCANTAB5E expression vector and 16 ℃ of connections of single-chain antibody gene are spent the night.By recombinant plasmid transformed e. coli tg1 competent cell, and the cell transformed is coated on containing on 100 μ g/mL penbritin LB culture plates, in 37 ℃ of overnight incubation.The transformed bacteria be grown on flat board is all collected, with 2 * YTAG (containing 100 μ g/mL penbritins and 2% glucose) diluting cells suspension to OD
600=0.2,37 ℃ of cultivations are cultured to logarithmic phase (about OD
600=0.4), add 2 * 10
9the pfuM13K07 helper phage, cultivate 1 hour for 37 ℃, centrifugal.With the resuspended sedimentation cell of 10mL 2 * YTAK (containing 2 * YT of 100 μ g/mL penbritins and 50 μ g/mL kantlex), 37 ℃ of shaking culture are spent the night, and the supernatant that centrifugal rear collection contains recombinant phage is single-chain antibody phage expression library.
8, the screening of recombinant phages antibody: select plain antigen (purchased from Shanghai history Rake bio tech ltd) to be coated with the polyethylene culture dish with P, will contain in the supernatant of recombinant phage and this culture dish 37 ℃ and hatch 2 hours.With PBS wash dish 20 times, then use PBST (containing the PBS of 0.05%Tween 20) wash dish 20 times, abandon PBST.Add 10mL in logarithmic phase TG1 cell, cultivate 1 hour for 37 ℃.Centrifugal, collect supernatant, carry out the next round screening.The screening process of repetition " absorption-wash-out-breeding " 2 times.With the superingection of M13K07 helper phage, just can generate enrichment clone's filamenlous phage surface display libraries.
9, the screening of mono-clonal recombinant phage and evaluation: after the third round screening, with 2 * YT, TG1 bacterium liquid is done to multiple dilution (stoste, 1: 10,1: 100,1: 1000), then be coated on SOBAG solid medium (molecular cloning, the third edition, Huang Peitang etc. translate) upper, 30 ℃ of overnight incubation.94 single bacterium colonies of random picking from flat board, be inoculated in respectively in 100 μ l 2 * YTAG (containing 100 μ g/mL penbritins and 2% glucose) nutrient solution 30 ℃ of overnight incubation.Get 20 μ l nutrient solutions, transfer in 200 μ l containing 5 * 10
8in 2 * YTAG nutrient solution of pfu/mL M13K07, cultivate 2 hours for 37 ℃.Centrifugal, by the resuspended sedimentation cell of 200 μ l 2 * YTAK (containing 2 * YT of 100 μ g/mL penbritins and 50 μ g/mL kantlex), 30 ℃ of overnight incubation.Centrifugal, collection supernatant, be the mono-clonal recombinant phage.
Select plain antigen coated elisa plate with P, with 0.5%BSA, as negative control, use goat-anti M13 phage antibody as positive control.37 ℃ of sealings of 1%BSA 1 hour.The equal-volume mixture of cleer and peaceful confining liquid on 100 μ l recombinant phages antibodies is joined in elisa plate, add the M13 phage in control wells.Hatch 1 hour for 37 ℃, PBST (containing the PBS of 0.05%Tween 20) washes plate 3 times, and PBS washes plate 3 times.Every hole adds 100 μ l goat-anti M13 phage antibody IgG-HRP (1: 2000), hatches 1 hour for 37 ℃.PBST and PBS once respectively wash plate 3 times, add freshly prepared substrate H
2o
2-OPD, room temperature reaction 20min, add 50 μ l 2M H
2sO
4termination reaction, at A
490the absorbance value in every hole is detected at place.The positive clone more than 2.1 times of the negative contrast of absorbance value, select with P and select element in conjunction with the strongest active positive colony.
