WO2019114647A1 - Senp1 phosphorylation modification regulating compound, sirt3 sumo modification compound, and applications thereof - Google Patents

Abstract

A SUMO modification can occur at locus K288 of a NAD-reliant deacetylase SIRT3 in mitochondria and the activity thereof can be regulated; at the same time, a SUMO specific protease 1 (SENP1) can regulate the SUMO modification of SIRT3, thus regulating a mitochondria-related physiological and pathological process with SIRT3 participation; and the effect of such regulation of SENP1 depends on a phosphorylation modification of locus S180 of SENP1. Also disclosed are a signal conditioning path of an SENP1-SIRT3 axis with respect to mitochondria metabolism, the activation of a macrophage and of a T cell, and effects on tumor immunity and tumor growth.

Description

Regulation of SENP1 phosphorylation modification compound and SIRT3 SUMO modification compound and application thereof Technical field

The invention belongs to the field of biomedicine and relates to SENP1 phosphorylation modified compound and SIRT3SUMO de-modification compound and application thereof, and particularly relates to phosphorylation modification of S180 site of SENP1 and regulation of SUMOylation modification of mitochondrial SIRT3 in mitochondrial metabolism-related physiology And the role of pathology and its application.

Background technique

Mitochondria are important energy metabolism in cells and organelles involved in the regulation of cellular metabolism. It can be divided into four regions: outer membrane, membrane gap, intima and matrix from the outside to the inside. In physiological and pathological conditions, the number, shape, and location of cells within the mitochondria change dynamically, and this change is related to the function of mitochondria. Recent studies have shown that these changes in mitochondria are associated with cellular mitochondria for energy requirements, nutrient supply, or metabolic changes. For example, when T cells are stimulated to differentiate into effector T cells by antigen stimulation, the mitochondrial shape becomes smaller and becomes spherical by the Fission process, and when further differentiated into memory T cells, the mitochondria shape becomes larger and becomes longer by Fusion. Buck et al., 2016). Fission makes mitochondria smaller and spherical, which can increase mitochondrial aerobic glycolysis, TCA flux, etc. These metabolic changes are beneficial to the differentiation and expansion of effector T cells; while the Fusion process Increasing the beta-oxidative metabolic activity of mitochondrial fatty acids contributes to the survival of memory T cells (Buck et al., 2016). These studies suggest that dynamic changes in mitochondria can affect mitochondrial metabolism, which in turn affects cell function.

The SUMO modification of proteins is a dynamic and reversible process (Cheng, et al. 2004). The SUMO modification process is carried out by the sequential action of three enzymes: activating enzyme (E1), ligase (E2) and ligase (E3). The target proteins modified by SUMO have been reported in hundreds of species. Most SUMO-modified proteins are located in the nucleus, including transcription factors, transcriptional co-regulators, proteins involved in chromatin remodeling, and signal transduction molecules. SUMO modification can affect numerous biological processes within a cell by modulating the localization, stability, and activity of these target proteins. The regulation of protein SUMO modification is mainly regulated by the de-SUMO process mediated by members of the SENP family of the SUMO-modified protease. The proteins capable of SUMO modification are mainly located in the cytoplasm and cell membrane, but the current SUMO modification of mitochondrial proteins has not been reported. The SENP family consists of six members: SENP1-3, SENP5-7 (Cheng, 2008). Most of the SENP is distributed in the nucleus, SENP3 and SENP5 are located in the nucleolus, and SENP6 is throughout the nucleoplasm. At the C-terminus of their amino acid sequences are highly similar and conserved regions of enzymatic activity, while the N-terminal sequences are diverse and are generally considered to regulate substrate specificity. Since SENP is an important regulator of SUMO modification, their expression or activity is closely related to the SUMO modification level of the substrate. Therefore, SENP is considered to be an important regulator of the regulation of protein SUMO modification, and also acts on proteins under physiological and pathological conditions. An important target for SUMO modification (Cheng, et al. 2004). The external signal is involved in the regulation of many cellular biological processes through a signal-regulating pathway formed by SENP and its substrate. However, it is still not well understood how the external signal regulates the activity of SENP and thus the cellular activity involved.

