CN107434826B - Yeast cell for high expression of Slit2D2-HSA protein and application - Google Patents

Abstract

The invention provides a yeast cell for high-expression of Slit2D2-HSA protein and application thereof, and particularly discloses a Slit2D2-HAS fusion protein with remarkable anti-tumor activity, and a Slit2D2-HAS fusion protein codon sequence capable of being highly expressed in yeast is obtained through multiple codon optimization. The optimized codon sequence can be efficiently expressed in yeast cells.

Description

Yeast cell for high expression of Slit2D2-HSA protein and application

Technical Field

The invention belongs to the field of biological medicines, and particularly relates to a yeast cell for high-expression Slit2D2-HSA protein and application thereof.

Background

Tumors are diseases caused by abnormal growth of body cells, and the incidence rate of malignant tumors is on the rise in the last 30 years. According to the "world cancer report", nearly half of the newly added cancer cases occur in asia every year in the world, most of which occur in china, and the highest number of newly added cancer cases occurs in china. The Chinese new cancer cases account for about 20% of the world, and the cancer death cases account for about 25% of the world. According to the report of 2015 annual report of Chinese tumor registration, 8550 new tumor cases are added every day in China, 6 people are diagnosed as cancer every minute, 5 people die from cancer, and solid tumors such as lung cancer, gastric cancer, liver cancer and the like become cancers with the highest morbidity and mortality. Tumors have become a serious disease affecting national health, and bring heavy burden to sick families and society.

Robo is a single transmembrane receptor protein, and in mammals, 4 Robo genes have been cloned. From a species evolution point of view, the extracellular portion of Robo1,2,3 is very conserved, consisting of 5 Ig-like domains and 3 Fibronectin type III repeats from Drosophila to human. Robos have a very short transmembrane region and a longer intracellular domain; according to sequence conservation, the intracellular domain is divided into 4 smaller regions, which are designated as: CC0, CC1, CC2, CC 3. The structure of Robo4 is very different from that of other three family members, and it has only 2 Ig-like functional regions and 3 fibrinectin III type repetitive sequences outside the cell; there are also only two regions, CC0 and CC2, within the cell. The extracellular IgG domains of Robos are thought to be necessary for binding with the ligand Slit, and the longer intracellular domain interacts with some important signal molecules and participates in signal transduction downstream of Slit/Robo, thereby completing the transmission of stimulation signals from the outside of the cell to the internal skeleton. At present, the mechanistic resolution of the proteins of slit2 and Robo interaction region has been completed, and it was found that the second domain D2 of slit2 binds to Ig1 of Robo1, thereby initiating signaling. In recent years, it has been discovered that Slit and its receptor Robo regulate the migration of tumor cells, the migration of inflammatory cells and the migration of vascular endothelial cells, and are closely related to the development of tumor cells and inflammatory diseases. Therefore, development of new antitumor drugs based on Slit is expected.

Disclosure of Invention

The invention aims to provide a yeast cell for high expression of Slit2D2-HSA protein and application thereof.

In a first aspect of the invention, there is provided a fusion protein selected from the group consisting of:

(A) a polypeptide having an amino acid sequence shown in SEQ ID NO. 1;

(B) has a homology of more than or equal to 80% (preferably, more than or equal to 90%) with the amino acid sequence shown in SEQ ID NO. 1

Homology; etc. preferably 95% homology; most preferably, homology of > 97%) of the polypeptide,

and the polypeptide has tumor suppressor activity;

(C) 1, the amino acid sequence shown in SEQ ID NO 1 is substituted by 1-5 amino acid residues,

A derivative polypeptide formed by deletion or addition and retaining tumor inhibiting activity.

In a second aspect of the invention, there is provided an isolated codon optimised polynucleotide encoding a fusion protein according to the first aspect of the invention; and the polynucleotide is selected from the group consisting of:

(a) polynucleotide with sequence shown in SEQ ID NO. 2;

(b) polynucleotide having a nucleotide sequence homology of 95% or more (preferably 98% or more) with the sequence shown in SEQ ID NO. 2;

(c) a polynucleotide complementary to any one of the polynucleotides of (a) - (c).

In a third aspect of the invention, there is provided an expression vector comprising a polynucleotide according to the second aspect of the invention.

In a fourth aspect of the invention, there is provided a host cell comprising an expression vector according to the third aspect of the invention or having integrated into its genome a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the host cell is a yeast cell.

In another preferred embodiment, the host cell is a yeast cell strain having a preservation number of CCTCC NO: M2016246.

In a fifth aspect of the invention, there is provided a method of preparing a fusion protein according to the first aspect of the invention, comprising the steps of:

culturing the cell of the fourth aspect of the invention under conditions suitable for expression, thereby expressing the fusion protein of the first aspect of the invention; and isolating the fusion protein.

In a sixth aspect of the present invention, there is provided a pharmaceutical composition, comprising the fusion protein of the first aspect of the present invention, the polynucleotide of the second aspect of the present invention, or the expression vector of the third aspect of the present invention, or the host cell of the fourth aspect of the present invention, and a pharmaceutically acceptable carrier and/or adjuvant.

In a seventh aspect of the invention, there is provided a use of the fusion protein of the first aspect of the invention for the preparation of a medicament for treating or preventing a tumor.

In another preferred embodiment, the use further comprises the preparation of a medicament for treating or preventing tumor metastasis.

