CN108144062A - Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application - Google Patents
Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application Download PDFInfo
- Publication number
- CN108144062A CN108144062A CN201711349811.2A CN201711349811A CN108144062A CN 108144062 A CN108144062 A CN 108144062A CN 201711349811 A CN201711349811 A CN 201711349811A CN 108144062 A CN108144062 A CN 108144062A
- Authority
- CN
- China
- Prior art keywords
- drug
- sirt3
- mitochondria
- prevention
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/45—Transferases (2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Epidemiology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
K288 sites the invention discloses the deacetylase SIRT3 relied on of NAD in mitochondria can occur SUMOization modification and regulate and control its activity；Meanwhile SUMO specific proteases 1 (SENP1) can regulate and control the SUMOization modification of SIRT3, so as to regulate and control the relevant physiology of mitochondria and pathologic process of SIRT3 participations；This regulating and controlling effect of SENP1 depends on the phosphorylation modification in SENP1S180 sites.Signals-modulating path the invention discloses SENP1 SIRT3 axis is of great significance for the prevention with Metabolism of Mitochondria and tumor-related illness to Metabolism of Mitochondria, the activation of macrophage and T cell and the influence to tumour immunity and tumour growth.
Description
Technical field
The invention belongs to biomedicine fields, are related to SENP1 phosphorylation modifications compound and SIRT3SUMOization goes modificationization
Close object and its application, and in particular to the phosphorylation modification in the S180 sites of SENP1 and the SUMOization modification to mitochondria SIRT3
Regulation and control be metabolized the effect and its application in relevant physiological and pathology in cell mitochondrial.
Background technology
Mitochondria is organelle of the energetic supersession important in cell with participating in cell metabolism regulation and control.It can divide from outside to inside
For four outer membrane, intermembrane space, inner membrance and matrix regions.Under physiology and pathologic condition, the quantity of mitochondria, shape and intracellular
Position can all occur dynamic change, and it is this change it is related with the function of mitochondria.In recent years research shows that, mitochondria
These change related to energy requirement, nutrition supply or metabolism change with cell mitochondrial.For example T cell is broken up by antigenic stimulus
When being proliferated as T effector cell, mitochondria shape is become smaller and is become spheroiding by Fission processes, and is further divided into note
During the property recalled T cell, mitochondria shape is then become larger and is become by Fusion growing (Buck et al., 2016).Fission makes
Mitochondria becomes smaller and becomes spherical, can increase mitochondria aerobic glycolysis, tricarboxylic acid cycle stream (TCA flux) etc., these generations
The change for thanking to activity is conducive to the differentiation amplification of T effector cell；And Fusion processes then increase the aliphatic acid of mitochondria
Beta- oxidative metabolic activities contribute to the surviving of memory t cell (T memory) (Buck et al., 2016).These grind
Study carefully and illustrate that the dynamic change of mitochondria can influence the metabolism of mitochondria and then influence the function of cell.
The SUMO modifications of protein are a dynamic and reversible process (Cheng, et al.2004).SUMO modifications
It is completed by three activating enzymes (E1), joining enzyme (E2) and ligase (E3) enzyme serial actions.The target egg modified by SUMO
In vain it has been reported that having as many as hundreds of.The protein of most of SUMO modifications is located in nucleus, and including transcription factor, transcription is altogether
Regulatory factor participates in albumen and signal transducers of chromatin remodeling etc..SUMO modifications can be by adjusting these target proteins
Position, stablize and activity influences intracellular numerous biological process.The regulation and control of protein s UMO modifications are mainly by going
The SUMOization Go to SUMOization process that is mediated of modification protease SENP family members regulates and controls.The albumen of SUMO modifications can occur
Can matter be predominantly located in cytoplasm and cell membrane, but SUMO modifications occur for albumen in mitochondria at present and have not been reported.
SENP families include 6 members：SENP1-3, SENP5-7 (Cheng, 2008).Most of SENP are distributed in nucleus,
SENP3 and SENP5 is positioned at kernel, and SENP6 spreads entire caryoplasm.It is that sequence height is similar in the C-terminal of their amino acid sequences
With conservative enzymatic activity region, and N-terminal sequence is different, it is considered that they regulate and control substrate specificities.Since SENP is important
SUMO modifies regulatory factor, their expression or the SUMO modification levels of activity height and substrate are closely related, thus SENP quilts
It is considered to act on protein under an important regulating and controlling factor of regulation protein SUMO modifications and physiology and pathologic condition
The important target (Cheng, et al.2004) of SUMO modifications.The signal tune that outer signals are formed by SENP and its substrate
Control access participation regulates and controls many activity of cell biology processes.But how at present outer signals are regulated and controled with the work of SENP
Property so influence participate in cell activity also have little understanding.
Sirtuin families share seven members (SIRT1-7), it relies on NAD+ as coenzyme, performance deacetylase or
The activity of ADP- ribosyltransferases, participates in the regulation and control of many important life processes, such as glycolipid metabolism, aging, stress reaction,
Inflammatory reaction, tumour and angiocardiopathy etc..Wherein, SIRT3 is a kind of deproteinized acetylase in mitochondrial matrix
(Dittenhafer-Reed et al., 2015).Mitochondrial protein more than 50% includes many enzyme energy for participating in metabolic process
Acetylation modification enough occurs, acetylation modification is a kind of important mechanisms of mitochondrial protein activity regulation.And SIRT3 is these lines
The main deacetylation modification enzyme of mitochondrial protein, the acetylation modification that it can regulate and control these mitochondrial proteins is horizontal, and then
Influence its function in mitochondria.The missing of SIRT3 can increase ROS in mitochondria, be sent out with aging, hearing impairment and cancer
There is substantial connection.But under physiology and pathologic condition, how to regulate and control the activity of SIRT3 and its Metabolism of Mitochondria process of participation
Also it is not clear.
Invention content
The present invention, which proposes the deacetylase SIRT3 that NAD is relied in mitochondria, can occur SUMO modifications, and SUMO is repaiied
Decorations can inhibit the activity of SIRT3.The SUMO decorating sites are located at the lysine of people SIRT3 the 288th, and (mouse SIRT3 is
223 lysines), modify equal energy using this SUMO decorating site of gene editing technology revulsion or the SUMO for lowering this site
The deacetylation activity of enough significantly activation SIRT3, and and then regulate and control the Metabolism of Mitochondria of its participation, include promoting the fat of mitochondria
Fat acid oxidase and oxidative phosphorylation activity, can promoteT cell survive, promote memory t cell antitumor activity,
Promote hematopoiesis function and weight-reducing of blood stem cell etc..
The present invention also further provides SIRT3SUMO by establishing the mouse of SIRT3SUMO site mutations (K223R) and repaiies
The activity of decorations regulation and control immunocyte, SIRT3K223R mouseT cell survives time lengthening, lymphocyte packet in vitro
Memory t cell is included significantly to increase.The antitumor of memory t cell of SIRT3K223R, which is exempted from, to be shown to mouse tumor model observation
Epidemic disease activity significantly increases.Therefore, in T cell SIRT3SUMOization modification K288 sites or regulate and control SIRT3 SUMOization modify because
Son by be modulating T cell activity and antineoplastic immune novel targets.