The Sirtuin family has seven members (SIRT1-7), which rely on NAD+ as a coenzyme to exert deacetylase or ADP-ribosyltransferase activity and participate in the regulation of many important life processes, such as glycolipid metabolism, aging, stress Reactions, inflammatory reactions, tumors and cardiovascular diseases. Among them, SIRT3 is a deproteinized acetylase located in the mitochondrial matrix (Dittenhafer-Reed et al., 2015). More than 50% of mitochondrial proteins include many enzymes involved in metabolic processes that can undergo acetylation, and acetylation is an important mechanism for the regulation of mitochondrial protein activity. SIRT3 is the major deacetylation enzyme of these mitochondrial proteins, which regulates the level of acetylation of these mitochondrial proteins, which in turn affects their function in mitochondria. The loss of SIRT3 can increase ROS in mitochondria and is closely related to aging, hearing impairment and cancer. However, in the physiological and pathological conditions, how to regulate the activity of SIRT3 and its involved mitochondrial metabolism process is not clear.

Summary of the invention

The present invention proposes that the NAD-dependent deacetylase SIRT3 in mitochondria can undergo SUMO modification, while the SUMO modification can inhibit the activity of SIRT3. The SUMO modification site is located at 288th position of human SIRT3 lysine (mouse SIRT3 is lysine 223), and the SUMO modification site is mutated by gene editing technology or the SUMO modification of this site is down-regulated. It can significantly activate the deacetylation activity of SIRT3 and thereby regulate its involved mitochondrial metabolism, including promoting fatty acid oxidation and oxidative phosphorylation activity of mitochondria, which can promote

T cells survive, promote the anti-tumor activity of memory T cells, promote hematopoietic function of blood stem cells, and lose weight.

The present invention further proposes SIRT3 SUMO modification to regulate the activity of immune cells by establishing a SIRT3 SUMO site mutation (K223R) in mice, SIRT3 K223R mouse

The survival time of T cells in vitro is prolonged, and lymphocytes, including memory T cells, are significantly increased. Observation of the mouse tumor model showed that the anti-tumor immune activity of SIRT3K223R memory T cells was significantly enhanced. Therefore, SIRT3SUMO-modification of the K288 site in T cells or a SUMO-modified factor that regulates SIRT3 will be a new target for regulating T cell activity and anti-tumor immunity.

The present invention proposes that SENP1 is a mitochondrial SIRT3-specific de-SUMO-modifying enzyme, which removes the SUMO modification of SIRT3, thereby significantly enhancing the activity of SIRT3. Under the action of metabolic stress factors, SENP1 is transported from the cytoplasm into the mitochondria, catalyzing the de-SUMO of SIRT3, thereby activating the deacetylation activity of SIRT3 and reducing the acetylation level of proteins in mitochondria, and changing the metabolic activity of mitochondria, especially Promotes fatty acid oxidation and oxidative phosphorylation activity of mitochondria. Therefore, SENP1 is an important upstream regulatory factor of SIRT3 (referred to as the SENP1-SIRT3 regulatory axis). The present invention further proposes that under stress conditions, SIRT3K288 site mutation or activation of SENP1 to remove SIRT3 can activate the regulation of fatty acid oxidation by SIRT3, thereby converting the energy metabolism of cells from glucose-based oxidative phosphorylation to The fatty acid oxidative phosphorylation is predominant, which is important for cells to overcome the damage caused by this metabolic stress. The stress conditions of the present invention include cell starvation due to a decrease in glucose supply, and some metabolites and some cytokines are capable of regulating S180 phosphorylation of SENP1, thereby regulating mitochondrial metabolism and function through the SENP1-SIRT3 axis.