In another preferred embodiment, the tumor is selected from the group consisting of: gastric cancer, liver cancer, leukemia, kidney tumor, lung cancer, small intestine cancer, bone cancer, prostatic cancer, colorectal cancer, breast cancer, large intestine cancer, prostatic cancer, cervical cancer, adrenal gland tumor, or bladder tumor.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the results of PCR identification, lane 1: PCR amplification product (2500 bp); MK DL5000 plus DNA Marker.

FIG. 2 shows a map of pPICZaA-Slit2D2-HAS plasmid, MK: DL5000DNA Marker; lanes 1-6, PCR amplification product (2400bp), positive clone 2-6.

FIG. 3 shows the results of PCR identification of colonies of DH5a transformed with yeast recombinant plasmid.

FIG. 4 shows the results of PCR identification of yeast genome, lanes 1-5, PCR product of clone 1-5 genomic DNA (About 2500 bp); x33 genomic DNA (negative control); pPICZaA-Slit2D2-HSA plasmid (positive control); MK is DL5000DNA Marker.

FIG. 5 shows the results of SDS-PAGE detection.

FIG. 6 shows the results of Western blot assay, lanes 1-5, culture supernatants (10-fold concentrated) of clones 1-5 after 72h induction; n negative control (X33); p is anti-His label western blot positive control; MK is a molecular weight marker.

FIG. 7 shows the results of purification of the fusion protein, lane A, column sample; lane B, flow through; lane C50 mM imidazole-1 elution; lane D, 50mM imidazole-2 elution; lane E500 mM imidazole-1 elution; lane F500 mM imidazole-2 elution; lane G500 mM imidazole-3 elution; lane H500 mM imidazole-2 (unreduced); MK is a molecular weight marker.

FIG. 8 shows the results of the final product, lane A: Slit2D2-HSA protein (unreduced); lane B Slit2D2-HAS protein (reduced); MK is a molecular weight marker.

FIG. 9 shows the results of the inhibition of the migration activity of the MDA-MB-231 tumor cell line by the slit2D2-HAS fusion protein.

FIG. 10 shows the results of the inhibition of the migration activity of the SMMC7721 tumor cell line by the slit2D2-HAS fusion protein.

FIG. 11 shows the results of the inhibition of the migration activity of the MCF-7/ADR tumor cell line by the slit2D2-HAS fusion protein.

Detailed Description

The invention obtains a Slit2D2-HAS fusion protein with obvious anti-tumor activity through extensive and intensive research, obtains a codon sequence of the Slit2D2-HAS fusion protein which can be highly expressed in yeast through multiple codon optimization, and preserves a yeast cell STRAIN of the highly expressed Slit2D2-HSA protein, is classified and named as Pichia pastoris ATCG-STRAIN-01(Pichia pastoris ATCG-STRAIN-01), HAS the preservation number of CCTCC NO: M2016246, HAS the preservation unit of China type culture preservation center (CCTCC), HAS the address of the preservation center of Wuhan university, Wuhan university, No. eight channel 299 in Wuhan district, Wuchang district, Hubei province, and HAS the preservation date of 2016 5 months and 4 days.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

According to the intensive research of the inventor, the Slit2D2-HSA fusion protein is designed and invented, and the expression of HEK-293 cells of mammals is utilized, so that the fusion protein has a good effect of inhibiting tumor metastasis, and specific contents can be found in Chinese patent application with the application number of CN201510236886.4 and international patent application with the application number of PCT/CN 2015/080523. However, when the expression system of mammalian cells is used for production and preparation, the production cost is high. Therefore, the key to reducing the production cost is to find an expression system which is lower in cost and can maintain the activity of the protein sample. The yeast expression system is a powerful tool for researching eukaryotic protein expression and analysis, has a post-transcriptional processing modification function, and is suitable for stably expressing functional exogenous protein. Compared with insect expression systems and mammalian expression systems, the yeast expression system has simple operation and low cost, can be fermented in a large scale, and is an ideal tool for producing and preparing recombinant eukaryotic proteins.

The invention mainly utilizes a gene engineering method to transform the gene into the yeast cell and screens the yeast cell which can stably and highly express the Slit2D2-HSA fusion protein, so that the method is suitable for preparing the Slit2D2-HSA fusion protein by subsequent low-cost and high-density fermentation.

Slit protein

The Slit is a kind of secretory glycoprotein, the molecular weight is about 200kD, and three Slit genes cloned in mammals are named as Slit1, Slit2 and Slit3 respectively. Its structure consists of an N-terminal signal peptide, 4 leucine-rich repeats (LRRs) and several EGF-like repeats (7 in Drosophila and 9 in vertebrates); the study showed that the LRRs are the binding region of the Slit protein and the receptor Robo. Slit proteins function by binding to the receptor Robo. Robo is a single transmembrane receptor protein, and in mammals, 4 Robo genes have been cloned. From a species evolution point of view, the extracellular part of Robo1,2,3 is very conserved, consisting of 5 Ig-like domains and 3 FibroctedinIII repeats from Drosophila to human. Robos have a very short transmembrane region and a longer intracellular domain; according to sequence conservation, the intracellular domain is divided into 4 smaller regions, which are designated as: CC0, CC1, CC2, CC 3. The structure of Robo4 is very different from that of other three family members, and it has only 2 Ig-like functional regions and 3 fibrinectin III type repetitive sequences outside the cell; intracellular is also only two regions of CC0 and CC 2. The extracellular IgG domain of Robos is considered to be necessary for binding with the ligand Slit, and the longer intracellular domain interacts with some important signal molecules and participates in signal transduction downstream of the Slit/Robo, thereby completing the transmission of stimulation signals from the outside of the cell to the internal skeleton. Mechanistic analysis of the proteins of slit2 and Robo interaction region revealed that the second domain D2 of slit2 binds to Ig1 of Robo1, initiating signaling (Morlot, Hemrika et al 2007, Hohenchester 2008, Seiradake, von Philipsborn et al 2009).