It is that mitochondria SIRT3 specificity removes SUMO modification enzymes that the present invention, which proposes SENP1, removes the SUMO modifications of SIRT3,
And then significantly increase the activity of SIRT3.Under the action of metabolic stress factor, SENP1 enters from cytoplasm in mitochondria, urges
Change the Go to SUMOization of SIRT3, so as to activate the deacetylation of SIRT3 active and reduce the acetylation water of protein in mitochondria
It is flat, change the metabolic activity of mitochondria, particularly promote fatty acid oxidation and oxidative phosphorylation activity of mitochondria etc..Therefore,
SENP1 is the important upstream regulatory factors of SIRT3 (being known as SENP1-SIRT3 regulation and control axis).Present invention further proposes answering
Under the conditions of swashing, the SUMOization modification of SIRT3K288 site mutations or activation SENP1 removals SIRT3 can activate SIRT3 to join
With the fatty acid oxidation of regulation and control, so as to which the energetic supersession for making cell is changed by the oxidative phosphorylation based on glucose with aliphatic acid
Based on oxidative phosphorylation, this this metabolic stress of damage caused by overcoming to(for) cell is highly important.It is of the present invention
Stressed condition includes cell starvation caused by being reduced due to glucose supplies, the energy such as some metabolites and some cell factors
Enough regulate and control the S180 phosphorylations of SENP1, so as to regulate and control Metabolism of Mitochondria and function by SENP1-SIRT3 axis.
Wherein, the regulatory mechanism that SENP1 enters cell mitochondrial is that phosphorus occurs for the serine (S180) of SENP1 the 180th
Acidification modification, SENP1 are transported into mitochondria, and and then activation SIRT3.Wherein, metabolic stress factor can promote (as hungry)
The AMPK of activation carries out phosphorylation modification to the serine (S180) of SENP1 the 180th, and SENP1 is promoted to be displaced into mitochondria
Matrix.And intervene AMPK or be mutated this site of S180 and prevent SENP1 from phosphorylation modification occurs, it will all prevent SENP1
It transports in mitochondria, SENP1 is caused to be reduced in Intramitochondrial positioning, cannot also start the Go to SUMOization and line to SIRT3
The regulation and control of plastochondria metabolic activity.The present invention is detached by subcellular components, and the experimental methods such as fluorescence localization and immune colloid gold carry
The SUMO specific proteases SENP1 for having gone out people source can be located in mitochondrial matrix.In addition, the stressed conditions such as starvation conditions
More SENP1 can be promoted to enter mitochondria.The present invention identifies SENP1 by mass-spectrometric technique can occur phosphorylation modification,
Phosphorylation site is the serine (S180) of the 180th.Further experiment proves the 180th generation phosphorylation modification of SENP1
It is their ability to the committed step into mitochondria.Under the conditional stimulus such as starvation, the protein kinase A MPK quilts of intracellular AMP dependences
Activation, AMPK directly carry out phosphorylation modification to the S180 sites of SENP1, and SENP1 is promoted to be displaced into mitochondria, reduce line grain
The SUMOization modification of vivo protein, such as SIRT3 strengthen mitochondria fatty acid oxidation, promote ATP, acetyl coenzyme A and ketoboidies
Generation, so as to improve mitochondria response environment stress ability.Therefore, the phosphorylation modification of SENP1S180 is a kind of new
Regulation and control mitochondrial function important way.Based on these as a result, whether being improved simultaneously for mitochondrial function with a variety of metabolism
Property and immunity disease occur important relation, the present invention will for research mitochondrial disease new strategy and therapy target will be provided.
The invention also provides using the S180 site phosphorylations of SENP1 as mark, promote SENP1S180 sites phosphorus to screen
The compound of acidification, these compounds can regulate and control the Metabolism of Mitochondria activity and phase that SIRT3SUMO modifications participate in by SENP1
The function of physiology and pathology is closed, so as to application prospect.Therefore, the factor of SENP1S180 site phosphorylations modification is promoted to lead to
Cross regulation and control SENP1-SIRT3 axis has important application prospect in physiology and pathologic process.Compared with prior art, the present invention is aobvious
The advantageous effect of work is：
Present invention firstly provides the SUMO decorating sites of SIRT3 and the signals-modulating path of SENP1-SIRT3 axis,
Have studied its significance in terms of Metabolism of Mitochondria and antineoplastic immune.This regulation and control can influence Metabolism of Mitochondria, shadow
Ring the activation of macrophage and T cell and the influence to tumour immunity and tumour growth.The present invention will further facilitate for
The understanding acted in immunologic cellular activity regulation and control in Metabolism of Mitochondria.The present invention has parsed SENP1-SIRT3 axis to cell metabolism
Inhibit the effect in being formed and mechanism with tumour immunity, new active cell can be inspired to be metabolized the strategy with tumour immunity.
The invention also provides the compound for promoting SENP1 that phosphorylation occurs swashs in the deacetylation activity for preparing SIRT3
The drug for agent, the drug for treating Metabolism of Mitochondria function relevant disease, prevention and/or the treatment tumour of living or prevention and/or treatment
Application in the drug of immune correlated disease.
The invention also provides the compound that phosphorylation occurs for the serine for promoting SENP1 the 180th is preparing SIRT3's
Deacetylation activity activator, regulate and control the drug of Metabolism of Mitochondria function, prevention and/or treat tumour drug or prevention and/
Or the application in the drug for the treatment of immune correlated disease.
The invention also provides SENP1 is promoted to enter Intramitochondrial compound from cytoplasm to prepare going for SIRT3
Acetylation activity activator, regulate and control the drug of Metabolism of Mitochondria function, prevention and/or treat tumour drug or prevention and/or
Treat the application in the drug of immune correlated disease.
The invention also provides protein kinase A MPK in the drug of S180 site phosphorylations modification for preparing SENP1, SIRT3
Deacetylation activity activator, regulate and control the drug of Metabolism of Mitochondria function, prevention and/or drug or the prevention for the treatment of tumour
And/or the application in the drug for the treatment of immune correlated disease.
The invention also provides protein kinase A MPK activator in the S180 site phosphorylations modification for preparing promotion SENP1
Drug, the deacetylation activity activator of SIRT3, the drug for regulating and controlling Metabolism of Mitochondria function, prevention and/or the medicine for treating tumour
Application in the drug of object or prevention and/or treatment immune correlated disease.
The invention also provides promote the compound of SIRT3 deacetylations activity in the deacetylation activity for preparing SIRT3
Activator regulates and controls the drug of Metabolism of Mitochondria function, prevention and/or treats the drug of tumour or prevention and/or the immune phase for the treatment of
Application in the drug of related disorders.
SUMO modificationizations or the change that SIRT3SUMO modificationizations site can be mutated are gone the invention also provides SIRT3 is promoted
It is swollen in the deacetylation activity activator for preparing SIRT3, the drug for regulating and controlling Metabolism of Mitochondria function, prevention and/or treatment to close object
Application in the drug of the drug of knurl or prevention and/or treatment immune correlated disease.
The invention also provides the lysine SUMO decorating sites for promoting SIRT3 the 288th go SUMO modificationizations or mutation
The compound in the lysine SUMO modificationizations site of SIRT3 the 288th is in deacetylation activity activator, the tune for preparing SIRT3
It controls the drug of Metabolism of Mitochondria function, the drug of prevention and/or treatment tumour or prevention and/or treats immune correlated disease
Application in drug.
In the present invention, the Metabolism of Mitochondria function relevant disease includes obesity, tumour, aging, neurodegenerative disease
Deng.
In the present invention, the treatment Metabolism of Mitochondria function relevant disease includes promoting aliphatic acid oxygen in mitochondria mitochondria
Change and oxidative phosphorylation.
In the present invention, the tumour, obesity, chronic viral infection disease, neurodegenerative disease etc..
In the present invention, the growth for preventing and/or treating tumour and refer to inhibit tumour cell promotes memory t cell
Antitumor activity.
In the present invention, the immune correlated disease includes autoimmune disease, chronic viral infection disease etc..
In the present invention, the prevention and/or treatment immune correlated disease are by regulating and controlling the activity of immunocyte, influencing macrophage
Activation, the promotion/extension of cell and T cellThe surviving of T cell, increase lymphocyte include memory t cell quantity,
Increase periphery lymphocyte quantity, increase mitochondrial fusion process, the hematopoiesis function of blood stem cell is promoted to realize.
In the present invention, the activator, drug are used for T cell.