Among them, the regulation mechanism of SENP1 into cell mitochondria is that phosphorylation of serine (S180) at position 180 of SENP1 is phosphorylated, and SENP1 is transported into mitochondria, which in turn activates SIRT3. Among them, metabolic stress factors (such as starvation) can promote the activation of AMPK phosphorylation of serine 180 (S180) of SENP1, and promote the translocation of SENP1 into the mitochondrial matrix. Intervention of AMPK or mutation S180 makes it impossible for phosphorylation of SENP1, which will prevent SENP1 from being transported into mitochondria, resulting in a decrease in the localization of SENP1 in the mitochondria, and also failing to initiate SIMO3 de-SUMO and mitochondrial metabolic activity. Regulation. The present invention proposes that the human SUMO-specific protease SENP1 can be localized in the mitochondrial matrix by means of subcellular component separation, fluorescence localization and immunocolloidal gold. In addition, stress conditions such as starvation conditions can promote more SENP1 into the mitochondria. The present invention identifies by mass spectrometry that SENP1 is capable of undergoing phosphorylation modification, and the phosphorylation site is the serine at position 180 (S180). Further experiments demonstrated that phosphorylation at position 180 of SENP1 is a key step in its entry into mitochondria. Under the stimulation of hunger and other conditions, the intracellular AMP-dependent protein kinase AMPK is activated. AMPK directly phosphorylates the S180 site of SENP1, which promotes the translocation of SENP1 into the mitochondria and reduces the SUMOylation of mitochondrial proteins, such as SIRT3. Enhances mitochondrial fatty acid oxidation, promotes the production of ATP, acetyl-CoA and ketone bodies, thereby improving the ability of mitochondria to cope with environmental stress. Therefore, phosphorylation at the S180 position of SENP1 is a novel important way to regulate mitochondrial function. Based on these results, and in view of the important link between the perfection of mitochondrial function and the occurrence of various metabolic and immune diseases, the present invention will provide new strategies and therapeutic targets for studying mitochondrial diseases.

The present invention also proposes to screen for phosphorylation of S180 locus in SENP1 to screen for compounds that promote phosphorylation of SELP1 S180. These compounds can regulate the mitochondrial metabolic activity and related physiological and pathological functions involved in SIRT3 SUMO modification by SENP1. Therefore, it has application prospects. Therefore, factors that promote the phosphorylation of SENP1 S180 site have important application prospects in the physiological and pathological processes by regulating the SENP1-SIRT3 axis. Compared with the prior art, the significant advantages of the present invention are:

The present invention firstly proposed the SUMO modification site of SIRT3 and the signal regulation pathway of the SENP1-SIRT3 axis, and studied the importance of mitochondrial metabolism and anti-tumor immunity. This regulation can affect mitochondrial metabolism, affect the activation of macrophages and T cells, and the effects on tumor immunity and tumor growth. The present invention will further promote recognition of the role of regulation of immune cell activity in mitochondrial metabolism. The present invention analyzes the role and mechanism of the SENP1-SIRT3 axis in cell metabolism and tumor immunosuppression, and can inspire new strategies for activating cell metabolism and tumor immunity.

The present invention also provides a compound for promoting phosphorylation of SENP1 in the preparation of a deacetylation activity activator of SIRT3, a medicament for treating a disease associated with mitochondrial metabolism, a medicament for preventing and/or treating a tumor, or a prevention and/or treatment of an immune-related disease. The application of the drug.

The present invention also provides a compound which promotes phosphorylation of serine at position 180 of SENP1 in the preparation of a deacetylation activity activator of SIRT3, a drug which regulates mitochondrial metabolic function, a drug for preventing and/or treating tumor, or a prevention and/or treatment The application of drugs for immune related diseases.

The present invention also proposes a compound which promotes the transport of SENP1 from the cytoplasm into the mitochondria in the preparation of a deacetylation activity activator of SIRT3, a drug which regulates mitochondrial metabolic function, a drug for preventing and/or treating a tumor, or a prophylactic and/or therapeutic immune-related The application of drugs for diseases.

The present invention also proposes a protein kinase AMPK for preparing a S180 site phosphorylation-modified drug of SENP1, a deacetylation activity activator of SIRT3, a drug for regulating mitochondrial metabolic function, a drug for preventing and/or treating tumor, or prevention and/or Or the use of drugs for the treatment of immune-related diseases.

The invention also provides a protein kinase AMPK activator for preparing a drug for promoting phosphorylation of S180 in SENP1, a deacetylating activity activator of SIRT3, a drug for regulating mitochondrial metabolism function, a drug for preventing and/or treating tumor, or Use in medicines for the prevention and/or treatment of immune related diseases.

The present invention also provides a compound for promoting SIRT3 deacetylation activity in the preparation of a deacetylation activity activator of SIRT3, a drug for regulating mitochondrial metabolic function, a drug for preventing and/or treating a tumor, or for preventing and/or treating an immune related disease. Application in medicine.

