CN104650206A - Functional proteins serving as target spots for medicinal development - Google Patents
Functional proteins serving as target spots for medicinal development Download PDFInfo
- Publication number
- CN104650206A CN104650206A CN201410446543.6A CN201410446543A CN104650206A CN 104650206 A CN104650206 A CN 104650206A CN 201410446543 A CN201410446543 A CN 201410446543A CN 104650206 A CN104650206 A CN 104650206A
- Authority
- CN
- China
- Prior art keywords
- numb
- mon1b
- cell
- nsf
- corpusculum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43577—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from flies
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Insects & Arthropods (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a group of functional proteins serving as target spots for medicinal development. The functional proteins are Numb, Mon1b and NSF; the Numb, the Mon1b or the NSF is taken as the target spot to develop medicines for treating diseases caused by abnormal early endosome fusion. A time delay experiment proves that when the Numb gene is deleted, the paired early endosomes are accumulated together without being abutted and fused with each other, and therefore, the Numb is an endosome abutting control factor. An in-vitro experiment proves that the Numb functions by use of the intracellular factor Mon1b, the Mon1b is capable of bonding with the NSF and Syntaxins, and meanwhile, the overexpression of the Mon1b and the NSF is capable of promoting membrane fusion, and the process depends on the SNARE mechanism.
Description
Technical field
The present invention relates to course of drug development, particularly relate to one group as target spot for the functional protein in drug development.
Background technology
Film merges the process almost relating to each cell, and as vesicle transport, exocytosis and cynapse transmission, this process relates to some protein moleculars as NSF, a-SNAP and SNARE mixture (comprising syntaxins, SNAP-25 and VAMP).Syntaxins and SNAP-25 is positioned on target film, is called as t-SNARE or Q-SNARE, and VAMP is positioned on transhipment vesica film, is called as V-SNARE or R-SNARE.In the process that film merges, R-SNARE and Q-SANRE of homology forms a four-helix bundle, is called as " trans "-SNARE complex body.NSF molecule is combined on " trans "-SNARE complex body by-SNAP subsequently, and the energy utilizing ATP to be hydrolyzed dismantles " trans "-SNARE complex body, thus the film carrying out a new round merges.
Numb molecule is the inherent determinative that first of asymmetric cell fate determines, its sudden change can make fruit bat peripheral nervous system can not form most of sensory nerve.Gene containing two homologies in zooblast is respectively
numbwith
numblike.At different cell processes, as the maintenance of asymmetric cell fission, cytodifferentiation, migration, stem cell activation, Adherens Junctions, tissue regeneration, tumour Numb in beta amyloid precursor protein (APP) cracking relevant with even Alzheimer occur and play distinct effect.
numbgene has 4 main alternative splicing sites at least, and then the protein-Numb65,66,71 and 72 that generation 4 kinds is different, has five kinds of Numb albumen altogether together with Numblike.Numb65,66 and Numblike is many expresses at noble cells, and Numb71 and 72 expresses mostly in proliferative cell.By inference, Numb65,66 and Numblike promote cytodifferentiation, and Numb71 and 72 promote cell proliferation.Different Numb protein localizations, in different subcellular organelles: Numb65,71 and Numblike is mostly positioned tenuigenin and Numb66 and 72 is mainly positioned film, shows that different hypotypes has different functions.It is found that recently, Numb participate in organoid endocytic processes and take part in many clathrins according to or many important molecule endocytosis transport processes of non-dependent, as the transhipment of Notch, EGFR EGF-R ELISA, Transferrins,iron complexes, integrin, N-cadherin, CAM 120/80, L1, cholesterol etc.Genetic evidence shows, after asymmetric cell fission, Numb contributes to determining two sub-cell destiny by antagonism Notch signal.A nearest research shows, Numb or by promoting the degraded that its lysosome relies on, or reduces it and be recovered to blood plasma to suppress Notch active.Numb also can carry out antagonism Notch signal by the transhipment of the membranin sanpodo promoting fruit bat.These discoveries show, Numb suppresses Notch signal to realize by regulating intracellular transport mode.In addition, Numb control APP intracellular transport and the dependent cutting mode of mediation hypotype, thus relate to the pathogeny of APP metabolism and Alzheimer.
Summary of the invention
The technical problem that the present invention mainly solves is to provide one group as target spot for the functional protein in drug development, can carry out drug development be used for the treatment of disease as target spot.
For solving the problems of the technologies described above, the technical scheme that the present invention adopts is: provide one group as target spot for the functional protein in drug development, described functional protein is Numb, Mon1b and NSF, carry out drug development using described Numb, Mon1b or NSF as target spot, be used for the treatment of corpusculum abnormal fusion in early stage born of the same parents and the disease caused.
In a preferred embodiment of the present invention, described Numb is the upstream regulatory factor that described Mon1b and described NSF regulate and control that in early stage born of the same parents, corpusculum (EEs) merges, and described Mon1b and described NSF is played a role by SNARE in EEs merges.
In a preferred embodiment of the present invention, described Numb and described Mon1b interacts, and described Mon1b dissociates from cis-SNARE the recycle of described NSF, control SNARE, thus the fusion of corpusculum in regulation and control born of the same parents.
In a preferred embodiment of the present invention, described Numb can promote the fusion of corpusculum in early stage born of the same parents, and described Numb is the regulatory factor in early stage born of the same parents in corpusculum docking operation.
In a preferred embodiment of the present invention, the Numb 65 in described Numb and Numb 71 regulates and controls the fusion of corpusculum in early stage born of the same parents, and the sequence of described Numb 65 is:
MNKLRQSFRRKKDVYVPEASRPHQWQTDEEGVRTGKCSFPVKYLGHVEVDESRGMHICEDAVKRLKATGKKAVKAVLWVSADGLRVVDEKTKDLIVDQTIEKVSFCAPDRNFDRAFSYICRDGTTRRWICHCFMAVKDTGERLSHAVGCAFAACLERKQKREKECGVTATFDASRTTFTREGSFRVTTATEQAEREEIMKQMQDAKKAETDKIVVGSSVAPGNTAPSPSSPTSPTSDATTSLEMNNPHAIPRRHAPIEQLARQGSFRGFPALSQKMSPFKRQLSLRINELPSTMQRKTDFPIKNAVPEVEGEAESISSLCSQITNAFSTPEDPFSSAPMTKPVTVVAPQSPTFQGTEWGQSSGAASPGLFQAGHRRTPSEADRWLEEVSKSVRAQQPQASAAPLQPVLQPPPPTAISQPASPFQGNAFLTSQPVPVGVVPALQPAFVPAQSYPVANGMPYPAPNVPVVGITPSQMVANVFGTAGHPQAAHPHQSPSLVRQQTFPHYEASSATTSPFFKPPAQHLNGSAAFNGVDDGRLASADRHTEVPTGTCPVDPFEAQWAALENKSKQRTNPSPTNPFSSDLQKTFEIEL,The sequence of Numb described 71 as follows:
MNKLRQSFRRKKDVYVPEASRPHQWQTDEEGVRTGKCSFPVKYLGHVEVDESRGMHICEDAVKRLKAERKFFKGFFGKTGKKAVKAVLWVSADGLRVVDEKTKDLIVDQTIEKVSFCAPDRNFDRAFSYICRDGTTRRWICHCFMAVKDTGERLSHAVGCAFAACLERKQKREKECGVTATFDASRTTFTREGSFRVTTATEQAEREEIMKQMQDAKKAETDKIVVGSSVAPGNTAPSPSSPTSPTSDATTSLEMNNPHAIPRRHAPIEQLARQGSFRGFPALSQKMSPFKRQLSLRINELPSTMQRKTDFPIKNAVPEVEGEAESISSLCSQITNAFSTPEDPFSSAPMTKPVTVVAPQSPTFQGTEWGQSSGAASPGLFQAGHRRTPSEADRWLEEVSKSVRAQQPQASAAPLQPVLQPPPPTAISQPASPFQGNAFLTSQPVPVGVVPALQPAFVPAQSYPVANGMPYPAPNVPVVGITPSQMVANVFGTAGHPQAAHPHQSPSLVRQQTFPHYEASSATTSPFFKPPAQHLNGSAAFNGVDDGRLASADRHTEVPTGTCPVDPFEAQWAALENKSKQRTNPSPTNPFSSDLQKTFEIEL。
In a preferred embodiment of the present invention, the sequence of described Mon1b is:
MEVGGDTAAPAPGGAEDLEDTQFPSEEAREGGGVHAVPPDPEDEGLEETGSKDKDQPPSPSPPPQSEALSSTSRLWSPAAPENSPTCSPESSSGGQGGDPSDEEWRSQRKHVFVLSEAGKPIYSRYGSVEALSATMGVMTALVSFVQSAGDAIRAIYAEDHKLVFLQQGPLLLVAMSRTSQSAAQLRGELLAVHAQIVSTLTRASVARIFAHKQNYDLRRLLAGSERTLDRLLDSMEQDPGALLLGAVRCVPLARPLRDALGALLRRCTAPGLALSVLAVGGRLITAAQERNVLAECRLDPADLQLLLDWVGAPAFAAGEAWAPVCLPRFNPDGFFYAYVARLDAMPVCLLLLGTQREAFHAMAACRRLVEDGMHALGAMRALGEAASFSNASSASAPAYSVQAVGAPGLRHFLYKPLDIPDHHRQLPQFTSPELEAPYSREEERQRLSDLYHRLHARLHSTSRPLRLIYHVAEKETLLAWVTSKFELYTCLSPLVTKAGAILVVTKLLRWVKKEEDRLFIRYPPKYSTPPATSTDQAAHNGLFTGL。
In a preferred embodiment of the present invention, the sequence of described NSF is:
MAGRSMQAARCPTDELSLTNCAVVNEKDFQSGQHVIVRTSPNHRYTFTLKTHPSVVPGSIAFSLPQRKWAGLSIGQEIEVSLYTFDKAKQCIGTMTIEIDFLQKKSIDSNPYDTDKMAAEFIQQFNNQAFSVGQQLVFSFNEKLFGLLVKDIEAMDPSILKGEPATGKRQKIEVGLVVGNSQVAFEKAENSSLNLIGKAKTKENRQSIINPDWNFEKMGIGGLDKEFSDIFRRAFASRVFPPEIVEQMGCKHVKGILLYGPPGCGKTLLARQIGKMLNAREPKVVNGPEILNKYVGESEANIRKLFADAEEEQRRLGANSGLHIIIFDEIDAICKQRGSMAGSTGVHDTVVNQLLSKIDGVEQLNNILVIGMTNRPDLIDEALLRPGRLEVKMEIGLPDEKGRLQILHIHTARMRGHQLLSADVDIKELAVETKNFSGAELEGLVRAAQSTAMNRHIKASTKVEVDMEKAESLQVTRGDFLASLENDIKPAFGTNQEDYASYIMNGIIKWGDPVTRVLDDGELLVQQTKNSDRTPLVSVLLEGPPHSGKTALAAKIAEESNFPFIKICSPDKMIGFSETAKCQAMKKIFDDAYKSQLSCVVVDDIERLLDYVPIGPRFSNLVLQALLVLLKKAPPQGRKLLIIGTTSRKDVLQEMEMLNAFSTTIHVPNIATGEQLLEALELLGNFKDKERTTIAQQVKGKKVWIGIKKLLMLIEMSLQMDPEYRVRKFLALLREEGASPLDFD。
In a preferred embodiment of the present invention, corpusculum abnormal fusion in described early stage born of the same parents and the disease caused is tumour and nerve degenerative diseases.