10, the DNA sequence analysis of positive colony recombinant plasmid: the DNA sequence dna of measuring anti P selectin single-chain antibody on this positive recombinant plasmid with T7DNA sequence TAATACGACTCACTATAGGG, this gene has the nucleotide sequence of SEQ ID NO:2 as a result, by 720 based compositions, its variable region of heavy chain encoding gene has the DNA sequence dna of SEQ ID NO:5 in sequence table, the variable region of light chain encoding gene has the DNA sequence dna of SEQ ID NO:6 in sequence table, its encoding sequence is for to hold the 1-720 bit base from 5 ', coding has the protein of the amino acid residue sequence of SEQ ID NO:1 in sequence table, by this antibody called after V
l-Linker-V
h(also claiming scFv).
The purifying of the structure of embodiment 2, anti P selectin single-chain antibody scFv carrier for expression of eukaryon and the screening of efficient expression cell line and anti P selectin antibody
One, the screening of the structure of anti P selectin single-chain antibody scFv carrier for expression of eukaryon and efficient expression cell line
For obtain aspect molecular structure, physicochemical property and biological function closer to natural higher organism protein molecule, the anti P selectin single-chain antibody V that embodiment 1 is obtained
l-Linker-V
hfusion gene cloning, to efficient carrier for expression of eukaryon pEE14.1 (Lonza), obtains carrying anti P selectin single-chain antibody V
l-Linker-V
hthe recombinant expression vector of fusion gene, called after pEE14.1/V
h-Linker-V
l.The recycling liposome is by recombinant plasmid pEE14.1/V
h-Linker-V
ltransfection is to Chinese hamster ovary cell CHO.After transfection 24 hours, suck substratum, add the selective medium DMEM+10%FCS+25 μ m MSX that 10mL is fresh.Containing 5%CO
2mixed gas, in 37 ℃ of incubators that humidity is 98%, cultivate.After 2 weeks, the clone of about 1-2mm occurs, with clone's ring, the clone of appearance is forwarded in 24 orifice plates, every hole adds 1mL selective medium DMEM+10%FCS+25 μ m MSX to continue to cultivate.After transformant grows to 5 days, draw supernatant.This supernatant 100 μ l are joined with P and select, in the antigen coated elisa plate of element, to hatch 1 hour for 37 ℃, and PBS washes plate 3 times.Every hole adds two anti-antibody IgG (1: 2000) of 100 μ l HRP marks, hatches 1 hour for 37 ℃.PBS washes plate 3 times, adds freshly prepared substrate H
2o
2-OPD, room temperature reaction 20min, add 50 μ l 2M H
2sO
4termination reaction, at A
490the absorbance value in every hole is detected at place.The positive clone more than 2.1 times of the negative contrast of absorbance value, select with P and select element in conjunction with the strongest active positive colony, is the Chinese hamster ovary celI strain of high efficient expression anti P selectin single-chain antibody.
Two, the purifying of anti P selectin single-chain antibody
By the Chinese hamster ovary celI strain amplification culture of high efficient expression, the results supernatant.Supernatant is slowly added in HiTrapN-hydroxysuccinimide column (Amersham Biosciences) to purification of single stranded antibody.With the PBS wash-out of 0.01mol/L pH 7.4, flow velocity is 1mL/min, to elutant OD
280till<0.02.Add the glycine of 0.1mol/L pH 2.4-HCl damping fluid, flow velocity is 1mL/min, collects the composition absorbed, immediately with the neutralization of 1mol/L sodium carbonate, in order to avoid protein denaturation.Through SDS-PAGE and Western Blot, identify, result as shown in Figure 3 and Figure 4, has obtained the target protein of 240KD through expression, and this albumen can be selected plain specific combination with P, conform to expected results, shown to obtain the very high anti P selectin single-chain antibody of purity.