The present invention also proposes a compound for promoting SIRT3 de-SUMO modification or capable of mutating a SIRT3 SUMO modification site in the preparation of a deacetylation activity activator of SIRT3, a drug for regulating mitochondrial metabolism function, a drug for preventing and/or treating tumor, or Use in medicines for the prevention and/or treatment of immune related diseases.

The present invention also provides a compound which promotes the lysine SUMO modification site at position 288 of SIRT3 to SUMO modification or mutates the lysine SUMO modification site at position 288 of SIRT3 in the preparation of a deacetylation activity activator of SIRT3, A medicament for regulating a mitochondrial metabolic function, a medicament for preventing and/or treating a tumor, or a medicament for preventing and/or treating an immune-related disease.

In the present invention, the mitochondrial metabolic function-related diseases include obesity, tumor, aging, neurodegenerative diseases and the like.

In the present invention, the treatment of a mitochondrial metabolic function-related disease comprises promoting fatty acid oxidation and oxidative phosphorylation in mitochondrial mitochondria.

In the present invention, the tumor, obesity, chronic viral infectious disease, neurodegenerative disease, and the like.

In the present invention, the prevention and/or treatment of a tumor means inhibiting the growth of tumor cells and promoting the antitumor activity of the memory T cells.

In the present invention, the immune-related diseases include autoimmune diseases, chronic viral infectious diseases, and the like.

In the present invention, the prevention and/or treatment of an immune-related disease affects the activation, promotion/prolongation of macrophages and T cells by regulating the activity of immune cells.

The survival of T cells, increase the number of lymphocytes including memory T cells, increase the number of peripheral lymphocytes, increase the mitochondrial fusion process, and promote the hematopoietic function of blood stem cells.

In the present invention, the activator or drug is used for T cells.

The present invention proposes that phosphorylation of serine (S180) at position 180 of SENP1 is required for the activation of SIRT3 by SENP1 transport into the mitochondria. The present invention proposes a novel mechanism for regulating mitochondrial metabolism and function: using S180 phosphorylation of SENP1 as a marker to screen for compounds that promote the phosphorylation of SENP1 S180, which can regulate the mitochondrial metabolic activity involved in SIRT3 SUMO modification by SENP1. And related physiological and pathological functions. Altering SIRT3 SUMO modification is closely related to mitochondria-related physiological and pathological processes. Screening for SENP1S180 phosphorylation factor has a broad application prospect in the regulation and mutation of SURT modification of SIRT3.

DRAWINGS

Figure 1 is a schematic diagram showing the ability of the mitochondrial protein SIRT3 to undergo SUMOylation.

Figure 2 is a schematic diagram showing the conservation of sequence species in the SIRT3 SUMO modification site.

Figure 3 is a schematic diagram showing the identification of K288 as a SIRT3 SUMO modification site.

Figure 4 is a schematic diagram showing the identification of SENP1 as a SIRT3 SUMO modified protease.

Figure 5 is a graphical representation of the effect of a SIRT3 SUMO modification site mutation on the deacetylation level of its substrate.

Figure 6 is a schematic diagram of mitochondrial oxidative phosphorylation by SIRT3 SUMO modification site.

Figure 7 is a schematic diagram of the SIRT3 SUMO modification site affecting fatty acid oxidation.

Figure 8 is a schematic diagram showing the construction of a SIRT3 SUMO modified site mutant mouse.

Figure 9 is a schematic diagram of the metabolic cage analysis of SIRT3 K223R mice.

Figure 10 is a schematic diagram of fatty acid oxidation in liver tissue of SIRT3 K223R mice under starvation conditions.

Figure 11 is a schematic diagram showing the oxidative phosphorylation metabolism and M2 phenotype of macrophages induced by SIRT3 K223R enhanced IL-4.

Figure 12 shows the increase of CD8+ memory T cells in the spleen of SIRT3 K223R mice.

Figure 13 shows the enhanced survival of SIRT3 K223R mouse CD8+ memory T cells.

Figure 14 shows the effect of SIRT3 K223R on the metabolism pattern of CD8+ memory T cells.