In a preferred embodiment of the present invention, described nerve degenerative diseases is alzheimer's disease, Parkinson's disease, Huntington's disease.
The invention has the beneficial effects as follows: the gene be used for as target spot in drug development of the present invention, with described Numb, Mon1b or NSF carries out drug development as target spot, be used for the treatment of corpusculum abnormal fusion in early stage born of the same parents and the disease caused, tenuigenin Numb albumen is recruited endochylema Mon1b as a kind of novel regulatory factor and is navigated on the vesica in EEA1 front, to dissociate lower NSF from SNARE complex body, SNARE complex body is made to recover original state, the film of a further unlatching new round merges, imply that Numb can control multiple key node, as endocytosis, reclaim and degraded fine adjustment signal in the intensity of various physiological process and time length.
Accompanying drawing explanation
In order to be illustrated more clearly in the technical scheme in the embodiment of the present invention, below the accompanying drawing used required in describing embodiment is briefly described, apparently, accompanying drawing in the following describes is only some embodiments of the present invention, for those of ordinary skill in the art, under the prerequisite not paying creative work, other accompanying drawing can also be obtained according to these accompanying drawings, wherein:
Fig. 1 is the lysate immuning hybridization result of the MCF7A cell of transfection, and wherein the expression level of Numb and Actin albumen as shown in the figure.
Fig. 2 verifies the validity of Numb gene inhibition and specific figure by fluorescence quantifying PCR method.
Fig. 3 is the gathering situation of the EEs of contrast and the downtrod MCF7A cell of Numb genetic expression, and right side is the Nonlinear magnify in the square frame of left side.
Fig. 4 is the quantitative statistics figure of EEs in contrast and the suppressed cell of Numb.
Fig. 5 is the quantitative statistics figure of EEs in contrast and the suppressed cell of Numb.
Fig. 6 is contrast and Numb genetic expression downtrod MCF7A cell Rab5 antibody hybridization colored graph.
Fig. 7 is the median size figure of corpusculum in the positive born of the same parents of Rab5.
Fig. 8 is contrast and Numb genetic expression downtrod MCF7A cell HGS antibody hybridization colored graph.
Fig. 9 is the chart of percentage comparison of corpusculum in the positive born of the same parents of HGS.
Figure 10 is the grain size distribution of corpusculum in the positive born of the same parents of Rab5.
The result figure that Figure 11 is control experiment group, the MCF7A cell antibody EEA1 of Numblike genetically deficient dyes, square frame is the effect that regional area amplifies.
The result figure that Figure 12 is control experiment group, the MCF7A cell Rab5 of Numblike genetically deficient dyes, square frame is the effect that regional area amplifies.
The result figure that Figure 13 is control experiment group, the MCF7A cell HGS of Numblike genetically deficient dyes, square frame is the effect that regional area amplifies.
Figure 14 is the concrete statistic data result figure of Figure 11.
Figure 15 is the concrete statistic data result figure of Figure 12.
Figure 16 is the concrete statistic data result figure of Figure 13.
Figure 17 is the distribution situation figure of EEs in electron microscopic observation contrast and the downtrod MCF7A cell of Numb genetic expression.
Figure 18 is after the MCF7A cell internalizing Dil-LD of contrast, Numb KD and Numblike KD, observes the fusion situation map of corpusculum in born of the same parents by micro-imaging viewing system.
Figure 19 be contrast, Numb KD and Numblike KD the MCF7A cell Dil-LDL positive born of the same parents in the chart of percentage comparison of corpusculum.
Figure 20 is that the MCF7A cell of contrast and Numb disappearance expresses Rab-RFP albumen, Real-time Collection figure afterwards respectively.
Figure 21 is the quantitative statistics figure of corpusculum generation integration percentage in early stage born of the same parents.
Figure 22 be the Rab5-RFP positive born of the same parents in the ratio of corpusculum in MCF7A cell within the scope of different distance.
Figure 23 is in MCF7A cell, in the cell of contrast and Numb genetically deficient Rab5-RFP born of the same parents in the distribution range of corpusculum distance.
Figure 24 is in HEK293T cell, in the cell of contrast and Numb genetically deficient Rab5-RFP born of the same parents in the distribution range of corpusculum distance.
Figure 25 expresses the MCF7A cell anti-EEA1 antibody labeling dyeing of GFP, GFP-Numb 65, GFP-Numb 66, GFP-Numb 71, GFP-Numb 72 and GFP-Numblike respectively.
Figure 26 is the outer observation and analysis bubbles coalesce figure of born of the same parents.
Figure 27 is fluorescence results figure different under 4 DEG C or 37 DEG C of reaction conditionss; b
Figure 28 is after reaction in 40 minutes, records the average quantity of certain area internal labeling vesicle in the reaction that contrast and Numb lack.
Figure 29 is under 37 DEG C of conditions after bubbles coalesce 40min, measures the size containing transferrin-555 vesicle, compares the Number and size distribution figure of vesicle in differential responses.
Figure 30 is that MCF7A lysate carries out immuning hybridization figure.
Figure 31 is the mutant forms figure that Myc-Numb71 is different.
Figure 32 expresses the HEK293T cell pyrolysis liquid of GFP-Mon1a/b and the immuning hybridization result figure of different Myc-Numb71 mutant.
Figure 33 is contrast and Numb KD MCF7A cell expressing Rab5-RFP, uses Mon1a hybridization check result figure afterwards.
Figure 34 is that contrast and Numb KD MCF7A cell anti-Mon1b and anti-EEA1 dye altogether, quantitatively schemes Mon1b positive cell.
Figure 35 is Mon1a antibody staining result figure in the cell of contrast and Numb genetically deficient.
Figure 36 is the individual scale map of the Mon1a positive in cell.
Figure 37 is after MCF7A and HEK293T Cells Depletion Numb gene, uses Mon1b antibody staining, and in the born of the same parents of its positive, the ratio of corpusculum is as figure statistics.
Figure 38 shows the MCF7A cell expressing Mon1a-GFP of contrast Numb KD or the immuning hybridization result figure of Mon1a-Myc albumen.
Figure 39 is the detection by quantitative figure of Mon1a-GFP in contrast and Numb KD cell.
Figure 40 is the detection by quantitative of Mon1a-Myc in contrast and Numb KD cell.
Figure 41 is contrast and Numb KD MCF7A cell expressing Rab5-RFP, uses Mon1b hybridization check result figure afterwards.
Figure 42 is contrast and Numb KD MCF7A cell expressing Rab5-RFP, uses Mon1a hybridization check, the count detection result figure of Mon1a.