Embodiment 3, experimentation on animals
One, biodistribution experiment
Adopt the Iodogen method by anti P selectin single-chain antibody ScFv mark
125i, in the EP pipe that is coated with 200 μ g Iodogen, add 50mmLo/L PBS (pH7.4) the 150 μ l of existing preparation, ScFv 100 μ l (100 μ g), the Na dissolved containing 1mg BSA successively
125i solution 15 μ l (185MBq), be interrupted and slightly shake mark pipe 15min under room temperature.SEP-PAK C18 post is used respectively methyl alcohol, distilled water and each 5mL of 0.1% trifluoroacetic acid (TFA) to wash successively and is made its activation; Mark mixture upper prop, 0.1%TFA drip washing; 60% acetonitrile solution wash-out, 1.5mL elutriant before collecting.After lyophilize, with PBS solution dilution, packing containing 1mg/mL BSA ,-80 ℃ of freezer storages are standby.Male DBA/1J mouse tail root subcutaneous injection 0.1mL collagen I I and complete Freund's adjuvant (all being purchased from U.S. Sigma company), strengthen once setting up rheumatoid arthritis (CIA) mouse model on the 21st day.Test and clustering method are as follows: 1. control group tail vein injection
125i-ScFv (2ug), sacrificed by decapitation after 24h, 48h, collect blood respectively, takes out histoorgan, weighs and measure its radioactivity (Bq), and result is scaled the ID%/g tissue.2. sacroiliitis group tail vein injection
125i-ScFv (2ug), after 24h, 48h, 72h, 96h, take the same processing, detection respectively.3. arthritis treatment group, tail vein injection once
125i-ScFv (0.25ug), after 24h, take the same processing, detection.4. arthritis treatment group, every day tail vein injection once
125i-ScFv (0.25ug), behind continuous 7 days, 24h, take the same processing, detection.Result as shown in Figure 5, shows that anti P selectin single-chain antibody ScFv of the present invention can assemble at sacroiliitis position height.
Two, animal experiment
Utilize rheumatoid arthritis (CIA) mouse model (the same), since test in the 21st day, be grouped as follows: 1. inject 50 μ l PBS control groups.2. the ScFv treatment group, inject a ScFv (0.25) mg every day, injects altogether 7 times.3. the ScFv treatment group, inject a ScFv (0.25) mg every day, injects altogether 4 times.4. the ScFv treatment group, inject a ScFv (0.25) mg.The 23rd day starts clinical score, and the standard that clicks is scored to the scorching degree of joint of animal: 0 minute, without sacroiliitis; 1 minute, light inflammation and claw were rubescent; 2 minutes, serious erythema and swelling, affected the claw function; 3 minutes, claw or joint deformity, stiff, lost function.Every mouse four limbs highest point total is 12 minutes.As shown in Figure 6, since the 23rd day, the sacroiliitis severity of tri-treatment groups of ScFv was starkly lower than the PBS group to result.
Above the results show anti P selectin single-chain antibody ScFv of the present invention selects element to have special targeting to P, has anti-stick/anti-inflammatory target retarding effect better, and the inflammatory reaction of body is had to good therapeutic action.