Serine (S180) the generation phosphorylation that the present invention proposes SENP1 the 180th is that SENP1 is transported in mitochondria
Necessary to activation SIRT3.The present invention proposes a kind of new mechanism of regulation and control Metabolism of Mitochondria and function：With SENP1's
S180 site phosphorylations are mark, and to screen the compound for promoting SENP1S180 phosphorylations, these compounds can pass through
The Metabolism of Mitochondria activity and relevant physiological and the function of pathology that SENP1 regulation and control SIRT3SUMO modifications participate in.Change
SIRT3SUMO modifies relevant with mitochondria physiology and pathologic process is closely related, screen SENP1S180 site phosphorylations because
Son has wide application prospect to the SUMO of the SIRT3 regulation and control modified and mutation and its in relevant disease prevention.
Description of the drawings
Fig. 1 is to identify that the schematic diagram of SUMOization modification can occur for mitochondrial protein SIRT3.
Fig. 2 sequence species conservative schematic diagrames where SIRT3SUMO decorating sites.
Fig. 3 is SIRT3SUMOization decorating site schematic diagram for identification K288.
Fig. 4 is that SIRT3SUMO modifies protease schematic diagram for identification SENP1.
Fig. 5 is influence schematic diagram of the SIRT3SUMO decorating sites mutation to its substrate deacetylation level.
Fig. 6 influences Mitochondria schematic diagram for SIRT3SUMO decorating sites.
Fig. 7 influences fatty acid oxidation schematic diagram for SIRT3SUMO decorating sites.
Fig. 8 builds schematic diagram for SIRT3SUMO decorating sites mutant mice.
Fig. 9 analyzes schematic diagram for SIRT3K223R mouse metabolism cages.
Figure 10 is fatty acid oxidation schematic diagram under SIRT3K223R mouse liver tissue starvation situations.
Figure 11 enhances IL-4 inducing macrophages oxidative phosphorylation metabolism and M2 phenotype schematic diagrames for SIRT3K223R.
Figure 12 is that CD8+ memory T cells increase in SIRT3K223R mouse spleens.
Figure 13 enhances for SIRT3K223R mouse CD8+ memory T cells survival ability.
Figure 14 is influences of the SIRT3K223R to CD8+ memory T cell metabolic patterns
Figure 15 enhances CD8+ memory T cell antineoplastic actions for SIRT3K223R
Figure 16 identifies that SENP1 is located at Intramitochondrial schematic diagram for isolation of cellular components.
Figure 17 is the schematic diagram that immune colloid gold experimental verification SENP1 is positioned at mitochondrial matrix.
Figure 18 is that immunofluorescence experiment proves the hungry schematic diagram that SENP1 is promoted to enter mitochondria.
Figure 19 is that phosphorylation modification and the schematic diagram of hungry enhancing SENP1 phosphorylations can occur for SENP1.
180 mutant serines that Figure 20 is SENP1 are into cannot after the alanine form that phosphorylation modification cannot occur
Into the schematic diagram of mitochondria.
Specific embodiment
With reference to specific examples below and attached drawing, the present invention is described in further detail.The process of the implementation present invention,
Condition, experimental method etc. in addition to the following content specially referred to, are among the general principles and common general knowledge in the art, this hair
It is bright that content is not particularly limited.
The immune precipitation identification SIRT3SUMO method of modifying of embodiment 1
SIRT3-Flag and HA-SUMO1 to 293T cell extraction mitochondrial fractions are transfected first, then pass through M2-Flag
Affinity gel (Sigma, A2220) or HA magnetic beads (Thermo, 88836) carry out immunoprecipitation experiment, use
Flag (Sigma, M2) and HA (Sigma, HA-7) antibody are detected, and detect the SIRT3SUMO Decorative strips of 51kDa sizes
Band (Fig. 1).Endogenous SIRT3SUMOization modification uses SIRT3 by extracting liver cancer cell lines SMMC7721 mitochondrial fractions
(Cell Signaling, 5490) antibody mediated immunity precipitation, then with SIRT3 (Cell Signaling, 5490) and SUMO1
(Abcam, 32058) antibody is detected, and also detects that the SIRT3SUMO Decorative strips band (Fig. 1) of 49kDa sizes.Then, will
SIRT3-Flag, HA-SUMO1 and RGS-SENP1 plasmid co-transfection extract mitochondrial protein and with Flag antibody to 293T cells
Immune precipitation is done, the SENP1 for showing to be overexpressed with Flag and HA antibody test results can remove the SIRT3 of SUMO modifications, together
When with the plasmid RGS-SENP1m (R630L, K631M) of SENP1 enzyme activity saltant types cannot then remove (Fig. 4) instead of RGS-SENP1.
Result above prove SIRT3 be mitochondria SUMO modification albumen and SENP1 be its Go to SUMOization protease.
It is the sequence cloned into people's Sirt3 genes of plasmid below：
001atggcgttctggggttggcgcgccgcggcagccctccggctgtggggccgggtagttgaa 060
061cgggtcgaggccgggggaggcgtggggccgtttcaggcctgcggctgtcggctggtgctt 120
121ggcggcagggacgatgtgagtgcggggctgagaggcagccatggggcccgcggtgagccc 180
181ttggacccggcgcgccccttgcagaggcctcccagacccgaggtgcccagggcattccgg 240
241aggcagccgagggcagcagctcccagtttcttcttttcgagtattaaaggtggaagaagg 300
301tccatatctttttctgtgggtgcttcaagtgttgttggaagtggaggcagcagtgacaag 360
361gggaagctttccctgcaggatgtagctgagctgattcgggccagagcctgccagagggtg 420
421gtggtcatggtgggggccggcatcagcacacccagtggcattccagacttcagatcgccg 480
481gggagtggcctgtacagcaacctccagcagtacgatctcccgtaccccgaggccattttt 540
541gaactcccattcttctttcacaaccccaagccctttttcactttggccaaggagctgtac 600
601cctggaaactacaagcccaacgtcactcactactttctccggctgcttcatgacaagggg 660
661ctgcttctgcggctctacacgcagaacatcgatgggcttgagagagtgtcgggcatccct 720
721gcctcaaagctggttgaagctcatggaacctttgcctctgccacctgcacagtctgccaa 780
781agacccttcccaggggaggacattcgggctgacgtgatggcagacagggttccccgctgc 840
841ccggtctgcaccggcgttgtgaagcccgacattgtgttctttggggagccgctgccccag 900
901aggttcttgctgcatgtggttgatttccccatggcagatctgctgctcatccttgggacc 960
961tccctggaggtggagccttttgccagcttgaccgaggccgtgcggagctcagttccccga 1020
1021ctgctcatcaaccgggacttggtggggcccttggcttggcatcctcgcagcagggacgtg 1080
1081gcccagctgggggacgtggttcacggcgtggaaagcctagtggagcttctgggctggaca 1140
1141gaagagatgcgggaccttgtgcagcgggaaactgggaagcttgatggaccagacaaatag 1200
Embodiment 2SIRT3SUMO decorating site identification methods
It is compared by protein amino acid sequence, the results showed that there is one around 8 lysines of SIRT3 protein 28s of people
Consensus sequence ψ-K- χ-the D (ψ is a hydrophobic amino acid residue, and χ is arbitrary amino acid residue) of a SUMO modifications, and this
Sequence is conservative (Fig. 2) in different plant species.With lower pair of primer by PCR method by the 288th on SIRT3 plasmids
Lysine mutation is arginine, then by the plasmid co-transfection of the plasmid of SIRT3K288R and SUMO1 into 293T cells, with
SIRT3WT plasmids pass through M2-Flag affinity gel (Sigma, A2220) or HA magnetic as positive control
Beads (Thermo, 88836) carries out immunoprecipitation experiment, is carried out with Flag (Sigma, M2) and HA (Sigma, HA-7) antibody
Detection, the results showed that after 288 lysine mutations of SIRT3, SUMOization modification cannot occur for SIRT3, i.e., K288 is
SIRT3SUMOization decorating site (Fig. 3).