Figure 43 is contrast and Numb KD MCF7A cell expressing Rab5-RFP, uses Mon1b hybridization check, the count detection result figure of Mon1b.
Figure 44 is the corresponding gene of MCF7A cell transfecting and with to antibody test result figure.
Figure 45 is that MCF7A cell pyrolysis liquid is for immuning hybridization detection figure.
Figure 46 is that the MCF7A cell anti-EEA1 of contrast and Mon1a disappearance hybridizes staining examine result figure.
Figure 47 is that the MCF7A cell anti-EEA1 of contrast and Mon1b disappearance hybridizes staining examine result figure.
Figure 48 is that contrast and Mon1a lack or Mon1b lacks MCF7A cell anti-EEA1 hybridization dyeing, carries out quantitative analysis in the drawings.
Figure 49 is that contrast and Mon1a lack or Mon1b lacks MCF7A cell internalizing Dil-LDL, observes the result figure that in born of the same parents, corpusculum merges afterwards with micro imaging system.
Figure 50 is that contrast and Mon1a lack or Mon1b lacks MCF7A cell internalizing Dil-LDL, observes corpusculum in born of the same parents afterwards and merges, see Figure 49 with micro imaging system, and the concrete figure of analysis further.
Figure 51 is MCF7A cell expressing Numb or the Numblike albumen of contrast and Mon1b disappearance, with EEA1 antibody staining figure.
Figure 52 is the statistics figure of Figure 51.
Figure 53 is the immuning hybridization result figure of HEK293T cell pyrolysis liquid.
Figure 54 is MCF7A cell anti-Myc and anti-HA antibody test and image.
Figure 55 is that contrast lacks the different carrier of HEK293T cell transfecting with Numb, and transfection is after 1 day, and cell pyrolysis liquid is used for the figure of immunodetection.
Figure 56 is contrast, the HEK293T cell of Numb KD and Mon1b KD obtains corpusculum in born of the same parents by high speed centrifugation, and the further cracking of precipitation containing corpusculum in born of the same parents after removing supernatant also carries out co-immunoprecipitation analysis.
Figure 57 is HEK293T cell transfecting Myc-NSF, and after transfection 36h, collecting cell also carries out co-immunoprecipitation analytical results figure.
Figure 58 is MCF7A cell cotransfection Myc-NSF and GFP or GFP-Mon1b, detects image after transfection 36h with anti-Myc.
Figure 59 be contrast and Mon1b process LAN HEK293T cell in, with anti-EEA1 antibody be separated after for immuning hybridization detect scheme.
Figure 60 is the different carrier of MCF7A transfection, and two days later, with EEA1 and Myc antibody test, in born of the same parents, the size of corpusculum represents in the drawings.
Figure 61 is the different carrier of MCF7A transfection, and transfection is after one day, the tetracycline screening 36h of cell 2ug/ml, collects afterwards, cracking carry out immuning hybridization figure.
Figure 62 is the different shRNAi of MCF7A cell transfecting, within 1 day, selects positive cell, after removing floating cells afterwards with 2ug/ml tetracycline screening 36h, by attached cell cotransfection GFP-Mon1b and Myc-NSF, transfection, after 2 days, with EEA1 and Myc antibody test, detects EE size in the drawings.
Figure 63 is contrast and the different carrier of Numb KD MCF7A cell transfecting, and transfection is after 2 days, cell EEA1 and Myc antibody test result figure.
Figure 64 be model set forth Numb and Mon1b be how to participate in and regulate and control corpusculum film in born of the same parents merge in the process recycling of SNARE complex body.After film merges, NSF is loaded on cis-SNARE complex body, under ATPase participates in, start the depolymerization of cis-SNARE complex body, once cis-SNARE completes depolymerization, under the help of Numb albumen, Mon1b is recruited from kytoplasm to be attached on SNARE-NSF complex body, thus is disintegrated down from complex body by NSF.The NSF disintegrated down and then participate in the cis-SNARE depolymehzation process of a new round.In film merges, the NSF of this dependence Numb and Mon1b dissociates and recycling process keeps the conversion of cis-SNARE and trans-SNARE two kinds of conformations to be vital for SNARE.
Embodiment
Be clearly and completely described to the technical scheme in the embodiment of the present invention below, obviously, described embodiment is only a part of embodiment of the present invention, instead of whole embodiments.Based on the embodiment in the present invention, those of ordinary skill in the art, not making other embodiments all obtained under creative work prerequisite, belong to the scope of protection of the invention.
In the examples below, the experiment material related to and experimentation have:
(1) vector construction and RNA interference
All carriers of Numb, NumbLike, Mon1A and Mon1B of expressing are all by being cloned into pcDNA3.1-Myc(Invitrogen by the full length sequence of corresponding gene) or pEGFP-C2(Clontech) carrier obtain.RFP-Rab5 expression vector is purchased from Addgene(plasmid 14437).Myc-Rab5 expression vector is by Rab5 fragment in the plasmid of buying is cloned into pcDNA3.1-Myc(Invitrogen) carrier and obtaining.MYC-NSF, MYC-α SNAP, MYC-STX13, FLAG-STX13, HA-STX6 and MYC-VAMP4 expression vector is obtained to pcDNA3.1-Myc, pcDNA3.1-HA or pcDNA3.1-Flag by corresponding gene fragment clone.For Numb gene silencing (Cat No. RHS4696-99359228 and RHS3979-9576173),
numblikegene silencing (Cat No. RHS3979-97052327),
mon1bthe shRNA of gene silencing (Cat No. RHS3979-9627154 and RHS3979-9627156) is from the open biological platform buying of Thermo, shRNA for Mon1a gene silencing has two, pGIPZMon1a (Cat No. RHS4430-101107193) buying biological platform open with Thermo, another one pLKO.1-Mon1a is experimental construction (target sequence is GTGCCATCCATAAGCTGATGC).For knock out the shRNA of syntaxin 6, syntaxin 13 and vamp 4 be laboratory build, concrete target sequence is syntaxin 6:GCAGGCATTAGCTGAAAGAAA; Syntaxin 13:CGAGCTGCTTACTATCAGAAA; Vamp 4:ACTAGATGAACTACAGGACAA;
(2) cell cultures and transfection
MCF-7A cell is cultivated in containing the RPMI-1640 substratum of 10 % (vol/vol) foetal calf serum, adds penicillin and the 100 units/ml spectinomycins of 100 units/ml, temperature 37 DEG C, CO simultaneously
2concentration 5%.HEK293T, Cos7 and primary MEF cell is cultivated in Dulbecco modified Eagle medium (DMEM) substratum, adds 10% FBS, 2mM glutamine, 1mM Sodium.alpha.-ketopropionate and 4500mg/L glucose.Plasmid DNA transfection adopts Megtran1.0 (Origene) reagent, gathers in the crops and detect after the cell transfecting 36h after transfection.MCF-7A, HEK293T and Cos7 cell of expressing different shRNAs utilizes the puromycin of 5ug/ml to screen 2-3 week after transfection.
(3) antibody
Resist of Numb (2756S) rabbit purchases from Cell Signaling more, Numb (MAB4338) mouse monoclonal antibody comes from R & D platform, Rab5 (3547S) and Myc (2276S) antibody are purchased from Cell Signaling, and the how anti-2411S of rabbit of EEA1 and mouse monoclonal antibody ab70521 is respectively purchased from Cell signaling and Abcam.HGS antibody (H00009146-M01) purchased from Abnova, Mon1B antibody NBP1-92131,17638-1-AP respectively purchased from Novus and Proteintech.Tag antibody (ANT146) is purchased from PROSPEC.HA antibody (MMS-101p) is purchased from Covance.GFP (75-131) antibody is from NeuroMab.Actin antibody (sc47778) and aSNAP antibody (sc48349) are purchased from Santa Cruz.NSF (3924) and Syntaxin 6 (2869) antibody are purchased from Cell Signaling.Syntaxin 13 (14259-1-AP) and Vti1A (12354-1-AP) is purchased from Proteintech.Mon1A is that Dr. Fudi Wang (nutrition science institute of the Chinese Academy of Sciences) gives.
(3) immuning hybridization fluorescence operation
All cell lysates in different experiments with to antibody 4 DEG C hatch 1.5 hr, embed 1h with protein A/G-Sepharose beads afterwards, immunoprecipitation complex is by carrying out Western blotting detection with corresponding antibody after SDS-PAGE electrophoresis.Numb, Myc, GFP, Flag, HA, Mon1b, Rab5, Syntaxin 6, Syntaxin 13, Vti1A, NSF, α SNAP use with after 1:1000 dilution, use after Actin antibody 1:5000 dilutes.The method of co-IP is used to detect the behavioural characteristic of SNARE complex body in corpusculum in early stage born of the same parents.MCF-7A is at 10-cm slat chain conveyor, and grow to 80% confluence, collects afterwards, with homogenisation buffer (250mM sucrose, 3mM imidazoles, pH are 7.2), at 4 DEG C, 3000g, 5 min are centrifugal, stoning and fragment, by 4 DEG C, centrifugal 30 min obtain material near perikaryons to 160000g, use 300 ul lysate (20mM Tris afterwards, 150mM NaCl, 1mM EDTA, 1%NP40, PH7.4) cracking, afterwards for experiment.