In recent years, the role of a reaction axis SDF-1/CXCR4 formed by interaction of a chemokine receptor (CXC chemokine-4, CXCR4) and a ligand stromal derived factor-1 (SDF-I) thereof in tumor invasion and metastasis is more and more concerned, and after the chemokine CXCL12 and the CXCR4 are combined, actin polymerization and cell pseudopodia can be caused, so that cancer cells break through basement membrane invasion, and the movement and distant metastasis of the cancer cells are promoted, thereby generating chemotactic movement and invasion reactions. The series of effects are positively correlated with SDF-1 dosage, and the SDF-1 is proved to be involved in local invasion and organ-specific metastasis of cancers such as breast cancer, prostate cancer, liver cancer, non-small cell lung cancer, fibrosarcoma, ovarian cancer, medulloblastoma, pancreatic cancer, colon cancer, melanoma and the like.

It has also been found that: ROBO1 is expressed in 45% of breast cancer DU4475 cells, and ROBO2 is expressed in 20% of breast cancer DU4475 cells; 35% MDA-MB-231 cells expressed ROBO1 and 21% MDA-MB-231 cells expressed ROBO 4. SDF-1 can induce the migration and invasion of breast cancer cells through a CXCR4/CXCL12 signal pathway, but the process can be inhibited by slit2 and the cell adhesion behavior can also be inhibited. (ii) a Other studies also demonstrated that Slit2(30pM or 100pM) was able to effectively inhibit SDF-1(10nM) induced tumor migration.

Fusion proteins and their preparation

In the context of the present invention, "fusion protein", "recombinant protein", "protein of the invention", "fusion protein of the invention" are used interchangeably and refer to a fusion protein having the structure described by formula Ia or Ib, i.e. comprising a protein element comprising Slit2D2 and a HSA protein element. A representative example is Slit2D 2-HSA. The proteins of the invention may be monomers or multimers (e.g., dimers) formed from monomers. Furthermore, it is to be understood that the term also includes active fragments and derivatives of the fusion protein.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in the natural state in the living cell is not isolated or purified, but the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in the natural state.

As used herein, "isolated fusion protein" means that the fusion protein is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify the fusion protein using standard protein purification techniques. Substantially pure proteins produce a single major band on a non-reducing polyacrylamide gel.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand.

The present invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the present invention. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

As used herein, the term "primer" refers to a generic term for an oligonucleotide that, when paired with a template, is capable of synthesizing a DNA strand complementary to the template from its origin by the action of a DNA polymerase. The primer can be natural RNA, DNA, and any form of natural nucleotide. The primers may even be non-natural nucleotides such as LNA or ZNA etc. A primer is "substantially" (or "substantially") complementary to a particular sequence on one strand of the template. The primer must be sufficiently complementary to one strand of the template to begin extension, but the sequence of the primer need not be completely complementary to the sequence of the template. For example, a primer that is complementary to the template at its 3 'end and has a sequence that is not complementary to the template at its 5' end remains substantially complementary to the template. Primers that are not perfectly complementary can also form a primer-template complex with the template, so long as there is sufficient primer binding to the template, allowing amplification to occur.

The full-length nucleotide sequence or a fragment thereof of the fusion protein or a component thereof (such as Slit2D2) of the invention can be obtained by PCR amplification method, recombination method or artificial synthesis method. For the PCR amplification method, the primer can be designed based on the disclosed nucleotide sequence, especially open reading frame sequence, and the sequence can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

A method of amplifying DNA/RNA using PCR technology is preferably used to obtain the gene of the present invention. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to vectors comprising the polynucleotides of the invention, as well as genetically engineered host cells encoded with the vector or fusion protein coding sequences of the invention, and methods for producing the proteins of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be used to express or produce recombinant proteins by conventional recombinant DNA techniques. Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) separating and purifying protein from culture medium or cell.

Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequences encoding the proteins of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: coli, bacterial cells of the genus streptomyces; fungal cells such as yeast; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, NS0, COS7, or 293 cells.