SIRT3K288R fwd 5’-cggcgttgtgaggcccgacattg-3’
SIRT3K288R rev 5’-caatgtcgggcctcacaacgccg-3’
Embodiment 3 proves that SIRT3SUMO modifications are inhibited to the deacetylation level of SIRT3
By the stable transfection Flag-SIRT3WT in the liver cancer cells SMMC7721 of endogenous SIRT3 gene silencings or
Flag-SIRT3K288R plasmids establish Flag-SIRT3WT or Flag-SIRT3K288R expression cells system.Pass through Acetyl-
Lys (Cell Signaling, 9441) antibody carries out immune precipitation, then with the target of the deacetylation of known SIRT3 modification
Protein antibodies such as SOD2 (Abcam, 13534), LCAD (Abcam, 196655), HMGCS2 (Abcam, 137043), AceCS2
(Abcam, 66038) is detected, the results showed that SIRT3K288R has higher deacetylation enzymatic activity (Fig. 5) than wild type.
4 Mitochondria level detection method of embodiment
10 are about spread in a hole of XF96-well minitype plates (Seahorse Bioscience)4Cell, if metabolism
It stress handle or be detected after not handling 6 hours at 37 DEG C with XF96 analyzers (Seahorse Bioscience), wherein
2 μM of oligomycin, 0.25 μM of FCCP and 0.5 μM of rotenone/antimycin are respectively used to detection backup breaths ability,
Maximum breathing value and ATP generation situations.After result finds out the mutation of SIRT3SUMO decorating sites, oxidative phosphorylation and ATP are horizontal
(Fig. 6) higher than wild type.
5 mitochondrial fatty acid oxidase analysis method of embodiment
The mitochondria lysate of cell is precipitated by the acetonitrile containing internal standard compound, obtains upper suspension by centrifugation, so
It is detected afterwards by tandem mass spectrum (TSQ Vantage, Thermo Fisher Scientific), by there are one bands
XBridgeTM Amide guard columns (2.1 × 10mm, 5 μm；Waters) XBridgeTM Amide column (2.1 ×
150mm,5μm；Waters chromatography) is carried out.Mobile phase is by 10mM ammonium acetate solutions (phase A) and acetonitrile (phase
B it) forms.L-carnitine, acylcarnitines and other internal references (Sigma-Aldrich) pass through cationic multiple reaction
Monitoring pattern (MRM) is analyzed, and data file is raw by 2.7 softwares of LCquan (Thermofisher Scientific)
Into.
The present invention is said the result shows that the amount of long chain fatty acids intermediate product is low compared with wild type in SIRT3K288R mutant cells
Bright SUMO modifications inhibit the activity of deacetylase of SIRT3 and the Fatty acids oxidation (Fig. 7) of mediation.
Embodiment 6 builds SIRT3K223R mouse
Using CRISPR/Cas9gene targeting technologies, structure is directed to the gRNA of Sirt3 genes, and in-vitro transcription is
MRNA instructs Cas9 albumen to shear DNA double chain in specific site, while the donor oligo of 99bp are integrated by homologous recombination
Enter destination locations (Fig. 8).After the super ovulation of embryonic donor mouse (C57BL/6), PMSG processing Donor females mouse are noted after 46 hours
HCG is penetrated, mates and mates with male mice, next day takes fertilized eggs to carry out microinjection.Then embryo transfer is carried out, embryo transfer
Mouse will birth in 19 days or so after surgery, tail (or toe) extraction DNA is cut after mouse is born about 7 days and carries out PCR identifications,
It obtains Founder mouse to mate to obtain the first generation with wild-type mice (C57BL/6), treats male Founder mouse to 7 week old,
Female mice can mate, PCR is identified after mouse is born 20 days to 4 week old with wild type opposite sex mouse respectively.If there is positive mice
Birth, then it represents that transgenosis has been integrated into reproduction cell, and mark strain is successfully established.The mutant mice is in normally raising situation
Lower and wild type does not have apparent difference.
Used sequence is as follows：
gRNA:CCCGATATCGTCTTTTTTGGGGA
Donor Oligo(99bp)：
GACAGGGTGCCCCGCTGCCCTGTCTGTACTGGCGTTGTGAGACCCGATATCGTCTTTTTTGGGGAGCAG
CTGCCTGCAAGGTTCCTACTCCATATGGCT
To primer before the identification of SIRT3K223R mouse：5’-GGGACCATTACAGAGTGAAGA-3’
SIRT3K223R mouse identify reverse primer：5’-CATACAGAGCCACAGACATACC-3’
Embodiment 7 studies the metabolism of SIRT3SUMO decorating site mutant mices
Metabolic cage experiment, each mouse point are carried out using 6 months male mices of C57BL/6 wild types and SIRT3K223R
(Research Diets, Inc.) is fed for normal diet and is not fed within 24 hours only for water two groups (n=4).Minispec
TD-NMR Analysers (Bruker instruments) are then placed in metabolic cage (Columbus for assessing body fat content
Instruments) for assessing feed, energy expenditure, oxygen consumption, carbon dioxide generation and activity situations such as, animal feeding and reality
It tests fully according to experimental animal Ethics Committee of Medical College, Shanghai Communication Univ. standard operation.The present invention is the result shows that normally raising
Under the conditions of supporting, the oxygen consumption of SIRT3K223R mouse and carbon dioxide generation are significantly higher than wild-type mice, illustrate the metabolism of SIRT3
In higher level (Fig. 9).And then the liver mitochondrion component of mouse is separated and carries out fatty acid oxidation mass spectral analysis,
The result shows that the long-chain fat acid product in SIRT3K223R mouse liver cells is significantly low compared with wild-type mice, explanation
SIRT3K223R has higher activity.In starvation, wild-type mice liver cell long-chain fat acid product significantly reduces, but
SIRT3K223R mouse are then without significantly changing (Figure 10).
Embodiment 8SIRT3K223R enhancing IL-4 inducing macrophages oxidative phosphorylation metabolism and M2 phenotypes
Bone marrow macrophage is detached from SIRT3WT and SIRT3K223R mouse, in vitro at IL-4 under condition of culture
24 hours are managed, analyze cell oxygen consumption and facs analysis CD206+CD301+ macrophages (M2) quantity with Seahorse, as a result
The M2 cells for showing the oxygen consumption of IL-4 induction SIRT3K223R macrophages and being formed dramatically increase (figure compared with wild type macrophage
11), illustrate that SIRT3K223R mutation can enhance the oxidative phosphorylation metabolism of macrophage and M2 phenotypes.
CD8+ memory T cells quantity and ratio increase in embodiment 9SIRT3K223R mouse spleens
T cell differentiation and development in thymus gland is ripe, and ripe CD8+ enters with CD4+T cells in spleen and lymph node.This
Inventive result shows that the thymus gland of SIRT3K223R mouse and spleen significantly increase, and total number of cells increase (Figure 12-a, b).Further
Streaming facs analysis the results show that its T cell cell proportion for developing each stage is without exception, but CD4SP (single
Positive, SP)/CD8SP/Double Positive (DP)/Double Negative (DN) and DN1/3/4 cell number
Amount significantly increases.Obtained in spleen it is similar as a result, CD8+ memory T cell central memory T cells (TCM)/
Effector memory T cells andThe cell quantity of T cells significantly increases, and wherein TCM accounts for CD8+T
The cell proportion of cells also significantly increases (Figure 12-c).Based on the above results, SIRT3K223R does not influence the development of T cell
Journey, but T cell number can be caused, the number of especially CD8+TCM increases.