Sequence table
<160>6
<210>1
<211>240
<212>PRT
<213 > phage
<400>1
Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Ser
1 5 10 15
Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Asp Tyr
20 25 30
Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Met
35 40 45
Gly Tyr Ile Ser Ser Gly Arg Thr Ser Tyr Asn Pro Ser Leu Lys Ser
50 55 60
Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe Leu Gln
65 70 75 80
Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg
85 90 95
His Tyr Gly Asn Tyr Glu Gly Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly
100 105 110
Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Gly Ser Gly
115 120 125
Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser
130 135 140
Met Ala Ile Gly Glu Lys Val Thr Ile Arg Cys Ile Thr Ser Thr Gly
145 150 155 160
Ile Asp Asp Asp Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro
165 170 175
Glu Leu Leu Ile Ser Glu Gly Asn Val Leu Arg Pro Gly Val Pro Ser
180 185 190
Arg Phe Ser Ser Ser Gly Tyr Gly Thr Asp Phe Leu Phe Thr Ile Glu
195 200 205
Asn Ile Leu Ser Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Thr Asp
210 215 220
Asn Leu Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg
225 230 235 240
<210>2
<211>720
<212>DNA
<213 > phage
<400>2
gtgcagctgc aggagtctgg acctggcctg gtgaaacctt ctcagtctct gtccctcacc 60
tgcactgtca ctggctactc aatcaccagt gattatgcct ggaactggat ccggcaattt 120
ccaggaaaca aactggagtg gatgggctac ataagcagtg gaagaacaag ctacaaccca 180
tctctcaaaa gtcgaatctc tatcactcga gacacatcca agaaccagtt cttcctgcag 240
ttgaattctg tgactactga ggacacggcc acatattact gtgcaagaca ctatggtaac 300
tacgagggct attactatgc tatggactac tggggccaag ggaccacggt caccgtctcc 360
tcaggaggcg gtggcggctc gggtggcggc ggctctgaca tccagatgac ccagtctcca 420
gcatccctgt ccatggctat aggagaaaaa gtcaccatca gatgcataac cagcactggt 480
attgatgatg atatgaactg gtaccagcag aagccagggg aacctcctga actccttatt 540
tcagaaggca atgttcttcg tcctggagtc ccatcccgat tctccagcag tggctatggt 600
acagattttc tttttacgat tgaaaacatt ctctcagaag atgttgcaga ttactactgt 660
ttgcaaactg ataacttgcc tctcacgttc ggctcgggga caaagttgga aataaaacgg 720
<210>3
<211>122
<212>PRT
<213 > phage
<400>3
Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln Ser
1 5 10 15
Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Asp Tyr
20 25 30
Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp Met
35 40 45
Gly Tyr Ile Ser Ser Gly Arg Thr Ser Tyr Asn Pro Ser Leu Lys Ser
50 55 60
Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe Leu Gln
65 70 75 80
Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys Ala Arg
85 90 95
His Tyr Gly Asn Tyr Glu Gly Tyr Tyr Tyr Ala Met Asp Tyr Trp Gly
100 105 110
Gln Gly Thr Thr Val Thr Val Ser Ser Gly
115 120
<210>4
<211>108
<212>PRT
<213 > phage
<400>4
Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Met Ala Ile Gly
1 5 10 15
Glu Lys Val Thr Ile Arg Cys Ile Thr Ser Thr Gly Ile Asp Asp Asp
20 25 30
Met Asn Trp Tyr Gln Gln Lys Pro Gly Glu Pro Pro Glu Leu Leu Ile
35 40 45
Ser Glu Gly Asn Val Leu Arg Pro Gly Val Pro Ser Arg Phe Ser Ser
50 55 60
Ser Gly Tyr Gly Thr Asp Phe Leu Phe Thr Ile Glu Asn Ile Leu Ser
65 70 75 80
Glu Asp Val Ala Asp Tyr Tyr Cys Leu Gln Thr Asp Asn Leu Pro Leu
85 90 95
Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg
100 105
<210>5
<211>366
<212>DNA
<213 > phage
<400>5
gtgcagctgc aggagtctgg acctggcctg gtgaaacctt ctcagtctct gtccctcacc 60
tgcactgtca ctggctactc aatcaccagt gattatgcct ggaactggat ccggcaattt 120
ccaggaaaca aactggagtg gatgggctac ataagcagtg gaagaacaag ctacaaccca 180
tctctcaaaa gtcgaatctc tatcactcga gacacatcca agaaccagtt cttcctgcag 240
ttgaattctg tgactactga ggacacggcc acatattact gtgcaagaca ctatggtaac 300
tacgagggct attactatgc tatggactac tggggccaag ggaccacggt caccgtctcc 360
tcagga
366
<210>6
<211>324
<212>DNA
<213 > phage
<400>6
gacatccaga tgacccagtc tccagcatcc ctgtccatgg ctataggaga aaaagtcacc 60
atcagatgca taaccagcac tggtattgat gatgatatga actggtacca gcagaagcca 120
ggggaacctc ctgaactcct tatttcagaa ggcaatgttc ttcgtcctgg agtcccatcc 180
cgattctcca gcagtggcta tggtacagat tttcttttta cgattgaaaa cattctctca 240
gaagatgttg cagattacta ctgtttgcaa actgataact tgcctctcac gttcggctcg 300
gggacaaagt tggaaataaa acgg
324
Claims (9)
1. anti P selectin single-chain antibody, the SEQ ID NO:1 of its amino acid residue sequence in sequence table means.