Transformation of host cells with recombinant DNABy conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The protein in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

In a preferred embodiment of the invention, the amino acid sequence of the SlitD2-HSA fusion protein according to the invention is as follows:

LHCPAACTCSNNIVDCRGKGLTEIPTNLPETITEIRLEQNTIKVIPPGAFSPYKKLRRIDLSNNQISELAPDAFQGLRSLNSLVLYGNKITELPKSLFEGLFSLQLLLLNANKINCLRVDAFQDLHNLNLLSLYDNKLQTIAKGTFSPLRAIQTMHLAQNPFICDCHLKWLADYLHTNPIETSGARCTSPRRLANKRIGQIKSKKFRCSGGGGSGGGGSGGGGSDAHKSEVAHRFKDLGEENFKALVLIAFAQYLQQCPFEDHVKLVNEVTEFAKTCVADESAENCDKSLHTLFGDKLCTVATLRETYGEMADCCAKQEPERNECFLQHKDDNPNLPRLVRPEVDVMCTAFHDNEETFLKKYLYEIARRHPYFYAPELLFFAKRYKAAFTECCQAADKAACLLPKLDELRDEGKASSAKQRLKCASLQKFGERAFKAWAVARLSQRFPKAEFAEVSKLVTDLTKVHTECCHGDLLECADDRADLAKYICENQDSISSKLKECCEKPLLEKSHCIAEVENDEMPADLPSLAADFVESKDVCKNYAEAKDVFLGMFLYEYARRHPDYSVVLLLRLAKTYETTLEKCCAAADPHECYAKVFDEFKPLVEEPQNLIKQNCELFEQLGEYKFQNALLVRYTKKVPQVSTPTLVEVSRNLGKVGSKCCKHPEAKRMPCAEDYLSVVLNQLCVLHEKTPVSDRVTKCCTESLVNRRPCFSALEVDETYVPKEFNAETFTFHADICTLSEKERQIKKQTALVELVKHKPKATKEQLKAVMDDFAAFVEKCCKADDKETCFAEEGKKLVAASQAALGLHHHHHH*(SEQ ID NO.:1)

through multiple codon optimization, the encoding polynucleotide sequence of the optimized SlitD2-HSA fusion protein which is particularly suitable for being expressed in yeast cells is as follows:

TTGCATTGTCCAGCAGCTTGTACTTGTTCTAACAACATCGTCGATTGCAGAGGTAAAGGTTTGACAGAAATCCCAACCAACTTGCCAGAAACCATTACCGAAATCAGATTGGAGCAGAACACCATTAAGGTTATTCCACCAGGCGCTTTTTCCCCATACAAGAAATTGAGAAGGATCGACTTGTCCAACAACCAAATCTCCGAATTGGCTCCAGACGCTTTTCAAGGTCTAAGATCTTTGAACTCCTTGGTCCTATACGGTAACAAGATCACCGAATTGCCAAAGTCATTGTTCGAAGGTCTATTCTCCTTGCAGTTGTTGTTGTTGAACGCCAACAAGATCAATTGCTTGAGAGTTGACGCTTTCCAAGACTTGCACAACTTGAACTTGTTGAGCCTATACGACAACAAGTTGCAGACTATCGCTAAAGGCACTTTCTCTCCATTGAGAGCTATTCAAACCATGCACTTGGCTCAAAACCCATTCATTTGCGATTGCCATTTGAAATGGTTGGCCGATTACTTGCACACTAACCCAATTGAAACTTCAGGAGCTAGGTGTACTAGTCCAAGAAGATTGGCTAACAAGAGAATCGGTCAGATCAAGTCCAAGAAGTTCAGATGTTCAGGCGGTGGAGGTTCAGGTGGTGGAGGTTCAGGAGGAGGAGGTTCAGACGCTCATAAATCAGAAGTTGCTCATAGATTCAAGGACTTGGGAGAAGAAAACTTCAAGGCTTTGGTGTTGATCGCTTTTGCACAATACTTGCAGCAGTGTCCATTCGAAGATCACGTCAAATTGGTCAACGAAGTCACAGAATTTGCTAAAACTTGCGTTGCCGACGAATCAGCCGAAAATTGCGATAAGTCCTTGCATACTTTGTTCGGCGATAAGTTGTGCACAGTTGCTACTTTGAGGGAAACTTACGGAGAAATGGCAGATTGTTGCGCTAAACAAGAACCAGAAAGGAACGAGTGCTTCTTGCAACATAAGGACGATAACCCAAACTTGCCAAGATTGGTTAGACCAGAAGTTGACGTTATGTGTACAGCATTTCACGATAACGAGGAGACCTTCTTGAAGAAATACCTATACGAGATCGCCAGGAGACATCCATATTTCTACGCTCCAGAGTTGTTGTTCTTCGCTAAAAGATACAAGGCCGCTTTTACCGAATGTTGTCAAGCAGCAGATAAAGCAGCTTGCTTGTTGCCAAAGTTGGACGAATTGAGAGACGAAGGTAAAGCTTCTTCCGCTAAACAAAGGTTGAAGTGCGCTTCATTGCAAAAGTTCGGAGAAAGAGCTTTTAAAGCTTGGGCAGTAGCTAGATTGTCACAAAGATTCCCAAAAGCCGAATTTGCCGAAGTTTCCAAATTGGTCACCGACTTGACTAAAGTTCATACCGAGTGTTGCCACGGAGATTTGTTGGAGTGCGCAGACGATAGAGCAGATTTGGCCAAATACATTTGCGAGAACCAGGATTCCATCTCCTCTAAGTTGAAGGAGTGTTGCGAAAAGCCATTGTTGGAAAAGTCCCATTGCATTGCAGAAGTTGAAAACGACGAAATGCCAGCAGATTTGCCATCTTTGGCAGCAGATTTCGTTGAATCTAAGGACGTTTGCAAGAACTACGCCGAAGCTAAAGACGTTTTCTTGGGCATGTTCCTATACGAATACGCTAGAAGACATCCAGATTACTCCGTTGTCTTGTTGTTGAGATTGGCTAAGACCTACGAGACTACTTTAGAGAAGTGTTGCGCAGCAGCAGATCCACACGAGTGTTACGCTAAAGTTTTCGACGAATTCAAGCCATTGGTTGAAGAACCACAGAACTTGATCAAGCAGAATTGCGAATTGTTCGAGCAATTGGGAGAGTACAAGTTCCAAAACGCTTTGCTAGTCAGATACACCAAGAAGGTTCCACAAGTTTCCACTCCAACTTTGGTTGAAGTCTCCAGAAACTTGGGTAAAGTTGGCTCTAAGTGTTGCAAGCATCCAGAAGCTAAGAGAATGCCTTGTGCCGAAGATTATTTGAGCGTTGTTTTGAACCAGCTTTGCGTTTTGCACGAAAAGACTCCAGTTTCCGATAGAGTCACTAAGTGTTGTACCGAATCCTTGGTTAACAGAAGACCTTGTTTCAGCGCTTTGGAAGTTGACGAAACTTACGTCCCAAAGGAATTCAACGCAGAAACTTTCACCTTCCACGCAGATATTTGCACTTTGTCCGAGAAGGAAAGACAGATCAAGAAGCAAACCGCTTTGGTTGAATTGGTGAAGCATAAGCCAAAGGCTACTAAGGAACAATTGAAGGCAGTTATGGACGATTTCGCAGCTTTCGTTGAAAAGTGTTGCAAGGCAGACGATAAGGAAACTTGTTTCGCCGAAGAAGGCAAAAAATTGGTCGCAGCTTCTCAAGCAGCTTTAGGTTTACATCACCATCATCATCATTAA(SEQ ID NO.:2)