Figure 15 shows the anti-tumor effect of SIRT3 K223R enhanced CD8+ memory T cells

Figure 16 is a schematic representation of the isolation of cellular components to identify SENP1 in the mitochondria.

Figure 17 is a schematic representation of the immunocolloidal gold assay demonstrating that SENP1 is localized to the mitochondrial matrix.

Figure 18 is a schematic diagram showing immunosaturation experiments demonstrating that hunger promotes the entry of SENP1 into mitochondria.

Figure 19 is a schematic representation of the phosphorylation of SENP1 and the phosphorylation of SENP1 by starvation.

Figure 20 is a schematic diagram showing that the serine at position 180 of SENP1 is mutated into alanine form which is incapable of undergoing phosphorylation modification and is incapable of entering mitochondria.

Detailed ways

The present invention will be further described in detail in conjunction with the following specific embodiments and drawings. The processes, conditions, experimental methods, and the like of the present invention are generally known in the art and common general knowledge, except for the contents specifically mentioned below, and the present invention is not particularly limited.

Example 1 Immunoprecipitation Identification of SIRT3 SUMO Modification Method

The mitochondrial components were firstly transfected with SIRT3-Flag and HA-SUMO1 to 293T cells, and then subjected to immunoprecipitation experiments by M2-Flag affinity gel (Sigma, A2220) or HA magnetic beads (Thermo, 88836) using Flag (Sigma, M2). The detection of HA (Sigma, HA-7) antibody detected a 51 kDa size SIRT3 SUMO modified band (Fig. 1). Endogenous SIRT3 SUMO modification was performed by extracting the mitochondrial component of the hepatoma cell line SMMC7721, immunoprecipitation with SIRT3 (Cell Signaling, 5490) antibody, and then detecting with SIRT3 (Cell Signaling, 5490) and SUMO1 (Abcam, 32058) antibodies. A 49 kDa size SIRT3 SUMO modified band was detected (Fig. 1). Then, SIRT3-Flag, HA-SUMO1 and RGS-SENP1 plasmids were co-transfected into 293T cells, mitochondrial proteins were extracted and immunoprecipitated with Flag antibody. The results of Flag and HA antibody detection showed that over-expressed SENP1 could remove SUMO-modified SIRT3. At the same time, the SENP1 enzyme mutant plasmid RGS-SENP1m (R630L, K631M) could not be removed by replacing RGS-SENP1 (Fig. 4). The above results demonstrate that SIRT3 is a mitochondrial SUMO modified protein and SENP1 is its de-SUMO protease.

The following is the sequence of the human Sirt3 gene cloned into the plasmid:

Example 2 SIRT3 SUMO modification site identification method

By amino acid sequence alignment of the protein, it was revealed that there is a SUMO-modified consensus sequence ψ-K-χ-D around lysine 288 of human SIRT3 protein (ψ is a hydrophobic amino acid residue, and χ is any amino acid residue). ), and this sequence is conserved among different species (Figure 2). The 288th lysine on the SIRT3 plasmid was mutated to arginine by PCR with the following pair of primers, and then the plasmid of SIRT3K288R was co-transfected into the 293T cell with the plasmid of SUMO1, and the SIRT3 WT plasmid was used as a positive control. Immunoprecipitation experiments were performed with M2-Flag affinity gel (Sigma, A2220) or HA magnetic beads (Thermo, 88836). The antibodies were detected by Flag (Sigma, M2) and HA (Sigma, HA-7). The results showed that SIRT3 288 After amino acid mutation, SIRT3 cannot undergo SUMOylation, ie, K288 is a SIRT3 SUMO modification site (Fig. 3).

SIRT3K288R fwd 5’-cggcgttgtgaggcccgacattg-3’

SIRT3K288R rev 5’-caatgtcgggcctcacaacgccg-3’

Example 3 demonstrates that SIRT3 SUMO modification has an inhibitory effect on the deacetylation level of SIRT3

The Flag-SIRT3 WT or Flag-SIRT3 K288R expressing cell line was stably transfected into the hepatoma cell SMMC7721 with endogenous SIRT3 gene silencing in the Flag-SIRT3 WT or Flag-SIRT3 K288R plasmid. Immunoprecipitation by Acetyl-lys (Cell Signaling, 9441) antibody followed by known deacetylation of target proteins of SIRT3 such as SOD2 (Abeam, 13534), LCAD (Abeam, 196655), HMGCS2 (Abeam, 137043) ), AceCS2 (Abeam, 66038) showed that SIRT3 K288R had higher deacetylase activity than wild type (Fig. 5).