Embodiment 10SIRT3K223R mouse CD8+ memory T cells survival ability enhances
Further to probe into the reason of CD8+T cells cell quantities increase, the present invention starts in terms of two, first, passing through
FACS Ki67 dyeing detect its cellular proliferative potential, the results showed that the multiplication potentiality of SIRT3K223R mouse CD8+T cells without
It significantly changes (Figure 13-a).And on the other hand, show CD8+TCM's and TN by PI (propidium iodide) cell viability coloration result
Cell viability KR groups are significantly higher than WT groups (Figure 13-b).The result prompts SIRT3K223R of the present invention that may improve CD8+TCM
With the survival survival abilities of TN.Therefore, the present invention sorted in spleen CD8+TN cells ( CD8+T cells
Isolation kit, Stem cell) and induce 3 with anti-CD3/CD8+IL2 Activation In Vitros 3 days, then with cell factor IL15
It obtains T memory (IL15-TM) (Buck et al., 2016).Then the method for 7AAD dyeing detection cell viabilities is utilized
(van der Windt et al., 2012), has detected CD8+TN and IL15-TM (1x105) it is non-stimulated in vitro under the conditions of train
Support the survival ability of 3 days, the results showed that the Motility ability of SIRT3K223R CD8+TN/IL15-TM cells is significantly higher than WT
Group (Figure 13-c, d).Meanwhile the present invention in the Recipient mice of IL15-TM tail vein injections to CD45.1, will be detected after 2 days its
Spleen and the viable count in peripheral lymph node, consistent with Motility result, IL15-TM is in spleen and lymph node for K223R groups
In internal survival ability equally be higher than WT groups (Figure 13-e, f).
Influences of the embodiment 11SIRT3K223R to CD8+ memory T cell metabolic patterns
It is similar with the result obtained in liver, mitochondria state and the metabolism of the controllable CD8+T cells of SIRT3K223R
Pattern.It using mito-tracker Green labeled mitochondrias, and is detected with FACS, as a result shows K223R groups CD8+IL15-TM
(memory) T cell mito-tracker MFI are significantly higher than WT groups, show that mitochondria mass increases, prompt mitochondrial fusion
The increase (Figure 14-a) of mito fusion.Immunofluorescence mito-tracker Green have obtained same as a result, K223R TM
Mitochondria mass is higher than WT groups, and there are the increases (Figure 14-b) of mito fusion.In addition, dye detection line using JC-1
Mitochondrial membrane potential MMP (Mitochondrial membrane potential), the JC- of SIRT3K223R groups TE and TM
1monomers is substantially less than WT groups, shows its MMP higher than WT groups, and MMP more stable K223R is conducive to maintaining cell just
Normal physiological function (Figure 14-c).Further metabolic fluxes result show SIRT3K223R TM oxidative phosphorylations OCR increase (Figure 14-
d)；Meanwhile TM cells are increased, and can generate more ATP and Acetyl-coA (Figure 14-e) using the ability of long chain fatty acids.
In conclusion the mitochondria mass and fusion of SIRT3-K223R CD8+IL15-TM increase, membrane potential MMP increases；It is metabolized mould
Formula is partial to oxidative phosphorylation increase, is enhanced using the ability of long chain fatty acids, can more effectively generate ATP energy supplies.With the previous generation
The change for thanking to pattern is conducive to the long-term surviving of TM cells.
Embodiment 12SIRT3K223R enhances effect of the CD8+ memory T cells survival ability in T cell is antitumor
CD8+T cells are the important effect cells of immune system fight tumour, enhance CD8+TM for research SIRT3K223R
Whether ability of the survival ability in antitumor enhances, and the present invention constructs SIRT3K223R CD45.2OT1 mouse (its CD8+T
Cell can be by oralbumin polypeptide OVA Peptide (257-264), antigen-specific activation), separation WT and K223R mouse
CD8+TN after, activate TN by the use of OVA peptides as antigen in vitro, equally generate IL15-TM using IL15 inductions, then will be similary
Number (1x106) WR and KR group IL15-TM cells pass through in tail vein injection adoptive transfer to Recipient mice CD45.1 mouse.
After adoptive transfer IL15-TM7 days, in Recipient mice back inoculation MC-38 colon cancer cells (1x106), and continuously monitoring is swollen
Knurl is grown.As a result it shows：To adopt tumour growth size in K223R CD8+IL15-TM group Recipient mices, weight is respectively less than WT groups,
The CD45.2+ in the tumor-infiltrated T cell of K223R groups is higher than WT groups with OVA specific antigen epitope H2Kb+ cell proportions simultaneously
(Figure 15).The above result shows that SIRT3K223R can enhance the survival ability of CD8+TM by the change of metabolic patterns, more favorably
In its effect in antitumor.
13 cell starvation method of embodiment
Normal cell culture containing 10% serum Dulbecco ' s modified Eagle ' s medium (DMEM,
4500mg/l glucose, 4mM L-glutamine) in, when starvation stimulates, cell culture is in the DMEM without serum
In (1000mg/l glucose, 4mM L-glutamine), processing time is 4 hours.
14 nucleus of embodiment, cytoplasm and mitochondria separation
Collect cell：It is washed one time with PBS, with a concentration of 0.25% trypsin digestion cell, cell is collected by centrifugation；Collection group
It knits：Animal is organized into preserving after putting to death on ice, no more than one hour；Wash cell：The PBS being pre-chilled with ice bath is gently weighed
Outstanding cell precipitation takes a small amount of cell for counting, and remaining cell centrifuges 5 minutes sedimentation cells with 600g at 4 DEG C, abandons supernatant；It washes
Wash tissue：It weighs in 1.5ml centrifuge tubes to the tissue of clip, weight is about 50-100mg, be washed once with PBS, is used
Scissors cuts into tissue very tiny fragment；Add in 1ml mitochondrias separating liquid [210mM mannitol, 70mM
Sucrose, 5mM Tris-HCl (pH 7.5), 1mM EGTA, 0.5mg/ml BSA] in cell or tissue, gently piping and druming is thin
Born of the same parents place 10-15 minutes on ice；Cell suspension is transferred in Dounce homogenizers, is homogenized 30 times or so；The mirror of homogenization effect
It is fixed：Homogenate number needed for different cell difference homogenizers is different, need to voluntarily optimize.It can usually be taken after being homogenized 10 times
About 2ul cell homogenates adds in 30-50ul Trypan Blue liquid, observation trypan blue stained positive (blue) under microscope after mixing
The ratio of cell.If positive cell ratio less than 50%, increases by 5 homogenate.Then the same sampling carries out Trypan Blue again
Identification.It can stop homogenate when positive ratio is more than 50% to enter in next step；Cell homogenates centrifuges 10 points with 600g at 4 DEG C
Clock is precipitated as nucleus P1；Carefully supernatant S1 is transferred in another centrifuge tube, 11,000g, 4 DEG C centrifuge 10 minutes, carefully go
Except supernatant S2, precipitation P2 is isolated cell mitochondrial.
The use of mitochondria：If for the function or enzyme activity research of intact mitochondria, isolated mitochondria sample
150-200ul mitochondrias storing liquid [1.5M sucrose, 1mM EGTA, 10mM Tris HCl can be added in product
(pH7.5)] mitochondria, is resuspended；Face if can be added in for the analysis of protein of mitochondria, in isolated mitochondrial samples
Mitochondria is cracked with the mitochondria lysate for being preceding added to PMSF.Mitochondria after cracking can be used for SDS-PAGE, Western
Measure of blot, IP and some enzymatic activitys in mitochondria etc..
The present invention has detected three main positioning for removing SUMO protease (SENP1-SENP3) in cell：SENP1 master
To be located at nucleus, but SENP1 albumen can be also detected in cytoplasm and mitochondrial fractions；The SENP2 overwhelming majority is positioned at
Nucleus；SENP3 exists in each component of cell.Further mitochondrial fractions are detached, the results showed that SENP3 eggs
It is located at mitochondrial outer membrane in vain, and SENP1 albumen can then be positioned in mitochondrial matrix (Figure 16).