it is understood that the term also includes derivatives of the fusion proteins of the invention, which refer to polypeptides of the invention that have 1-3 amino acid additions or substitutions, 1-2 amino acid deletions, and still have tumor suppressor activity. These conservative variant polypeptides are preferably generated by amino acid substitutions according to Table 1.

TABLE 1

Initial residue(s)	Representative substitutions	Preferred substitutions
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

Once the relevant peptide sequences have been identified, they can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into cells, and isolating the relevant peptide (fusion protein) from the propagated host cells by conventional methods.

In addition, the related peptide sequence can also be directly synthesized by a chemical method.

Genetically engineered cell

The invention provides a genetically engineered cell (host cell), wherein the genetically engineered cell is a eukaryotic cell (preferably a yeast cell), and an expression cassette of SlitD2-HSA fusion protein is integrated in the genome of the cell; or the cell contains an expression vector which contains an expression cassette of SlitD2-HSA fusion protein.

In another preferred embodiment, the cell is a yeast cell.

In another preferred example, the expression cassette of SlitD2-HSA fusion protein comprises the following elements operably linked 5 'to 3': a promoter, an initiation codon, an ORF sequence of SlitD2-HSA fusion protein and a stop codon.

In the present invention, the term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

Pharmaceutical compositions and methods of administration

The invention also provides a composition comprising an effective amount of the fusion protein of the invention, and a pharmaceutically acceptable carrier. Typically, the fusion proteins of the present invention can be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is typically about 5 to about 8, preferably about 6 to about 8.

As used herein, the term "effective amount" or "effective dose" refers to an amount that is functional or active in and acceptable to humans and/or animals, such as 0.001 to 99 wt%; preferably 0.01 to 95 wt%; more preferably, 0.1 to 90 wt%.

As used herein, a "pharmaceutically acceptable" component is one that is suitable for use in humans and/or mammals without undue adverse side effects (such as toxicity, irritation, and allergic response), i.e., at a reasonable benefit/risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents.

The pharmaceutical composition of the present invention contains a safe and effective amount of the fusion protein of the present invention and a pharmaceutically acceptable carrier. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation is usually adapted to the administration mode, and the pharmaceutical composition of the present invention can be prepared in the form of injection, for example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition is preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount. The pharmaceutical preparation of the invention can also be prepared into a sustained release preparation.

The effective amount of the fusion protein of the present invention may vary depending on the mode of administration and the severity of the disease to be treated, etc. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the fusion protein of the invention such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the weight of the patient, the immune status of the patient, the route of administration, and the like. In general, the fusion protein of the present invention can be administered to a patient suffering from tumor at a dose of about 0.5mg to 5mg/kg (preferably 2mg to 4 mg/kg) of animal body weight per day, which is satisfactory. For example, divided doses may be administered several times per day, or the dose may be proportionally reduced, as may be required by the urgency of the condition being treated.

The main advantages of the invention are:

(1) the yeast cell is modified by a gene engineering method for the first time to express the slit2D2-HSA fusion protein;

(2) the slit2D2-HSA fusion protein expressed by the yeast cells has good anti-tumor metastasis activity;

(3) the obtained codon optimized sequence can be efficiently expressed in yeast cells, and the expressed fusion protein has obvious anti-tumor activity;

(4) it has been unexpectedly found that a yeast cell strain with high expression of slit2D2-HSA fusion protein has about 5-10 times higher expression ability than that of general yeast cells.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

In a preferred embodiment of the invention, the media and reagents used are as follows:

1. low-salt LB culture medium

10g of peptone

5g of yeast powder

5g NaCl

Adding H₂O constant volume to 1L (adding 15g agar powder to prepare solid culture medium)