2. anti P selectin single-chain antibody according to claim 1, is characterized in that: the polypeptide that the amino acid residue sequence that the variable region of heavy chain of described anti P selectin single-chain antibody is the SEQ ID NO:3 in sequence table means; The polypeptide that the amino acid residue sequence that variable region of light chain is the SEQ ID NO:4 in sequence table means.
3. the gene of coding claim 1 or 2 described anti P selectin single-chain antibody.
4. encode the according to claim 3 gene of anti P selectin single-chain antibody, is characterized in that: be the DNA sequence dna that SEQ ID NO:2 means in sequence table.
5. encode the according to claim 3 gene of anti P selectin single-chain antibody, is characterized in that: the DNA sequence dna of SEQ ID NO:3 in the DNA sequence dna that the variable region of heavy chain encoding gene of the gene of described coding anti P selectin single-chain antibody is SEQ ID NO:5 in sequence table or code sequence list; The DNA sequence dna of SEQ ID NO:4 in the DNA sequence dna that the variable region of light chain encoding gene is SEQ ID NO:6 in sequence table or code sequence list.
6. for expressing the recombinant expression vector of anti P selectin single-chain antibody, be the recombinant expression vector that contains claim 3 or 4 or 5 described anti P selectin single-chain antibody encoding genes.
7. a method of expressing the described anti P selectin single-chain antibody of claim 1, by described recombinant expression vector conversion or the transduction host cell for expressing anti P selectin single-chain antibody of claim 6, cultivate host cell, from substratum or cell, separation and purification albumen, obtain anti P selectin single-chain antibody.
8. expression method according to claim 7, it is characterized in that: described host cell is Chinese hamster ovary celI.
9. the application of the described anti P selectin single-chain antibody of claim 1 or 2 in the medicine of preparation treatment body inflammatory reaction.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200810224769 CN101456912B (en) | 2008-12-29 | 2008-12-29 | Anti P selectin single-chain antibody and use thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 200810224769 CN101456912B (en) | 2008-12-29 | 2008-12-29 | Anti P selectin single-chain antibody and use thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101456912A CN101456912A (en) | 2009-06-17 |
CN101456912B true CN101456912B (en) | 2013-05-22 |
Family
ID=40768058
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 200810224769 Expired - Fee Related CN101456912B (en) | 2008-12-29 | 2008-12-29 | Anti P selectin single-chain antibody and use thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101456912B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102192978B (en) * | 2011-03-15 | 2013-09-04 | 中国科学院武汉病毒研究所 | Method and application for safety evaluation of drugs and xenobiotics both effecting on internal mucous membranes |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1542020A (en) * | 2003-11-07 | 2004-11-03 | 上海第二医科大学附属瑞金医院 | Monoclonal antibody of anti human P-selectin lectin-EGF domain and preparation method and application thereof |
CN101186649A (en) * | 2006-11-17 | 2008-05-28 | 上海交通大学医学院附属瑞金医院 | Human monoclonal antibody of anti-human P-selectin lectin-epidermal growth factor functional domain and hybridoma cell strain thereof |
-
2008
- 2008-12-29 CN CN 200810224769 patent/CN101456912B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1542020A (en) * | 2003-11-07 | 2004-11-03 | 上海第二医科大学附属瑞金医院 | Monoclonal antibody of anti human P-selectin lectin-EGF domain and preparation method and application thereof |