15 immunofluorescence experiment of embodiment
The slide for having climbed cell is gently rinsed 1 time with PBS in culture plate；It is fixed with 4% paraformaldehyde room temperature
Creep plate 15 minutes；PBS rinsings slide 3 times, every time 3 minutes；0.1%Triton X-100, penetrating 20 points of room temperature are prepared with PBS
Clock；PBS rinsings slide 3 times, every time 3 minutes；10% lowlenthal serum is added dropwise on slide, room temperature is closed 30 minutes；Sop up closing
Liquid, every slide are added dropwise the primary antibody diluted with PBS of sufficient amount and are put into wet box, 4 DEG C of overnight incubations；PBS rinses slide 3
It is secondary, 3 minutes every time；The fluorescence secondary antibody for being added dropwise and having diluted after surplus liquid on creep plate is blotted, is protected from light incubation at room temperature 30 minutes；It is protected from light
PBS rinsings slide 3 times, every time 3 minutes；With the mounting fluid-tight piece containing anti-fluorescence quenching, acquired in fluorescence microscopy Microscopic observation
Image.
For the present invention the result shows that with the extension of starvation time, the common location of SENP1 and mitochondrial protein marker are notable
Increase (Figure 18), scale is 50 microns.
16 immune colloidal gold method of embodiment
4% paraformaldehyde (PFA) and 0.2% glutaraldehyde (GA) room temperature fix 1 hour.After cell is fixed, centrifugation removal
Fixer, PB buffer solution for cleaning, low-speed centrifugal remove supernatant, stay a little buffer solution that cell is resuspended.Centrifuge tube is heated to 37 DEG C, together
When 12% (w/v) gelatin is heated to 37 DEG C, gelatin and gentle agitation are added dropwise dropwise, cell is resuspended in 12% gelatin,
37 DEG C are permeated 10 minutes or so, and centrifugation makes cell precipitation get off, then low-temperature setting gelatin.Centrifuge tube tip there is the portion of cell
Divide and be cut into 1mm by knife3Fritter several.It is suitable that the fritter being cut into is put into 4 DEG C of rotation soaked overnights, selection in 2.3M sucrose
Rotary speed and angle kill or collide centrifugation tube wall to prevent sample blocks.The mild freezer box temperature of sample temperature, knife is -80
DEG C, semithin section of the thickness for 200nm or so is first obtained before ultra-thin section is carried out, is observed and is determined with Toluidine blue staining
Position chooses the more region of cell and carries out repairing block progress ultra-thin section.Set the mild freezer box temperature of sample temperature, knife as-
120 DEG C, ultra-thin section is carried out, obtains ultra-thin section of the thickness for 70nm or so, piece is dragged for sucrose, is pressed in and is covered with Formvar films
Contained network on.Contained network is tipped upside down on 2% gelatin plate, 37 DEG C are kept for 20 minutes or more；0.02M glycine is washed 2 times, every time 2 points
Clock；1% bovine serum albumin(BSA) BSA is incubated 2 minutes；Antibody is diluted with 1%BSA, 4 DEG C are placed on overnight incubation in wet box；0.1%
BSA is rinsed 4 times, every time 2 minutes；Immuno-gold labeling is incubated at room temperature 25 minutes；0.1%BSA is washed 2 times, and 2 minutes every time, PBS washed 4
It is secondary, 2 minutes every time；1% glutaraldehyde, 5 minutes；PBS is washed 2 times, and 5 minutes every time, distilled water rinsed at least 6 times, every time 1 minute；
2% uranium acetate UA (pH7), 5 minutes；Go over distilled water rapidly；Base cellulose-uranium acetate (MC-UA) is incubated packet
It buries, is operated on ice, after preceding two drop MC-UA drops are quickly incubated, into third MC-UA drops, and stopped 5-10 minutes,
Contained network is taken out, sucks extra MC-UA drops, it is dry to form film, Electronic Speculum observation.
After the present invention carries out cryoultramicrotome to MEF cells, with the SENP1 albumen in immuno-gold labeling cell,
The result shows that SENP1 albumen is not only present in nucleus and cytoplasm, it can also be located in mitochondrial internal (Figure 17).Cyto tables
Show cytoplasm, Mt represents mitochondria, and N represents nucleus, and scale is 500 nanometers.
Embodiment 17 identifies the phosphorylation modification of SENP1
Flag-SENP1 is transfected into 293T cells first, 24-48h harvests cell after transfection；Xian one is gently floated with PBS
Time, 1ml PBS are added, cell suspension are transferred in 1.5ml EP pipes with rifle or cell scraper, 4 DEG C, 800g is centrifuged 5 minutes
After abandon supernatant；Appropriate cell IP lysis buffers [50mM Tris-HCl (pH7.4), 400mM are added in after extraction mitochondrial fractions
NaCl, 1%Triton X-100,0.1%SDS, 1mM PMSF, PhosSTOP cocktail and protease
Inhibitors], on ice or 4 DEG C crack 30 minutes, 40Hz ultrasounds 3 times, each 10s；After lysate ultrasound 12,000g from
The heart 10 minutes, taking a small amount of lysate, remaining lysate adds in M2-affinity gel (Sigma, A2220) at 4 DEG C as control
It slowly rocks and is incubated 2h progress immune precipitations；It is centrifuged 1 minute with 3,000g speed at 4 DEG C after reaction, by M2-affinity
Gel is centrifuged to tube bottom, carefully sucks supernatant, is washed 3-4 times with 1ml lysis buffers, is eventually adding 2 × SDS sample-loading buffers, and 95
It DEG C boils 5 minutes.The sample prepared is subjected to Western blot, with Anti-Flag (Sigma, M2) and Anti-
Phosphoserine/threonine (Abcam, ab17464) antibody is detected.
The experimental results showed that when cell starvation, the phosphorylation modification enhancing of SENP1 albumen；It is if same on this basis
When with λ-Ppase phosphoric acid enzymatic treatments, will be unable to detect the phosphorylation modification (Figure 19) of SENP1 albumen.
Embodiment 18 identifies SENP1S180 site phosphorylation methods
SENP1S180 is sported the primer of A (alanine) by design on QuikChange websites, with pFLAG-SENP1
Plasmid is template, and the sequence of SENP1-S180A is amplified using PCR reactions, plasmid is extracted after conversion, is through sequence verification site
It is no to be mutated successfully.To be mutated in successful SENP1-S180A plasmid transfections to 293T cells, by co-immunoprecipitation and
Western blot detect the phosphorylation level of SENP1；In addition to identical cell separate mitochondria component, pass through western
Blot detects positioning of the SENP1 in mitochondria.
The result shows that after SENP1S180 phosphorylations are mutated, the positioning in mitochondria substantially reduces, and then line
Whole SUMOization modification enhancing in plastochondria, but the mutation has no effect on its positioning (figure in nucleus and cytoplasm
20)。
The method that the screening of embodiment 19 changes SENP1S180 phosphorylation modifications
By in Flag-SENP1 plasmid transfections to 293T, after 24 hours, compound AICAR (500 μ are added in the medium
M), A769662 (500 μM), Comp.C (4 μM), lactic acid (20mM) or cell factor IL-4 (20ng/ml), are collected after 4-6 hours
Cell detects the phosphorylation of SENP1S180, while point cellifugal mitochondria by co-immunoprecipitation and westernblot
Component, detection SENP1 is in the amount of mitochondria.
The protection content of the present invention is not limited to above example.Without departing from the spirit and scope of the invention, originally
Field technology personnel it is conceivable that variation and advantage be all included in the present invention, and using appended claims as protect
Protect range.