Autoclaving at 121 deg.C for 20min

YPD Medium

20g of peptone

10g yeast powder

20g glucose

Adding H₂O constant volume is 1L

Autoclaving at 121 deg.C for 20min

YPDS Medium

20g of peptone

10g yeast powder

20g glucose

1M sorbitol (Sortitol)

Adding H₂O constant volume to 1L (adding 15g agar powder to prepare solid culture medium)

Autoclaving at 121 deg.C for 20min

4.YPDZ

The YPDS solid medium was added with Zeocin to a final concentration of 100ug/ml before use

BMMY Medium (Buffered methane-complex Medium)

1% yeast powder

2% peptone

100mM potassium phosphate pH 6.0

1.34％ YNB

(Yeast nitrogen source, containing ammonium sulfate without amino acids)

4 x 10^ -5% biotin

0.5% methanol

a) And b) is stock solution used for preparing BMMY culture medium.

a)500X B(0.02％Biotin)

20mg of biotin was dissolved in 100mL of ddH2O and sterilized by filtration and stored at 4 ℃. Can be stored for 1 year

b)10X M(5％methanol)

5mL of methanol was added to 95mL of ddH2O, and the mixture was sterilized by filtration, stored at 4 ℃ and allowed to stand for 2 months.

Preparing BMMY:

10g of yeast powder and 20g of peptone were dissolved in 700mL of H2O and autoclaved at 121 ℃ for 20 min.

Cooled to room temperature, and aseptically added 100mL of 1M potassium phosphate buffer, pH 6.0, 100mL of 10X YNB, 2mL of 500X B

SDS-PAGE electrophoresis buffer (5X)

Tris 15.1 g; 94g of glycine; 5g of SDS, adding deionized water to fully dissolve the SDS, and fixing the volume to 1L.

SDS-PAGE Loading buffer (5X)

1.25ml of 1M Tris-HCl (pH 6.8); 0.5g of SDS; BPB 25 mg; 2.5ml of glycerol; 2-ME 5%, adding deionized water to make the volume to 5 ml.

8. Coomassie brilliant blue staining solution

Coomassie Brilliant blue R-250,1 g; 450ml of methanol; glacial acetic acid 100 ml; 450ml of deionized water.

9. Decolorizing liquid

450ml of methanol; glacial acetic acid 100 ml; 450ml of deionized water.

10. Preparation of separating glue and concentrated glue

Example 1

1. Experimental reagent and instrument

1.1 Experimental reagents

Xho I, Not I and SacI restriction enzymes, available from Bao bioengineering (Dalian) Co., Ltd; DL2000 and DL5000DNA ladders, Taq DNA polymerase, KOF DNA polymerase,

one-step directed cloning kit (seamless cloning) from Novoprotein; CutSmart Buffer is available from Gittie Biotechnology, Inc.; plasmid Midi Preparation Kit (Plasmid Midi Preparation Kit) was purchased from Biyun sky; other conventional chemical reagents are domestic analytical pure reagents and are purchased from bio-engineering (Shanghai) GmbH. All primer synthesis and sequencing for this study was done by Shanghai Czeri bioengineering, Inc.

1.2 Experimental instruments

Gradient PCR amplification instrument (ThermoFisher), nucleic acid protein quantitative instrument (Thermo), desk centrifuge (Hunan Saite)

2. Experimental methods

2.1 obtaining the Gene of interest

Synthesizing a Slit2D2-HSA-His gene sequence (SEQ ID NO.2) by gene, and designing a primer ZSLLIT-F: 5'-GAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTTGCATTGTCCAGCAGCTTG-3' (SEQ ID NO.3)

The gene sequence between Xho I and Not I was amplified by ZSLIT-R: 5'-GAGATGAGTTTTTGTTCTAGAAAGCTGGCGGCCGCTTAATGATGATGATGGTGATG-3' (SEQ ID NO. 4).

The reaction system is as follows:

the PCR reaction conditions were as follows:

the PCR identification result is shown in FIG. 1, and the electrophoresis result shows that the obtained PCR fragment is consistent with the expected result.

2.2 seamless cloning

Selecting

The one-step directional cloning kit connects the target gene fragment with the vector pPICZaA (purchased from Invitrogen). The ligated plasmid was named pPICZaA-Slit2D2-HSA, and the map of the plasmid was shown in FIG. 2.

The specific method comprises the following steps:

A. and (3) selecting enzyme sites Xho I and Not I to carry out double enzyme digestion linearization on the pPICZaA vector.

B. The target DNA fragment and the linearized vector are cloned seamlessly in a certain molar ratio (see details in the description of the invention)

One-step directional cloning kit instructions).

C. After the completion of the seamless cloning reaction, the transformation was immediately carried out, and the remaining reaction solution was stored at 4 ℃ for future use.

2.2 Yeast recombinant plasmid transformation E.coli DH5a

1. A tube of 100 μ l e.coli DH5a competent cells was thawed on ice and the tube wall was flicked to resuspend the cells. Add 10. mu.l of the reaction to the competent cells, flick down, and incubate on ice for 45 minutes.

After heat shock in a water bath at 2.42 ℃ for 90 seconds, it was quickly placed on ice for 5 minutes.

3. Add 500. mu.l LB liquid medium and incubate at 37 ℃ for 45-60 minutes.

4.5000 g, the cells were collected by centrifugation for 3 minutes, and a predetermined amount of the cells were spread evenly on a Zeocin-containing plate containing 25ug/ml as needed, and cultured overnight.