Immuning dyeing method is as follows: at room temperature, cell fixes 10 minutes in 3.7% formaldehyde, with PBS wash buffer 3 limit containing 0.1% Triton X-100, at room temperature 2h is hatched afterwards with corresponding antibodies, at room temperature resist with two after flushing and hatch 1h, two anti-markers are lexa Fluor 488 or Alexa Fluor 555 (Invitrogen).
For the immunostaining of HGS, Mon1a and Mon1b, before fixing with formaldehyde, use ice bath 30s.Numb, Mon1a, Mon1b, HGS antibody is with 1:100 dilution proportion, and EEA1, Rab5, HGS antibody is with EEA1, Rab5, HGS dilution proportion, and Anti-Myc antibody is with 1:1000 dilution proportion.
(4) art vitro vesicle fusion experiment
Contrast MCF7A and Numb KD MCF7A cell and Transferrins,iron complexes-488 or Transferrins,iron complexes-555 and hatch 5min altogether at 37 DEG C, all perikaryon materials from contrast contrast MCF7A and Numb KD MCF7A cell and cytosol, combine according to experimental design, image is obtained by Zeiss 510 confocal fluorescent microscope, with AutoQuant X software (Imaris, Bitplane) software, image is processed.Vesicle volume size ImageJ software software measurement.Observe for viable cell, MCF-7A is planted on the culture dish of 35-mm, afterwards transfection Rab5-RFP, or at 37 DEG C, hatches 3min with Transferrins,iron complexes, or at 37 DEG C, hatches 5min with 10ug/ml Di-LDL.Cell, with after substratum cleaning, uses Nikon ECLIPSE TE200 microscope imaging, 100 × oily sem observation afterwards.
(5) Electronic Speculum detects
First cell is cleaned gently with PBS damping fluid, at 4 DEG C, 4h is fixed with the phosphoric acid buffer that glutaraldehyde, the pH containing 2.5% is 7.3, in ice bath, 1h is hatched afterwards with the perosmic anhydride of 2%, with the uranyl acetate dyeing of 2%, serial dehydration in ethanol-acetone, Gum Rosin is embedded wherein, cuts into slices with Ultracut-R slicing machine (Leica, Germany).Hitachi H-7650 microscope is utilized to obtain image.
(6) in born of the same parents in early stage, corpusculum is separated
MCF7A and HEK293T cell with grinding bead grinding, adds proteinase inhibitor in advance in damping fluid (250 mM glucose, 3 mM imidazoles, 1 mM EDTA, pH are 7.4) in damping fluid.Perikaryon inclusion obtains (10 min, 700g and 30 min, 17000g) by continuously centrifuged, and the EEs in perikaryon is separated by the hybridization of EEA1 antibody mediated immunity.
(7) endocytosis analysis
First cell is cultured to 50000 cells/well, and the LDL (Invitrogen) marked with 50 μ g/ml Alex Fluor 488/555-Transferrin (Invitrogen) or 10 μ g/ml Dil afterwards hatches 15min altogether at 4 DEG C.Rinse 3 times with the PBS of precooling, following cell to go in the substratum of 37 DEG C of pre-temperature and for imaging.
(8) Real time PCR
Real-time fluorescence quantitative PCR instrument is undertaken by CFX96 real-time PCR instrument (Bio-Rad), pre-composition SsoFast Era Green Supermix (Bio-Rad, Cat No.172-5201AP).TransZol Up (TransGen Biotech, Cat No.ET111-01) extract RNA, with cDNAs with become SuperMix kit (TransGen Biotech, Cat No. AT311-02) synthetic DNA Article 1 chain, and it can be used as template, PCR primer used is as follows:
β-actin
(5’CTCCTCCCTGGAGAAGAGCTA3’ and 5’CCTTCTGCATCCTGTCGGCAA3’)；
Numb
(5’ACTTTTGATGCTAGTCGGACC3’ and
5’GAAGTAGGAGAGGTGGGAGAG3’);
numblike
(5’TCTCCTTTTGTGCTCCTGAC3’ and
5’TTCTCCCGTCGCTGTTTTC3’);
mon1a
(5’ACACCCTTACCCCTCCAT3’ and
5’CTTCTCTTCCTCTGCATGTCAG3’);
mon1b
(5’TGGCTGAGAAGGAGACACTAC3’ and 5’GGTGGGTAACGAATGAAGAGC3’)。
Embodiment one:
Prove that Numb is that in early stage born of the same parents, corpusculum merges necessary:
Refer to Fig. 1 and Fig. 2, utilize two not homotactic tiny RNA (shRNA) in MCF7A, knock out Numb gene, transcriptional level and the protein expression level of expressing Numb in the cell of two tiny RNA are all significantly lowered, but do not affect the expression of Numb like, demonstrate specificity and the validity of gene knockout.Utilize corpusculum (EEs) situation in the early stage born of the same parents in EEA1 antibody mediated immunity fluorescent dye detection normal cell and Numb deletion cells (Numb-KD).Refer to Fig. 3, compared with the MCF7A cell of contrast, in Numb-KD cell, the EES of the EEA1 positive assembles and cluster is deposited in together.Refer to Figure 4 and 5, detailed quantitative statistics is presented at the whole EES cluster more than the 70% EEA1 positive in Numb-KD cell to be existed, and quantity such in compared with control cells only has 50%.Situation and the compared with control cells of the accumulation of Numb-KD cell EES cluster are different.In the EES piled up in compared with control cells, 50% is only be made up of two EES, and in Numb-KD cell, the EES piled up in the cell more than 30% forms by piling up more than 5 EES, only has 27% to be combined into by two EES.These results show, and Numb genetically deficient can cause endosome film abnormal fusion, and this proves, Numb plays a part general in endosome film fusion process.
With early stage EES mark Rab5 and EES mark HGS detection in late period Numb-KD cell, thus the effect of research Numb in film merges.Refer to Fig. 6 to 9, result shows, and no matter is by Rab5 or HGS marker detection, the EES of maturation greatly all can be detected in compared with control cells perikaryon, but in Numb-KD cell, large EES seldom detected, but some little EES are deposited in perikaryon.Refer to Figure 10, vesica Analyzing on Size shows, the area of the EES containing most of Rab5 positive in Numb-KD cell is less than 0.02um
2, only have and little be greater than 0.02um
2, and these are greater than 0.02um
2be only real ripe EES.These results illustrate, in Numb-KD cell, EES can be transported to perikaryon, but can not complete the ripening process of ensuing dependence homotype film fusion.In addition, in Numb-KD cell, the positive EES of HGS mark obviously reduces, and because HGS is generally the detection mark of ripe EES, therefore also proves that Numb disappearance causes the ripening process hindering EES.In order to confirm that Numb genetically deficient hinders EES ripe further, we have used other shRNA significantly to reduce the expression amount of Numb, have also been obtained above-mentioned identical experimental result.
Refer to Figure 11 to 16, utilize above-mentioned similar experimental technique to prepare Numb like-KD cell, this cell of empirical tests does not have significant difference compared with the control in EES film fusion process, proves that Numb like albumen does not almost act on EES ripening process.
The important regulating and controlling factor of the EES maturation of Rab5 by sufficient proof, process LAN Rab5 can to promote EES that homomixis occurs and form larger EES.Process LAN Rab5 albumen, observe the change of EES in Numb-KD cell and compared with control cells, find in compared with control cells, occurred the larger EES of volume of a large amount of EAA1 positive, and only to have occurred assembling in Numb-KD and the EES of small volume, this illustrates that process LAN Rab5 can not save the EES caused because of Numb disappearance and merge obstacle, and therefore Numb regulates EES to merge is do not rely on Rab5.Refer to Figure 17, the morphological specificity of early stage endosome (EE) in Numb-KD cell with transmission electron microscope observing, it obviously diminishes with compared with control cells phase specific volume.
In sum, above experimental data demonstrates Numb new effect in endosome homotype film fusion process, and Numb is that in early stage born of the same parents, corpusculum merges necessary.
Embodiment two:
Prove that Numb is that in early stage born of the same parents, corpusculum merges the regulatory factor in docking operation:
In early stage born of the same parents, the homotype fusion of corpusculum will experience three coherent and discernible processes: be hooked, dock and merge.Refer to Figure 18 and 19, utilize the dynamic process that real time imagery analysis is merged, observed in compared with control cells and be hooked, dock and merge three phases.Contrary in Numb-KD cell, EES is gathered near perikaryon, but can not merge.And these EES to flock together be not by physical contact, but concussion and swinging mutually around each other.This illustrates, Numb regulation process is after gathering and before merging.In order to analyze the behavioural characteristic of EES in Numb-KD cell, EES is divided into three groups, the endosome of random motion (around concussion wave also do not merge), assembles endosome (shaking swing for a long time each other around) and fusion endosome (generation physical contact also completes fusion process).According to above-mentioned mode classification, Numb-KD does not affect the first endosome, and has increased substantially the quantity of assembling endosome, decreases the quantity merging endosome.Therefore, the process after Numb impact is assembled and before merging, mainly docking operation.Also be observed in the EES that similar experimental phenomena marks at Transferrins,iron complexes.Because Transferrins,iron complexes and low-density lipoprotein realize degraded and recycling by endosome and lysosome, Numb participates in its process, illustrates that Numb plays general effect in endosome docking operation in early days.But after Numb-like disappearance, but there is not above-mentioned similar experimental result, prove Numb instead of Numb like and play a role in endosome fusion process.