SEQUENCE LISTING
<110>Medical College, Shanghai Communication Univ.
<120>Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 1200
<212> DNA
<213>Artificial sequence
<400> 1
atggcgttct ggggttggcg cgccgcggca gccctccggc tgtggggccg ggtagttgaa 60
cgggtcgagg ccgggggagg cgtggggccg tttcaggcct gcggctgtcg gctggtgctt 120
ggcggcaggg acgatgtgag tgcggggctg agaggcagcc atggggcccg cggtgagccc 180
ttggacccgg cgcgcccctt gcagaggcct cccagacccg aggtgcccag ggcattccgg 240
aggcagccga gggcagcagc tcccagtttc ttcttttcga gtattaaagg tggaagaagg 300
tccatatctt tttctgtggg tgcttcaagt gttgttggaa gtggaggcag cagtgacaag 360
gggaagcttt ccctgcagga tgtagctgag ctgattcggg ccagagcctg ccagagggtg 420
gtggtcatgg tgggggccgg catcagcaca cccagtggca ttccagactt cagatcgccg 480
gggagtggcc tgtacagcaa cctccagcag tacgatctcc cgtaccccga ggccattttt 540
gaactcccat tcttctttca caaccccaag ccctttttca ctttggccaa ggagctgtac 600
cctggaaact acaagcccaa cgtcactcac tactttctcc ggctgcttca tgacaagggg 660
ctgcttctgc ggctctacac gcagaacatc gatgggcttg agagagtgtc gggcatccct 720
gcctcaaagc tggttgaagc tcatggaacc tttgcctctg ccacctgcac agtctgccaa 780
agacccttcc caggggagga cattcgggct gacgtgatgg cagacagggt tccccgctgc 840
ccggtctgca ccggcgttgt gaagcccgac attgtgttct ttggggagcc gctgccccag 900
aggttcttgc tgcatgtggt tgatttcccc atggcagatc tgctgctcat ccttgggacc 960
tccctggagg tggagccttt tgccagcttg accgaggccg tgcggagctc agttccccga 1020
ctgctcatca accgggactt ggtggggccc ttggcttggc atcctcgcag cagggacgtg 1080
gcccagctgg gggacgtggt tcacggcgtg gaaagcctag tggagcttct gggctggaca 1140
gaagagatgc gggaccttgt gcagcgggaa actgggaagc ttgatggacc agacaaatag 1200
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
cggcgttgtg aggcccgaca ttg 23
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence
<400> 3
caatgtcggg cctcacaacg ccg 23
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence
<400> 4
cccgatatcg tcttttttgg gga 23
<210> 5
<211> 99
<212> DNA
<213>Artificial sequence
<400> 5
gacagggtgc cccgctgccc tgtctgtact ggcgttgtga gacccgatat cgtctttttt 60
ggggagcagc tgcctgcaag gttcctactc catatggct 99
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence
<400> 6
gggaccatta cagagtgaag a 21
<210> 7
<211> 22
<212> DNA
<213>Artificial sequence
<400> 7
catacagagc cacagacata cc 22
Claims (15)
1. promote SENP1 occur phosphorylation compound prepares SIRT3 deacetylation activity activator, treat mitochondria generation
Thank the drug of function relevant disease, the drug of prevention and/or treatment tumour or the medicine of prevention and/or treatment immune correlated disease
Application in object.
2. promote the serine of SENP1 the 180th that the compound of phosphorylation occurs in the deacetylation activity activator for preparing SIRT3
Agent regulates and controls the drug of Metabolism of Mitochondria function, prevention and/or treats the drug of tumour or prevention and/or the immune related disease for the treatment of
Application in the drug of disease.
3. promote SENP1 from cytoplasm enter Intramitochondrial compound the deacetylation activity activator for preparing SIRT3,
Regulate and control the drug of Metabolism of Mitochondria function, the drug of prevention and/or treatment tumour or prevention and/or treatment immune correlated disease
Drug in application.
4. protein kinase A MPK swashs in the drug of S180 site phosphorylations modification for preparing SENP1, the deacetylation activity of SIRT3
Correlation is immunized in the drug for agent, the drug for regulating and controlling Metabolism of Mitochondria function, prevention and/or the treatment tumour of living or prevention and/or treatment
Application in the drug of disease.
5. the drug that protein kinase A MPK activator is modified in the S180 site phosphorylations for preparing promotion SENP1, SIRT3's goes second
It is acylated activity activator, the drug for regulating and controlling Metabolism of Mitochondria function, prevention and/or treats the drug of tumour or prevent and/or control
Treat the application in the drug of immune correlated disease.
6. promote the compound of SIRT3 deacetylation activity in deacetylation activity activator, the regulation and control mitochondria for preparing SIRT3
In the drug of metabolic function, the drug of prevention and/or treatment tumour or the drug of prevention and/or treatment immune correlated disease
Using.
7. SIRT3 is promoted to go SUMO modificationizations or the compound in SIRT3SUMO modificationizations site can be mutated to prepare SIRT3's
Deacetylation activity activator, regulate and control the drug of Metabolism of Mitochondria function, prevention and/or treat tumour drug or prevention and/
Or the application in the drug for the treatment of immune correlated disease.
8. the lysine SUMO decorating sites of SIRT3 the 288th is promoted to go SUMO modificationizations or be mutated relying for SIRT3 the 288th
The compound in propylhomoserin SUMO modificationizations site prepare SIRT3 deacetylation activity activator, regulation and control Metabolism of Mitochondria function
Drug, prevention and/or treat tumour drug or prevention and/or treatment immune correlated disease drug in application.
9. such as any one of them application of claim 1~8, which is characterized in that the Metabolism of Mitochondria function relevant disease
Including obesity, tumour, aging, neurodegenerative disease.
10. such as any one of them application of claim 1~8, which is characterized in that the treatment Metabolism of Mitochondria function is related
Disease includes promoting fatty acid oxidation and oxidative phosphorylation in mitochondria mitochondria.
11. such as any one of them application of claim 1~8, which is characterized in that the tumour, obesity, slow virus are sexy
Infectious diseases, neurodegenerative disease.
12. such as any one of them application of claim 1~8, which is characterized in that the prevention and/or treatment tumour refer to
Inhibit the growth of tumour cell, promote the antitumor activity of memory t cell.
13. such as any one of them application of claim 1~8, which is characterized in that the immune correlated disease is exempted from including itself
Epidemic disease disease, chronic viral infection disease.
14. such as any one of them application of claim 1~8, which is characterized in that the prevention and/or the immune correlation for the treatment of
Disease is by regulating and controlling the activity of immunocyte, influencing activation, the promotion/extension of macrophage and T cellT cell into
Living, increase lymphocyte includes memory t cell quantity, increases periphery lymphocyte quantity, increase mitochondrial fusion process, promote
It is realized into the hematopoiesis function of blood stem cell.