2.3 PCR identification of recombinant plasmid transformed DH5a yeast colonies

The PCR reaction conditions were as follows:

detecting by 1% agarose gel electrophoresis, determining positive clone, performing amplification culture, and sequencing by Czech.

The PCR identification results are shown in FIG. 3, and the experimental results are in line with the expectations.

2.4 Yeast expression plasmid extraction with correct sequencing

Plasmid extraction Kit (Plasmid Midi Preparation Kit) from Biyunnan was selected for Plasmid extraction. The method comprises the following steps:

1. the overnight bacteria were put into 3 centrifuge tubes of 1.5ml, centrifuged at 5000g for 1 min to collect the bacterial pellet, and the supernatant was discarded. Repeat once more, collect 3 ml of overnight bacterial pellet per tube.

2. Add 250. mu.l of solution I per tube (RNase A had been added to solution I) and resuspend the bacterial pellet. Ensure that the precipitate is completely dispersed without visible clumps of bacteria.

3. Add 250. mu.l of solution II to each tube and gently invert the tube 4-6 times to allow complete lysis of the bacteria and the solution is clear.

4. 350 microliter of solution III is added into each tube, and the centrifuge tube is inverted 4-6 times to mix evenly, so that white floccule is generated.

5. Centrifugation was carried out at the highest speed (around 13,000 rpm) for 10 minutes at room temperature.

6. The supernatant from the previous step centrifugation is poured or sucked into a plasmid purification column. Centrifuging at the highest speed for 30-60 seconds, and pouring the liquid in the collecting tube. Repeat twice more to allow three tubes of plasmid to bind to the same purification column.

7. Adding 750 microliter of solution IV into the plasmid purification column, centrifuging at the highest speed for 30-60 seconds, washing off impurities, and pouring off the liquid in the collection tube.

8. Centrifuge at maximum speed for another 1 minute to remove residual liquid and completely volatilize trace ethanol.

9. The plasmid purification column was placed in a 1.5ml centrifuge tube, 120. mu.l of solution V was added to the cylindrical surface of the tube, and left for 1 minute.

10. Centrifuging at the highest speed for 1 min, adding 600 microliters of solution VI into the obtained liquid, mixing uniformly, and adding into a raw plasmid purification column.

11. Centrifuging at the highest speed for 30-60 seconds, and pouring the liquid in the collecting tube.

12. Adding 750 microliter of solution IV into the plasmid purification column, centrifuging at the highest speed for 30-60 seconds, washing off impurities, and pouring off the liquid in the collection tube.

13. Centrifugation was carried out for a further 1 minute at maximum speed to remove residual liquid and completely volatilize traces of ethanol.

14. The plasmid purification column was placed in a 1.5ml centrifuge tube, 120. mu.l of solution V was added to the cylindrical surface of the tube, and left for 1 minute.

15. And centrifuging at the highest speed for 1 minute to obtain the liquid, namely the cell-transfer-grade ultrapure plasmid.

2.5 plasmid linearization for correct sequencing

The plasmid was linearized using Sac I. The linearization system is as follows:

overnight at 37 ℃.

2.6 electrotransformation of Yeast X33

200ul yeast competent cells X33 were taken, 20ul linearized plasmid was added, mixed and transferred to an electric rotor (d ═ 0.2cm), placed on ice for several minutes, put into an electric rotor for electric shock (voltage: 1680V, electric shock time: 5ms), after electric shock, 1ml 1M D-sorbitol was immediately added, gently blown several times, the yeast after electric conversion was pipetted into a 1.5ml EP tube, and placed on ice for several minutes. The EP tube was incubated at 30 ℃ for 1 hour in an incubator and then plated on YPDZ plates and incubated at 30 ℃ for 3 days.

2.7 Yeast X33 expression Strain high copy selection

High copy screening is carried out by using a high-concentration Zeocin antibiotic plate, colonies on the low-concentration Zeocin plate are collected and coated on the high-concentration Zeocin plate, the concentration of the Zeocin is respectively 200, 400, 600 and 800ug/ml, and the colonies are cultured for 3 days at 30 ℃. And selecting the clone on the plate with the highest zeocin concentration, culturing, extracting a yeast genome and identifying the positive yeast strain.

2.8 Positive Yeast Strain identification

2.8.1 Yeast genome extraction

And after the monoclone is picked to be cultured in a centralized way for about 24 hours, taking 1ml of bacterial liquid for preserving the seeds. Another 1ml of the bacterial solution was put into a 1.5ml EP tube, the cells were collected by centrifugation, resuspended in 200ul of TE Buffer, added with 1% (V/V) β -mercaptoethanol and 1% (V/V) proteinase K, and digested in a 50 ℃ water bath for about 3 hours with shaking occasionally. 200ul chloroform and 200ul phenol were added and vortexed for several seconds. Centrifuging at 12000rpm for 5min, carefully sucking the upper liquid, adding 2 times volume of absolute ethyl alcohol, precipitating and recovering.

2.8.2 PCR identification of Yeast genome

And (3) selecting an alpha-factor and 3' AOX universal primer for identification. The reaction system is as follows:

the PCR reaction conditions were as follows:

the results of the PCR positive identification are shown in FIG. 4, and the results are in agreement with the expectations.