Referring to Figure 20 to 22, by have detected the impact of Numb-KD cell that positive and Rab5-RFP expresses on EES Rab5, confirming that Numb regulates and controls the docking of endosome in a kind of ubiquitous mode.In contrast, the Rab5 positive alveolar cells of about 70% can complete gathering, docking and fusion process.And in Numb-KD, ratio only has 36%, and the endosome flocked together for a long time observed, and there is not stable docking in these endosomes, but carry out waving concussion at periphery each other, and this proves that the docking operation of EES receives impact.In compared with control cells and Numb-KD cell, there is no significant difference with the process merging startup after EES has docked, illustrate that Numb does not affect fusion process.
Refer to Figure 23 to 24, prove that Numb affects EES docking operation by cells in vitro experiment.The behavior of the EES that latest developments get up to utilize Distance evaluation paired, is applied to the effect of Numb-KD in EES in the cell evaluating Rab5-RFP process LAN by this principle.The vesica that the vesica of arbitrarily selected red-label is adjacent with it, by real-time cell imaging system observation dynamic process thereafter.In compared with control cells, in the time of 100s, distance to be less than in the paired vesica of 100nm 85% and finally to complete fusion, the vesica of distance between 100-200nm has 63% finally to complete fusion, the vesica of distance between 200-400nm only has 20% finally to merge, and the not realization that distance is greater than 400nm is merged.The Distance geometry of this data declaration endosome finally completes fusion to be had and contacts closely.According to this result, the vesica colony that distance is less than 100nm by us becomes the colony of docking or merging, because these vesicas can complete fusion in the following very short time.Distance being called between 100-400nm, assembles colony, and these colonies can complete fusion, but need the regular hour.Rely on this definition, after finding that in MCF7A and HEK293T cell, Numb knocks out, the distance of most of vesica is 200-400nm, and distance is less than the ratio that the vesica merged can occur 100nm and obviously reduces.This digital proof, Numb is required for endosome docking.
Embodiment three:
Prove that in cell, Numb 65 and Numb 71 regulates and controls the fusion of corpusculum in early stage born of the same parents:
According to the difference of cut mode in mammalian cell, Numb mono-has 4 types, is Numb 65, Numb 66, Numb 71, Numb 72 respectively, and together with Numb like, in mammalian cell, one has five kinds of Numb albumen.
Refer to Figure 25, knock out Numb in MCF7A after, the corresponding Numb albumen of process LAN.Process LAN Numb 65 and Numb 71 can reappear normal fusion, and Numb 66, Numb72 and Numb like then can not recover to merge.Detailed quantitative analysis shows: process LAN Numb 66, Numb72 and the Numblike size to endosome has no significant effect, and Numb 65 and Numb 71 process LAN can significantly improve the size of endosome.In addition, process LAN Numb 65 and Numb 71 significantly improves larger endosome (>=0.2m
2) ratio, reduce less endosome (≤0.1m
2) ratio, these data presentation only have Numb 65 and Numb 71 instead of Numb 66, Numb72 and Numb like plays a role in endosome fusion process.
Embodiment four:
Prove that the fusion of corpusculum in Numb regulation and control born of the same parents is realized by cytokine:
Take external fusion experiment, with prove Numb EE docking and merge in effect and explore in it mechanism.Refer to Figure 26, in born of the same parents, corpusculum exciting light 488nm or 555nm label 37 DEG C hatch 5min, isolated nuclei pericentral siphon supernatant liquor (PNS), corpusculum and soluble cytokine in the born of the same parents that the inside comprises mark, put it into containing ATP, cytosol and corresponding damping fluid.Refer to Figure 27 and 28, the vesicle that the quantity that in born of the same parents, corpusculum occurs to merge produces two kinds of colors by record simultaneously calculates.Experiment finds that Numb KD does not affect body internal labeling in control group and Numb KD MCF7A cell.Find in an experiment, under hatching 40min condition at 37 DEG C, come from tenuigenin and the PNS of contrast MCF7A cell, obvious fusion phenomenon can be produced.And come from tenuigenin and the PNS of Numb KD cell, producing the quantity merged will lack 50%.Bubbles coalesce can reduce the quantity of the larger vesicle of volume extremely.Refer to Figure 29, the quantity being greater than 2.0um in Numb KD cell lacks 37% compared with the control.In addition, Numb KD considerably reduces and is less than 0.5um
2the quantity of endosome, this shows that Numb KD can affect after little vacuolar membrane merges and locates, and these results all prove that Numb controllable EE docks and merges in vitro.
Refer to Figure 29, in an experiment, we adopt the perikaryon supernatant liquor of Normocellular tenuigenin and Numb-KD cell jointly to hatch, and result shows it can produce the fusion situation identical with compared with control cells and vesica size.This shows, Numb is merged by a unknown cytokine modulating EE.
Embodiment five:
Prove that Numb can interact with Mon1a and Mon1b:
Refer to Figure 30,31 and 32, proved by co-immunoprecipitation experiment, Numb can be combined with Mon1a and Mon1b of yeast bubbles coalesce regulatory factor Mon1 homology in mammalian cell.The total Mon1 of yeast is a part of cis-SNARE, and is that trans-SNARE pairing is necessary.In mammalian cell, find that it has two homologous genes to be Mon1a and Mon1b respectively, nearest experiment proves that they are early stage and in late period born of the same parents, corpusculum is transported necessary.Construct the mutant of a series of Numb, prove that PTB and the PRR structural domain of Numb is that Numb and Mon1 is in conjunction with necessary.Numb has 5 kinds of isomer, co-immunoprecipitation experiment proves that all Numb isomer can interact with Mon1, although only have corpusculum in Numb 65 and Numb 71 born of the same parents to play a role in merging, this proves that the interaction of Numb and Mon1 has in cellular physiological events and acts on widely.
Embodiment six:
Prove that Numb can recruit Mon1b and navigate in early stage born of the same parents on corpusculum from tenuigenin:
Refer to 33 and 34, utilize the antibody of Mon1a and Mon1b to carry out co-immunoprecipitation experiment and prove positive signals in compared with control cells, and the signal of Mon1a and Mon1b weakens 57% and 67% respectively in Numb-KD cell, refers to Figure 35,36 and 37.Refer to Figure 38,39 and 40, this change causing Mon1a to distribute in ubcellular due to Numb KD is proved further by Mon1a-myc and Mon1a-GFP albumen.Refer to Figure 34, utilizing the co-precipitation of Mon1b and EEA1 antibody mediated immunity to detect proves, be that Mon1b instead of Mon1a is positioned on EEs, and Numb KD considerably reduces the distribution of Mon1a on EEs.Refer to Figure 41 to 44, in order to prove the Distribution and localization of Numb and Mon1 in ubcellular further, process LAN Rab5-RFP albumen (being proved to be the fusion that it can improve EE) in MCFA cell, discovery only has part Mon1b instead of Mon1a and Rab5-RFP to locate altogether, and Numb KD considerably reduces the quantity that Mon1b and Rab5-RFP locates altogether; Only have Mon1b instead of Mon1a to appear on the EEs of Rab5 or EEA1 mark, and locating altogether only appear in Numb with Mon1b, instead of Mon1a, all these explanations only have Mon1b to relate to docking and the fusion of EE.
Embodiment seven:
Prove that Mon1b is the important docking regulatory factor that in early stage born of the same parents, corpusculum merges:
Refer to Figure 45, in MCF7A cell, we reduce the expression of Mon1a or Mon1b by RNA interference method, are obviously lowered by Western blotting and qRT-PCR results verification Mon1 genetic expression.Refer to Figure 46 to 50, the fusion of Mon1a KD on EEs does not affect, but Mon1b KD affects the fusion of EEs and the EEs increase by 75% of generation gathering, after finding reticent Mon1b instead of Mon1a substantially reduce the volume of EEs of Rab5 or HGS mark, this shows to only have Mon1a to affect the fusion of EEs.Next we are in Mon1a and Mon1b silenced cell, carry out time-lag experiment, in Mon1b KD cell there is long-time gathering and docking do not occur and merges in EEs, in Mon1a KD cell there is not obvious change in the fusion of EEs compared with the control, these digital proofs, Mon1b is that EE docking is necessary.