CN101186649A (en) * | 2006-11-17 | 2008-05-28 | 上海交通大学医学院附属瑞金医院 | Human monoclonal antibody of anti-human P-selectin lectin-epidermal growth factor functional domain and hybridoma cell strain thereof |
Non-Patent Citations (2)
Title |
---|
董宁征等.抗P选择素免疫小鼠单链抗体噬菌体展示文库的构建和筛选.《免疫学杂志》.2002,第119-122页. * |
郭瑞峰.人P选择素胞外区Lectin-EGF片段的基因克隆及单链抗体初筛.《苏州大学硕士学位论文》.2005,第6-22页. * |
Also Published As
Publication number | Publication date |
---|---|
CN101456912A (en) | 2009-06-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2024002149A1 (en) | Recombinant type-iii collagen and method for preparing same | |
ES2686968T3 (en) | Bifunctional fusion proteins to inhibit angiogenesis in the tumor microenvironment and to activate adaptive immune responses and their genes and uses | |
CN109897107B (en) | Nano antibody and preparation method thereof | |
CN101602809B (en) | Antibody targeted complement inhibitor with anti-inflammatory action | |
CN114395574B (en) | Porcine epidemic diarrhea virus fusion protein, and encoding gene and application thereof | |
CN101456912B (en) | Anti P selectin single-chain antibody and use thereof | |
CN101475644B (en) | Novel targeted fusion protein with anti-inflammatory action and use thereof | |
CN107034201A (en) | Apparent modification enzyme SETD2 antivirus action and its application | |
RU2020113297A (en) | DNA vaccine against SARS-CoV-2 virus based on gene therapy DNA vector GDTT1.8NAS12, method of its production, strains carrying gene therapy DNA vectors, method of their production, method of industrial-scale production of gene therapy DNA vectors | |
CN103130894B (en) | Recombinant single-chain antibody G5-4ScFv of anti-human gamma delta T cell receptor (TCR) monoclonal antibody and encoding gene and application thereof | |
CN108822220A (en) | Sheep albumin-interferon-tau-interleukin-22 fusion protein, preparation method and its encoding gene, a kind of sheep long-acting interferon | |
CN108840950A (en) | A kind of fusion protein and preparation method thereof being made of pig interleukin 2 and 6, Porcine interferon-gamma and porcine interferon alpha | |
KR101466875B1 (en) | The therapy for autoimmune disease using minicircle vector designed to express TNFR2 | |
CN107434826B (en) | Yeast cell for high expression of Slit2D2-HSA protein and application | |
CN111732667B (en) | Peste des petits ruminants virus genetic engineering subunit vaccine | |
CN102121010B (en) | Takifugu obscures B lymphocyte stimulating factor cDNA and cloning method and recombination application thereof | |
CN108864305A (en) | A kind of fusion protein and preparation method thereof being made of sheep albumin, sheep interferon gamma and sheep interferon-tau | |
CN108840935A (en) | A kind of fusion protein being made of sheep albumin and sheep interferon gamma and preparation method thereof and a kind of recombination sheep long-acting interferon γ | |
CN108794644A (en) | A kind of fusion protein and preparation method thereof being made of cattle interleukins-2 2, Bov IFN γ and Bov IFN α | |
CN108864302A (en) | A kind of fusion protein and preparation method thereof being made of pig albumin, Porcine interferon-gamma and pig interleukin 2 and 6 | |
CN103232543A (en) | Recombinant protein Tumstatin-CD137L4 with Tumstatin activities as well as preparation method and application thereof | |
CN101235083B (en) | HIV-I resisting polypeptide, coded sequence and use thereof | |
CN101838318B (en) | Anti-HIV-I polypeptide and coding sequence and use thereof | |
CN101899100B (en) | Anti-HIV-I (Human Immunodeficiency Virus-I) polypeptides as well as coding sequences and applications thereof | |
CN101357944B (en) | Anti-idio-typic antibody NP30 chimeric Fab fragment of japonicum, preparation method and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130522 Termination date: 20151229 |
|
EXPY | Termination of patent right or utility model |