2.9 methanol inducible expression

Selecting 5 positive monoclonals, performing amplification culture at 30 ℃ in 20-30ml YPD medium, centrifuging for 5min when OD grows to 2-6, discarding the medium, re-suspending with BMMY medium, and adjusting OD to about 10. The culture was continued for 72h and induced expression was performed by adding 1% (V/V) methanol every 24 h. The host bacteria transformed in the empty state were used as a negative control. Collecting the supernatant of the fermentation liquid, performing ultrafiltration concentration, and performing SDS-PAGE and Anti-His western blot analysis.

The results of SDS-PAGE and Western blot are shown in FIG. 5 and 6, respectively.

The experimental result shows that the expression quantity of the No.3 strain is higher, and the No.3 strain is selected as a seed strain to carry out seed preservation and supernatant protein purification at the same time. Through quantitative detection, the expression quantity of the No.3 strain is improved by about 5 to 10 times compared with other positive clones, and the method has relatively less foreign protein and higher purification yield. Strain number 3 has the accession number CCTCCM 2016246.

2.10 Ni column purification

The yeast secretion supernatant was purified by SFF (Ni) affinity chromatography column (5ml) with the following specific steps:

1. equilibrium gel medium: the column was equilibrated with 10 column volumes of Buffer A (20mM Tris,250mM NaCl,10mM MIDdazole, pH 8.0);

2. adding yeast secretion supernatant into a purification column;

3. adjusting the nucleic acid protein detector to adjust the flow rate to 2 mg/ml;

4. draining the buffer in the column, and collecting flow-through liquid;

5. washing the column with 5 column volumes of equilibration buffer;

6. adjusting the flow rate to 1 mg/ml; gradient elution was carried out with eluents (20mM Tris,250mM NaCl,500mM Imidazole, pH8.0) of different Imidazole concentrations (50mM, 500 mM). Eluting the impure protein and collecting fractions;

7. after the protein purification was complete, the column was equilibrated with equilibration Buffer A for 20min, the liquid was drained, and finally the column was washed with 20% ethanol.

The protein purification results are shown in fig. 7; the final product test results are shown in fig. 8.

3. In vitro activity test-Transwell tumor in vitro metastasis model establishment

Tumor cells were digested and broken up, 15,000 cells were added to the upper layer of the transwell chamber in a total volume of 100ul, without serum, each group containing different concentrations of drug, three in parallel. 600ul of medium containing 10% serum was added to the lower chamber layer and SDF1 was added to a final concentration of 10nM, except for the lower NC group, which had no SDF1, and all groups. After 24 hours the chamber was fixed with 4% paraformaldehyde, then the cells of the upper membrane were gently wiped off and the cells of the lower membrane were stained with DAPI. The stained cells of the lower membrane were photographed under a fluorescent microscope, and 5 fields of view, 20X objective, were randomly selected for each chamber. The number of cells in each photograph was counted. An HSA negative control group, a Slit2D2-HSA/HEK-293 (the protein is expressed by HEK-293 cells) positive control group and a Slit2D2-his/HEK-293 (the protein is expressed by HEK-293 cells) positive control group are arranged, and the following cell lines are detected in vitro to obtain breast cancer: MCF-7/ADR (from ATCC), MDA-MB-231 (from ATCC); liver cancer SMMC7721 (purchased from ATCC). And detecting the in vitro anti-tumor migration activity of the slit2D2-HSA protein expressed by the yeast expression system.

The experimental results are shown in fig. 9, 10 and 11, and the results show that the slit2D2-HSA protein expressed by yeast has obvious activity of inhibiting tumor migration, and has no significant difference in activity with the protein expressed by mammalian cells. The slit2D2-HSA active protein can be expressed, produced and prepared by a yeast system with lower production cost.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims (11)

1. The fusion protein is characterized in that the fusion protein is amino as shown in SEQ ID NO. 1

A polypeptide of sequence.

2. An isolated codon-optimized polynucleotide encoding the fusion protein of claim 1; and the polynucleotide is shown as SEQ ID NO. 2.

3. An expression vector comprising the polynucleotide of claim 2.

4. A host cell comprising the expression vector of claim 3 or having integrated in its genome the polynucleotide of claim 2, wherein said host cell is not a plant cell.

5. The host cell of claim 4, wherein the host cell is a yeast cell.

6. The host cell of claim 4, wherein the host cell is a yeast cell strain with a collection number of CCTCC M2016246.

7. A method of making the fusion protein of claim 1, comprising the steps of:

culturing the cell of claim 4 under conditions suitable for expression, thereby expressing the fusion protein of claim 1; and isolating the fusion protein.

8. A pharmaceutical composition comprising the fusion protein of claim 1, the polynucleotide of claim 2, or the expression vector of claim 3, or the host cell of claim 4, and a pharmaceutically acceptable carrier and/or adjuvant.

9. Use of the fusion protein according to claim 1 for the preparation of a medicament for the treatment or prevention of tumors.

10. The use according to claim 9, further comprising the use for the preparation of a medicament for the treatment or prevention of tumor metastasis.

11. The use according to claim 10, wherein the tumor is selected from the group consisting of: gastric cancer, liver cancer, leukemia, kidney tumor, lung cancer, small intestine cancer, bone cancer, prostatic cancer, colorectal cancer, breast cancer, large intestine cancer, prostatic cancer, cervical cancer, adrenal gland tumor, or bladder tumor.

Images