Embodiment eight:
The docking that proof Numb regulates and controls corpusculum in early stage born of the same parents is realized by Mon1b:
Five of process LAN Numb dissimilar albumen in the MCF7A cell of Mon1b KD, then with anti-EEA1 mark, fluorescence co-focusing detects the fusion situation of EEs, thus obtains the relation in EEs fusion process between Numb and Mon1b.In Mon1b KD cell, all Numb albumen of process LAN comprises Numb 65 and Numb 71, and EEs all can not be made to merge.Refer to Figure 51 and 52, image is presented in these cells, and EEs is all serious piling up.Statistics display, all Numb anisotropic approach albumen all can not save the situation that abnormal fusion occurs EEs, therefore, illustrates that Mon1b is that Numb regulation and control EES merges necessary.Also illustrate, Numb is regulation and control upstream or jointly regulates and controls the fusion of EEs with Mon1b.
Embodiment nine:
Prove that Mon1b can to dissociate NSF and then the recycle of control SNARE from cis-SNARE:
In yeast, Mon1b is a part of cis-SNARE, and its sudden change will cause the pairing of trans-SNARE, therefore will consider what whether the fusion of Numb and Mon1b regulation and control EEs was realized by SNARE mixture.Refer to Figure 53, co-immunoprecipitation result display Mon1b can be combined with SNARE composite bulk phase, comprises syntaxin 13 and syntaxin 6 and cis-SNARE depolymerizing factor NSF, but can not be combined with a-SNAP and VAMP4.This illustrates, Mon1b is a part for SNARE complex body.Refer to Figure 54, the Mon1b of the accumulation near NSF, syntaxin 13 and syntaxin 6 and perikaryon has good co-precipitation effect, and α-SNAP and VAMP4 and Mon1b does not almost have.Particularly Mon1b and NSF has the co-precipitation of 100%, and both albumen have a large amount of distribution near the enrichment region perikaryon of EEs.These results show, Mon1b is regulated and controled EE fusion and realized by SNARE.Refer to Figure 55, prove that Numb and SNARE does not directly interact.But the effect of Mon1b and NSF obviously weakens in Numb KD cell, this illustrates that Numb acts on SNARE complex body by regulation and control Mon1b.
From normal cell, Numb KD cell and Mon1b KD cell, corpusculum in born of the same parents is separated, with anti-syntaxin 13 immunoprecipitation, afterwards with NSF, α-SNAP, Vti1A, syntaxin 6 and syntaxin 13 immuning hybridization by high speed centrifugation.Refer to 56, result shows, Numb KD and Mon1b KD does not all affect anti-syntaxin 13 and corpusculum SNARE(Vti1A and syntaxin 6 in born of the same parents) and the dissociation factor (NSF and α-SNAP) of cis-SNARE there is co-immunoprecipitation and react, illustrate that Numb and Mon1b does not all directly affect the assembling of SNARE and dissociate.But refer to 57, find unexpectedly, process LAN Mon1b significantly can reduce the combination of NSF and syntaxin13, syntaxin 13 does not receive impact with the combination of other component of SNARE.Refer to 58, by immunofluorescence dyeing, process LAN Mon1b significantly can reduce the distribution of NSF near perikaryon, in 57 cells detected, have the NSF expression amount in 31 cells near perikaryon to reduce, and the nsf signal near the perikaryon of 26 cells disappear.Refer to Figure 59, prove further by the method for co-immunoprecipitation, process LAN Mon1b can reduce the NSF in EEs, and does not affect other components of SNARE.These results illustrate, Mon1b can to dissociate lower NSF from SNARE.
Refer to Figure 60, in the MCF7A cell being with or without NSF, process LAN Mon1b detects the metamorphosis of EE, find corpusculum in the born of the same parents that coexpression Mon1b and NSF can produce the larger EEA1 positive in a large number near perikaryon, but any one in both process LAN does not all produce obvious change.In the born of the same parents of both coexpressions the size of corpusculum be express GFP-Mon1b or Myc-NSF born of the same parents in 2 times of corpusculum.The statistical study of endosome size distribution shows, coexpression two albumen not only improve the quantity (>=0.2m of corpusculum in the larger born of the same parents of volume
2), but also the quantity (≤0.05m of corpusculum in the born of the same parents significantly reducing small volume
2).Illustrated by these experimental datas, both process LAN can improve the fusion of EEs and produce abnormal EEs.Therefore we infer, Mon1b and NSF plays synergy to transform to trans-SNARE by driving cis-SNARE in EEs merges.If like this, it is rely on SNARE complex body that the EEs for NSF and Mon1b appearance excessively merges.Refer to Figure 61,62 and 63, in fact, by syntaxin 6, syntaxin 13 or Vamp 4 in the reticent SNARE component of shRNA, change the excessive fusion that coexpression Mon1b and NSF occurs in MCF7A cell completely to manifest, further illustrate Mon1b and NSF and played a role by SNARE in EEs merges.In order to better understand the relation between Numb, Mon1b, NSF and EEs, whether have detected coexpression Mon1b and NSF in Numb KD cell can make EEs merge recovery normally, result shows, can produce and contrast corpusculum in similar large born of the same parents, this illustrates that Numb is the upstream regulatory factor that Mon1b and NSF regulates and controls EEs fusion.The more important thing is to only have common process LAN Mon1b and NSF just can occur excessive fusion phenomenon, and separately process LAN one can not occur that this manifests, illustrate that Mon1b and NSF relies on SNARE complex body closely to interact regulation and control EE fusion.
Refer to Figure 64, in the present invention, the mechanism of film transport process is participated in order to characterize Numb, adopt RNA perturbation technique disappearance Numb (Numb-KD) and Numblike (Numblike-KD), find in Numb deletion cells, transitional vesicle flocks together, instead of is fused into larger transitional vesicle.Time-lag experiment shows, the transitional vesicle in Numb-KD cell strain trends towards piling up mutually but not having stable docking and fusion.It should be noted that and only have endochylema Numb65 and Numb71 can realize when overexpression saving experiment in Numb-KD cell strain, and then recover the normal fusion of transitional vesicle.External endosome test for fusion shows, endochylema Numb albumen controls the fusion of endosome by cytoplasmic factor.Prove further subsequently, Numb protein binding Mon1b.The assembling and the trans SNARE subsequently that affects cis-SNARE complex body after Mon1b sudden change match.Upset tenuigenin Mon1b after Numb disappearance to be enrolled on vesica, and after Mon1b disappearance, and there is identical phenomenon in disappearance Numb.Further discovery, Mon1b can be attached to NSF and syntaxins, instead of SNAP and VAMP.After process LAN Mon1b, reduce the combination of NSF and syntaxins.After coexpression Mon1b and NSF, be that the transport vesicle (it depends on SNARE assembly) in born of the same parents becomes large.Therefore, research finds that tenuigenin Numb albumen is recruited endochylema Mon1b as a kind of novel regulatory factor and navigated on the vesica in EEA1 front, to dissociate lower NSF from SNARE complex body, SNARE complex body is made to recover original state, the film of a further unlatching new round merges, imply that Numb can control multiple key node, if endocytosis, recovery and degraded fine adjustment signal are in the intensity of various physiological process and time length.
The foregoing is only embodiments of the invention; not thereby the scope of the claims of the present invention is limited; every utilize description of the present invention to do equivalent structure or equivalent flow process conversion; or be directly or indirectly used in other relevant technical field, be all in like manner included in scope of patent protection of the present invention.