15. such as any one of them application of claim 1~8, which is characterized in that the activator, drug are used for T cell.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711349811.2A CN108144062A (en) | 2017-12-15 | 2017-12-15 | Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application |
| PCT/CN2018/120039 WO2019114647A1 (en) | 2017-12-15 | 2018-12-10 | Senp1 phosphorylation modification regulating compound, sirt3 sumo modification compound, and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711349811.2A CN108144062A (en) | 2017-12-15 | 2017-12-15 | Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108144062A true CN108144062A (en) | 2018-06-12 |
Family
ID=62467338
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711349811.2A Pending CN108144062A (en) | 2017-12-15 | 2017-12-15 | Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN108144062A (en) |
| WO (1) | WO2019114647A1 (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019114647A1 (en) * | 2017-12-15 | 2019-06-20 | 上海交通大学医学院 | Senp1 phosphorylation modification regulating compound, sirt3 sumo modification compound, and applications thereof |
| CN109908368A (en) * | 2019-01-31 | 2019-06-21 | 中国人民解放军军事科学院军事医学研究院 | A kind of application of SENP1 gene and/or SENP1 albumen in preparation treatment cardiovascular disease medicine |
| CN110791473A (en) * | 2018-08-02 | 2020-02-14 | 广州溯原生物科技有限公司 | Application of human sirt3 gene in stem cell induced differentiation |
| CN112029738A (en) * | 2020-08-18 | 2020-12-04 | 浙江省人民医院 | Human parkin protein acetylation and application thereof in medicine preparation |
| CN112063654A (en) * | 2020-09-17 | 2020-12-11 | 南通大学附属医院 | Construction method of point mutation thrombocytopenia mouse model |
| CN112063603A (en) * | 2020-06-01 | 2020-12-11 | 暨南大学 | Acetylation modified CNP protein marker molecule related to central nervous senescence and application thereof |
| CN113155577A (en) * | 2021-05-08 | 2021-07-23 | 右江民族医学院 | Preparation method for identifying specific protein acetylation modified sample |
| CN114075590A (en) * | 2020-08-18 | 2022-02-22 | 上海市高血压研究所 | Application of SIRT3 mediated macrophage Frataxin deacetylation modification in improvement of inflammatory diseases |
| CN114075590B (en) * | 2020-08-18 | 2024-06-07 | 上海市高血压研究所 | Application of SIRT3 mediated macrophage Frataxin deacetylation modification in improving inflammatory diseases |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104918610A (en) * | 2012-11-13 | 2015-09-16 | 纽斯尔特科学公司 | Compositions and methods for increasing energy metabolism |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108144062A (en) * | 2017-12-15 | 2018-06-12 | 上海交通大学医学院 | Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application |
-
2017
- 2017-12-15 CN CN201711349811.2A patent/CN108144062A/en active Pending
-
2018
- 2018-12-10 WO PCT/CN2018/120039 patent/WO2019114647A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104918610A (en) * | 2012-11-13 | 2015-09-16 | 纽斯尔特科学公司 | Compositions and methods for increasing energy metabolism |
Non-Patent Citations (2)
| Title |
|---|
| JINKE CHENG: "Protein SUMOylation controls mitochondrial metabolism", 《全国华人生物学家大会暨第十六届美洲华人生物科学学会学术研讨会》 * |
| 王艳等: "AMPK对线粒体功能的调节", 《中国细胞生物学学报》 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019114647A1 (en) * | 2017-12-15 | 2019-06-20 | 上海交通大学医学院 | Senp1 phosphorylation modification regulating compound, sirt3 sumo modification compound, and applications thereof |
| CN110791473A (en) * | 2018-08-02 | 2020-02-14 | 广州溯原生物科技有限公司 | Application of human sirt3 gene in stem cell induced differentiation |
| CN109908368A (en) * | 2019-01-31 | 2019-06-21 | 中国人民解放军军事科学院军事医学研究院 | A kind of application of SENP1 gene and/or SENP1 albumen in preparation treatment cardiovascular disease medicine |
| CN112063603A (en) * | 2020-06-01 | 2020-12-11 | 暨南大学 | Acetylation modified CNP protein marker molecule related to central nervous senescence and application thereof |
| CN112063603B (en) * | 2020-06-01 | 2022-05-06 | 暨南大学 | Acetylation modified CNP protein marker molecule related to central nervous senescence and application thereof |
| CN112029738A (en) * | 2020-08-18 | 2020-12-04 | 浙江省人民医院 | Human parkin protein acetylation and application thereof in medicine preparation |
| CN114075590A (en) * | 2020-08-18 | 2022-02-22 | 上海市高血压研究所 | Application of SIRT3 mediated macrophage Frataxin deacetylation modification in improvement of inflammatory diseases |
| CN112029738B (en) * | 2020-08-18 | 2022-04-29 | 浙江省人民医院 | Human parkin protein acetylation and application thereof in medicine preparation |
| CN114075590B (en) * | 2020-08-18 | 2024-06-07 | 上海市高血压研究所 | Application of SIRT3 mediated macrophage Frataxin deacetylation modification in improving inflammatory diseases |
| CN112063654A (en) * | 2020-09-17 | 2020-12-11 | 南通大学附属医院 | Construction method of point mutation thrombocytopenia mouse model |
| CN112063654B (en) * | 2020-09-17 | 2023-04-28 | 南通大学附属医院 | Construction method of point mutation platelet weakness mouse model |
| CN113155577A (en) * | 2021-05-08 | 2021-07-23 | 右江民族医学院 | Preparation method for identifying specific protein acetylation modified sample |
| CN113155577B (en) * | 2021-05-08 | 2023-07-25 | 右江民族医学院 | Preparation method for identifying specific protein acetylation modified sample |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019114647A1 (en) | 2019-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108144062A (en) | Regulate and control SENP1 phosphorylation modifications compound and SIRT3 SUMOization modified compound and its application | |
| Yu et al. | Aryl hydrocarbon receptor activation modulates intestinal epithelial barrier function by maintaining tight junction integrity | |
| Seo et al. | Proteasome activator enhances survival of Huntington's disease neuronal model cells | |
| Hirsch et al. | ERp29 deficiency affects sensitivity to apoptosis via impairment of the ATF6–CHOP pathway of stress response | |
| Katz et al. | Translational research in vitiligo | |
| Wu et al. | Nrf2 overexpression rescues the RPE in mouse models of retinitis pigmentosa | |
| Chen et al. | Inhibition of Miro1 disturbs mitophagy and pancreatic β-cell function interfering insulin release via IRS-Akt-Foxo1 in diabetes | |
| Tufford et al. | Melanopsin retinal ganglion cells regulate cone photoreceptor lamination in the mouse retina | |
| Lee et al. | Global SUMOylation is a molecular mechanism underlying hypothermia-induced ischemic tolerance | |
| CN1303425A (en) | PNS cell lines and methods of use therefor | |
| Saitoh et al. | Spatiotemporal localization of D-amino acid oxidase and D-aspartate oxidases during development in Caenorhabditis elegans | |
| Bridges et al. | Induction of cystine-glutamate transporter xc− by human immunodeficiency virus type 1 transactivator protein tat in retinal pigment epithelium | |
| Lu et al. | The mammalian retinal degeneration B2 gene is not required for photoreceptor function and survival | |
| Daniele et al. | Glucose uptake by GLUT1 in photoreceptors is essential for outer segment renewal and rod photoreceptor survival | |
| CN107998397A (en) | Application of the EMC10 albumen as biomarker in male sterility is diagnosed | |
| Akematsu et al. | Role of class III phosphatidylinositol 3-kinase during programmed nuclear death of Tetrahymena thermophila | |
| US20110081296A1 (en) | Systems and methods for identification of ciliopathy therapeutics | |
| Mayfield et al. | The SMYD1 and skNAC transcription factors contribute to neurodegenerative diseases | |
| Wu et al. | SENP3 grants tight junction integrity and cytoskeleton architecture in mouse Sertoli cells | |
| Nemova et al. | Proteases of the calpain family: Structure and functions | |
| Chen et al. | Loss of PIGK function causes severe infantile encephalopathy and extensive neuronal apoptosis | |
| Kubíková et al. | Proteomic profiling of human embryonic stem cell-derived microvesicles reveals a risk of transfer of proteins of bovine and mouse origin | |
| Muñoz et al. | Mechanisms of Modulation of Mitochondrial Architecture | |
| Wang et al. | Up‐regulation of cell division cycle 20 expression alters the morphology of neuronal dendritic spines in the nucleus accumbens by promoting FMRP ubiquitination | |
| Jung et al. | V-set and immunoglobulin domain-containing 1 (VSIG1), predominantly expressed in testicular germ cells, is dispensable for spermatogenesis and male fertility in mice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180612 |
|
| WD01 | Invention patent application deemed withdrawn after publication |