Sequence table
<110> Suzhou is along Sheng Qiao bio tech ltd
<120> is used for the functional protein in drug development as target spot
<160>
<170>
<210> 1
<211>
<212> albumen
<213> Numb65
<400> 1
MNKLRQSFRRKKDVYVPEASRPHQWQTDEEGVRTGKCSFPVKYLGHVEVDESRGMHICEDAVKRLKATGKKAVKAVLWVSADGLRVVDEKTKDLIVDQTIEKVSFCAPDRNFDRAFSYICRDGTTRRWICHCFMAVKDTGERLSHAVGCAFAACLERKQKREKECGVTATFDASRTTFTREGSFRVTTATEQAEREEIMKQMQDAKKAETDKIVVGSSVAPGNTAPSPSSPTSPTSDATTSLEMNNPHAIPRRHAPIEQLARQGSFRGFPALSQKMSPFKRQLSLRINELPSTMQRKTDFPIKNAVPEVEGEAESISSLCSQITNAFSTPEDPFSSAPMTKPVTVVAPQSPTFQGTEWGQSSGAASPGLFQAGHRRTPSEADRWLEEVSKSVRAQQPQASAAPLQPVLQPPPPTAISQPASPFQGNAFLTSQPVPVGVVPALQPAFVPAQSYPVANGMPYPAPNVPVVGITPSQMVANVFGTAGHPQAAHPHQSPSLVRQQTFPHYEASSATTSPFFKPPAQHLNGSAAFNGVDDGRLASADRHTEVPTGTCPVDPFEAQWAALENKSKQRTNPSPTNPFSSDLQKTFEIEL
<210> 2
<211>
<212> albumen
<213> Numb71
<400> 2
MNKLRQSFRRKKDVYVPEASRPHQWQTDEEGVRTGKCSFPVKYLGHVEVDESRGMHICEDAVKRLKAERKFFKGFFGKTGKKAVKAVLWVSADGLRVVDEKTKDLIVDQTIEKVSFCAPDRNFDRAFSYICRDGTTRRWICHCFMAVKDTGERLSHAVGCAFAACLERKQKREKECGVTATFDASRTTFTREGSFRVTTATEQAEREEIMKQMQDAKKAETDKIVVGSSVAPGNTAPSPSSPTSPTSDATTSLEMNNPHAIPRRHAPIEQLARQGSFRGFPALSQKMSPFKRQLSLRINELPSTMQRKTDFPIKNAVPEVEGEAESISSLCSQITNAFSTPEDPFSSAPMTKPVTVVAPQSPTFQGTEWGQSSGAASPGLFQAGHRRTPSEADRWLEEVSKSVRAQQPQASAAPLQPVLQPPPPTAISQPASPFQGNAFLTSQPVPVGVVPALQPAFVPAQSYPVANGMPYPAPNVPVVGITPSQMVANVFGTAGHPQAAHPHQSPSLVRQQTFPHYEASSATTSPFFKPPAQHLNGSAAFNGVDDGRLASADRHTEVPTGTCPVDPFEAQWAALENKSKQRTNPSPTNPFSSDLQKTFEIEL
<210> 3
<211>
<212> albumen
<213> Mon1b
<400> 3
MEVGGDTAAPAPGGAEDLEDTQFPSEEAREGGGVHAVPPDPEDEGLEETGSKDKDQPPSPSPPPQSEALSSTSRLWSPAAPENSPTCSPESSSGGQGGDPSDEEWRSQRKHVFVLSEAGKPIYSRYGSVEALSATMGVMTALVSFVQSAGDAIRAIYAEDHKLVFLQQGPLLLVAMSRTSQSAAQLRGELLAVHAQIVSTLTRASVARIFAHKQNYDLRRLLAGSERTLDRLLDSMEQDPGALLLGAVRCVPLARPLRDALGALLRRCTAPGLALSVLAVGGRLITAAQERNVLAECRLDPADLQLLLDWVGAPAFAAGEAWAPVCLPRFNPDGFFYAYVARLDAMPVCLLLLGTQREAFHAMAACRRLVEDGMHALGAMRALGEAASFSNASSASAPAYSVQAVGAPGLRHFLYKPLDIPDHHRQLPQFTSPELEAPYSREEERQRLSDLYHRLHARLHSTSRPLRLIYHVAEKETLLAWVTSKFELYTCLSPLVTKAGAILVVTKLLRWVKKEEDRLFIRYPPKYSTPPATSTDQAAHNGLFTGL
<210> 4
<211>
<212> albumen
<213> NSF
<400> 4
MAGRSMQAARCPTDELSLTNCAVVNEKDFQSGQHVIVRTSPNHRYTFTLKTHPSVVPGSIAFSLPQRKWAGLSIGQEIEVSLYTFDKAKQCIGTMTIEIDFLQKKSIDSNPYDTDKMAAEFIQQFNNQAFSVGQQLVFSFNEKLFGLLVKDIEAMDPSILKGEPATGKRQKIEVGLVVGNSQVAFEKAENSSLNLIGKAKTKENRQSIINPDWNFEKMGIGGLDKEFSDIFRRAFASRVFPPEIVEQMGCKHVKGILLYGPPGCGKTLLARQIGKMLNAREPKVVNGPEILNKYVGESEANIRKLFADAEEEQRRLGANSGLHIIIFDEIDAICKQRGSMAGSTGVHDTVVNQLLSKIDGVEQLNNILVIGMTNRPDLIDEALLRPGRLEVKMEIGLPDEKGRLQILHIHTARMRGHQLLSADVDIKELAVETKNFSGAELEGLVRAAQSTAMNRHIKASTKVEVDMEKAESLQVTRGDFLASLENDIKPAFGTNQEDYASYIMNGIIKWGDPVTRVLDDGELLVQQTKNSDRTPLVSVLLEGPPHSGKTALAAKIAEESNFPFIKICSPDKMIGFSETAKCQAMKKIFDDAYKSQLSCVVVDDIERLLDYVPIGPRFSNLVLQALLVLLKKAPPQGRKLLIIGTTSRKDVLQEMEMLNAFSTTIHVPNIATGEQLLEALELLGNFKDKERTTIAQQVKGKKVWIGIKKLLMLIEMSLQMDPEYRVRKFLALLREEGASPLDFD
Claims (9)
1. one group to be used for the functional protein in drug development as target spot, it is characterized in that, described functional protein is Numb, Mon1b and NSF, carries out drug development using described Numb, Mon1b or NSF as target spot, is used for the treatment of corpusculum abnormal fusion in early stage born of the same parents and the disease caused.
2. functional protein according to claim 1, it is characterized in that, described Numb is the upstream regulatory factor that described Mon1b and described NSF regulate and control that in early stage born of the same parents, corpusculum (EEs) merges, and described Mon1b and described NSF is played a role by SNARE in EEs merges.
3. functional protein according to claim 2, is characterized in that, described Numb and described Mon1b interacts, and described Mon1b dissociates from cis-SNARE the recycle of described NSF, control SNARE, thus the fusion of corpusculum in regulation and control born of the same parents.
4. functional protein according to claim 1, is characterized in that, described Numb can promote the fusion of corpusculum in early stage born of the same parents, and described Numb is the regulatory factor in early stage born of the same parents in corpusculum docking operation.
5. functional protein according to claim 4, is characterized in that, the Numb 65 in described Numb and Numb 71 regulates and controls the fusion of corpusculum in early stage born of the same parents, and the sequence of described Numb 65 is:
MNKLRQSFRRKKDVYVPEASRPHQWQTDEEGVRTGKCSFPVKYLGHVEVDESRGMHICEDAVKRLKATGKKAVKAVLWVSADGLRVVDEKTKDLIVDQTIEKVSFCAPDRNFDRAFSYICRDGTTRRWICHCFMAVKDTGERLSHAVGCAFAACLERKQKREKECGVTATFDASRTTFTREGSFRVTTATEQAEREEIMKQMQDAKKAETDKIVVGSSVAPGNTAPSPSSPTSPTSDATTSLEMNNPHAIPRRHAPIEQLARQGSFRGFPALSQKMSPFKRQLSLRINELPSTMQRKTDFPIKNAVPEVEGEAESISSLCSQITNAFSTPEDPFSSAPMTKPVTVVAPQSPTFQGTEWGQSSGAASPGLFQAGHRRTPSEADRWLEEVSKSVRAQQPQASAAPLQPVLQPPPPTAISQPASPFQGNAFLTSQPVPVGVVPALQPAFVPAQSYPVANGMPYPAPNVPVVGITPSQMVANVFGTAGHPQAAHPHQSPSLVRQQTFPHYEASSATTSPFFKPPAQHLNGSAAFNGVDDGRLASADRHTEVPTGTCPVDPFEAQWAALENKSKQRTNPSPTNPFSSDLQKTFEIEL,The sequence of Numb described 71 as follows:
MNKLRQSFRRKKDVYVPEASRPHQWQTDEEGVRTGKCSFPVKYLGHVEVDESRGMHICEDAVKRLKAERKFFKGFFGKTGKKAVKAVLWVSADGLRVVDEKTKDLIVDQTIEKVSFCAPDRNFDRAFSYICRDGTTRRWICHCFMAVKDTGERLSHAVGCAFAACLERKQKREKECGVTATFDASRTTFTREGSFRVTTATEQAEREEIMKQMQDAKKAETDKIVVGSSVAPGNTAPSPSSPTSPTSDATTSLEMNNPHAIPRRHAPIEQLARQGSFRGFPALSQKMSPFKRQLSLRINELPSTMQRKTDFPIKNAVPEVEGEAESISSLCSQITNAFSTPEDPFSSAPMTKPVTVVAPQSPTFQGTEWGQSSGAASPGLFQAGHRRTPSEADRWLEEVSKSVRAQQPQASAAPLQPVLQPPPPTAISQPASPFQGNAFLTSQPVPVGVVPALQPAFVPAQSYPVANGMPYPAPNVPVVGITPSQMVANVFGTAGHPQAAHPHQSPSLVRQQTFPHYEASSATTSPFFKPPAQHLNGSAAFNGVDDGRLASADRHTEVPTGTCPVDPFEAQWAALENKSKQRTNPSPTNPFSSDLQKTFEIEL。
6. The function of the protein according to claim 1, its characteristic is that Mon1b sequence is describedMEVGGDTAAPAPGGAEDLEDTQFPSEEAREGGGVHAVPPDPEDEGLEETGSKDKDQPPSPSPPPQSEALSSTSRLWSPAAPENSPTCSPESSSGGQGGDPSDEEWRSQRKHVFVLSEAGKPIYSRYGSVEALSATMGVMTALVSFVQSAGDAIRAIYAEDHKLVFLQQGPLLLVAMSRTSQSAAQLRGELLAVHAQIVSTLTRASVARIFAHKQNYDLRRLLAGSERTLDRLLDSMEQDPGALLLGAVRCVPLARPLRDALGALLRRCTAPGLALSVLAVGGRLITAAQERNVLAECRLDPADLQLLLDWVGAPAFAAGEAWAPVCLPRFNPDGFFYAYVARLDAMPVCLLLLGTQREAFHAMAACRRLVEDGMHALGAMRALGEAASFSNASSASAPAYSVQAVGAPGLRHFLYKPLDIPDHHRQLPQFTSPELEAPYSREEERQRLSDLYHRLHARLHSTSRPLRLIYHVAEKETLLAWVTSKFELYTCLSPLVTKAGAILVVTKLLRWVKKEEDRLFIRYPPKYSTPPATSTDQAAHNGLFTGL。
7. functional protein according to claim 1, is characterized in that, the sequence of described NSF is:
MAGRSMQAARCPTDELSLTNCAVVNEKDFQSGQHVIVRTSPNHRYTFTLKTHPSVVPGSIAFSLPQRKWAGLSIGQEIEVSLYTFDKAKQCIGTMTIEIDFLQKKSIDSNPYDTDKMAAEFIQQFNNQAFSVGQQLVFSFNEKLFGLLVKDIEAMDPSILKGEPATGKRQKIEVGLVVGNSQVAFEKAENSSLNLIGKAKTKENRQSIINPDWNFEKMGIGGLDKEFSDIFRRAFASRVFPPEIVEQMGCKHVKGILLYGPPGCGKTLLARQIGKMLNAREPKVVNGPEILNKYVGESEANIRKLFADAEEEQRRLGANSGLHIIIFDEIDAICKQRGSMAGSTGVHDTVVNQLLSKIDGVEQLNNILVIGMTNRPDLIDEALLRPGRLEVKMEIGLPDEKGRLQILHIHTARMRGHQLLSADVDIKELAVETKNFSGAELEGLVRAAQSTAMNRHIKASTKVEVDMEKAESLQVTRGDFLASLENDIKPAFGTNQEDYASYIMNGIIKWGDPVTRVLDDGELLVQQTKNSDRTPLVSVLLEGPPHSGKTALAAKIAEESNFPFIKICSPDKMIGFSETAKCQAMKKIFDDAYKSQLSCVVVDDIERLLDYVPIGPRFSNLVLQALLVLLKKAPPQGRKLLIIGTTSRKDVLQEMEMLNAFSTTIHVPNIATGEQLLEALELLGNFKDKERTTIAQQVKGKKVWIGIKKLLMLIEMSLQMDPEYRVRKFLALLREEGASPLDFD。
8. functional protein according to claim 1, is characterized in that, corpusculum abnormal fusion in described early stage born of the same parents and the disease caused is tumour and nerve degenerative diseases.
9. functional protein according to claim 8, is characterized in that, described nerve degenerative diseases is alzheimer's disease, Parkinson's disease, Huntington's disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410446543.6A CN104650206A (en) | 2014-09-04 | 2014-09-04 | Functional proteins serving as target spots for medicinal development |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410446543.6A CN104650206A (en) | 2014-09-04 | 2014-09-04 | Functional proteins serving as target spots for medicinal development |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104650206A true CN104650206A (en) | 2015-05-27 |
Family
ID=53241889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410446543.6A Pending CN104650206A (en) | 2014-09-04 | 2014-09-04 | Functional proteins serving as target spots for medicinal development |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104650206A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107434826A (en) * | 2016-05-26 | 2017-12-05 | 李华顺 | A kind of yeast cells of high expression Slit2D2 HSA albumen and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008143979A2 (en) * | 2007-05-16 | 2008-11-27 | Cold Spring Harbor Laboratory | Tumor suppressor gene screening using rna interference libraries and method of treatment |
| WO2009044173A2 (en) * | 2007-10-05 | 2009-04-09 | Trojan Technologies Ltd. | Methods of treating cancer using notch pathway inhibitors |
| CN103869080A (en) * | 2014-03-06 | 2014-06-18 | 中国农业大学 | Early diagnostic marker for chronic neurodegenerative diseases and application of marker |
-
2014
- 2014-09-04 CN CN201410446543.6A patent/CN104650206A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008143979A2 (en) * | 2007-05-16 | 2008-11-27 | Cold Spring Harbor Laboratory | Tumor suppressor gene screening using rna interference libraries and method of treatment |
| WO2009044173A2 (en) * | 2007-10-05 | 2009-04-09 | Trojan Technologies Ltd. | Methods of treating cancer using notch pathway inhibitors |
| CN103869080A (en) * | 2014-03-06 | 2014-06-18 | 中国农业大学 | Early diagnostic marker for chronic neurodegenerative diseases and application of marker |
Non-Patent Citations (4)
| Title |
|---|
| LUCIA DI MARCOTULLIO1,ET AL.: "Numb is a suppressor of Hedgehog signalling and targets Gli1 for Itch-dependent ubiquitination", 《NATURE CELL BIOLOGY》 * |
| SRINIVASULU CHIGURUPATIA,ET AL.: "Evidence for Altered Numb Isoform Levels in Alzheimer’s Disease Patients and a Triple Transgenic Mouse Model", 《JOURNAL OF ALZHEIMER’S DISEASE》 * |
| YONGTAOYANG,ET AL.: "Numb modulates the paracellular permeability ofintestinal epithelial cells through regulating apicaljunctional complex assembly andmyosin light chain phosphorylation", 《EXPERIMENTAL CELL RESEARCH》 * |
| 张弗盈等: "膜融合中的SNAREs 及其相关蛋白研究进展", 《医学综述》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107434826A (en) * | 2016-05-26 | 2017-12-05 | 李华顺 | A kind of yeast cells of high expression Slit2D2 HSA albumen and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Iskratsch et al. | FHOD1 is needed for directed forces and adhesion maturation during cell spreading and migration | |
| Williams et al. | SNAP23, Syntaxin4, and vesicle-associated membrane protein 7 (VAMP7) mediate trafficking of membrane type 1–matrix metalloproteinase (MT1-MMP) during invadopodium formation and tumor cell invasion | |
| US20210046124A1 (en) | Human functional corneal endothelial cell and application thereof | |
| Dustrude et al. | CRMP2 protein SUMOylation modulates NaV1. 7 channel trafficking | |
| Kjenseth et al. | The gap junction channel protein connexin 43 is covalently modified and regulated by SUMOylation | |
| Wang et al. | VPS35 regulates developing mouse hippocampal neuronal morphogenesis by promoting retrograde trafficking of BACE1 | |
| Wang et al. | LIMD1 phase separation contributes to cellular mechanics and durotaxis by regulating focal adhesion dynamics in response to force | |
| Zhang et al. | Arginylation-dependent regulation of a proteolytic product of talin is essential for cell–cell adhesion | |
| Ludemann et al. | O-glycosylation of the tail domain of neurofilament protein M in human neurons and in spinal cord tissue of a rat model of amyotrophic lateral sclerosis (ALS) | |
| Haage et al. | Talin autoinhibition regulates cell-ECM adhesion dynamics and wound healing in vivo | |
| Irving et al. | The serpinopathies: studying serpin polymerization in vivo | |
| Dráberová et al. | Differential expression of human γ‐tubulin isotypes during neuronal development and oxidative stress points to a γ‐tubulin‐2 prosurvival function | |
| Sakurai-Yageta et al. | Tumor suppressor CADM1 is involved in epithelial cell structure | |
| Hanel et al. | Facioscapulohumeral muscular dystrophy (FSHD) region gene 1 (FRG1) is a dynamic nuclear and sarcomeric protein | |
| CN108144062A (en) | Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application | |
| Song et al. | ALOX5-mediated ferroptosis acts as a distinct cell death pathway upon oxidative stress in Huntington's disease | |
| Zallocchi et al. | Regulated vesicular trafficking of specific PCDH15 and VLGR1 variants in auditory hair cells | |
| Khalfaoui et al. | Laminin receptor 37/67LR regulates adhesion and proliferation of normal human intestinal epithelial cells | |
| De Mario et al. | Calcium handling by endoplasmic reticulum and mitochondria in a cell model of Huntington’s disease | |
| Yang et al. | Increased expression of CX43 on stromal cells promotes leukemia apoptosis | |
| Staugaitis et al. | NG2-positive glia in the human central nervous system | |
| Liu et al. | Tetraspanin CD9 regulates invasion during mouse embryo implantation | |
| Serra-Vinardell et al. | LYST deficiency impairs autophagic lysosome reformation in neurons and alters lysosome number and size | |
| Hirako et al. | Isolation of a hemidesmosome-rich fraction from a human squamous cell carcinoma cell line | |
| Austin et al. | Release of membrane-bound vesicles and inhibition of tumor cell adhesion by the peptide Neopetrosiamide A |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 215028 unit 601, biological building B2, No. 218, Xing Hu Street, Suzhou Industrial Park, Suzhou, Jiangsu. Applicant after: ASCO (Suzhou) Biotechnology Co., Ltd. Address before: 215028 unit 601, biological building B2, No. 218, Xing Hu Street, Suzhou Industrial Park, Suzhou, Jiangsu. Applicant before: SUZHOU SHUNSHENGQIAO BIOTECHNOLOGY CO., LTD. |
|
| CB02 | Change of applicant information | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150527 |
|
| RJ01 | Rejection of invention patent application after publication |