Example 4 Method for detecting mitochondrial oxidative phosphorylation level

Approximately 10 ⁴ cells were plated in one well of XF96-well microplate (Seahorse Bioscience) and tested with XF96 analyzer (Seahorse Bioscience) at 37 °C for 6 hours after metabolic stress treatment or no treatment, 2 μM oligomycin, 0.25 μM FCCP and 0.5 μM rotenone/antimycin were used to detect alternate breathing capacity, maximum respiratory value and ATP production, respectively. It was shown that the oxidative phosphorylation and ATP levels were higher in the SIRT3 SUMO modification site than in the wild type (Fig. 6).

Example 5 mitochondrial fatty acid oxidation analysis method

The mitochondrial lysate of the cells was precipitated by acetonitrile containing the internal standard, and the supernatant was obtained by centrifugation, and then detected by tandem mass spectrometry (TSQ Vantage, Thermo Fisher Scientific) with an XBridgeTM Amide guard column (2.1 × 10 mm, X-ray separation of 5 μm; Waters) XBridgeTM Amide column (2.1×150 mm, 5 μm; Waters). The mobile phase consisted of 10 mM aqueous ammonium acetate (phase A) and acetonitrile (phase B). L-carnitine, acylcarnitines and other internal controls (Sigma-Aldrich) were analyzed by cationic multiple reaction monitoring mode (MRM) and data files were generated by LCquan 2.7 software (Thermofisher Scientific).

The results of the present invention indicate that the amount of long-chain fatty acid intermediates in SIRT3 K288R mutant cells is lower than that of wild type, indicating that SUMO modification inhibits the activity of deacetylase of SIRT3 and mediates fatty acid oxidation metabolism (Fig. 7).

Example 6 Construction of SIRT3 K223R Mice

The CRISPR/Cas9 gene targeting technology was used to construct a gRNA targeting the Sirt3 gene, which was transcribed into mRNA in vitro, directing the Cas9 protein to cleave the DNA duplex at a specific site, and the 99 bp donor oligo was integrated into the destination by homologous recombination (Fig. 8). . After superovulation of embryonic donor mice (C57BL/6), donor female mice were treated with PMSG, hCG was injected 46 hours later, and male mice were mated with the cage, and the fertilized eggs were microinjected the next day. Embryo transfer is then performed. Embryo-transplanted mice will be born about 19 days after surgery. After the mice are born about 7 days after birth, DNA is extracted from the tail (or toes) and PCR-identified to obtain Founder mice and wild-type mice (C57BL). /6) Mating to obtain the first generation, male founder mice to 7 weeks old, female mice to 4 weeks old, can be mated with wild-type heterologous mice, mice were identified by PCR 20 days after birth. If a positive mouse is born, it means that the transgene has been integrated into the germ cell and the marker line is successfully established. The mutant mice did not differ significantly from the wild type in normal feeding conditions.

The sequence used is as follows:

gRNA:CCCGATATCGTCTTTTTTGGGGA

Donor Oligo (99bp):

SIRT3 K223R mouse identification forward primer: 5'-GGGACCATTACAGAGTGAAGA-3'

SIRT3 K223R mouse identification reverse primer: 5'-CATACAGAGCCACAGACATACC-3'

Example 7 Study of Metabolism in SIRT3 SUMO Modified Site Mutant Mice

Metabolic cage experiments were performed on 6-month-old male mice of C57BL/6 wild type and SIRT3K223R. Each mouse was divided into normal diet feeding (Research Diets, Inc.) and 24 hours without feeding only water (n=4). . Minispec TD-NMR Analysers (Bruker instruments) were used to assess body fat content and then placed in a metabolic cage (Columbus Instruments) to assess feeding, energy expenditure, oxygen consumption, carbon dioxide production and activity, and animal feeding and experiments were performed in full accordance with Shanghai. Standardized operation of the Experimental Animal Ethics Committee of Jiaotong University School of Medicine. The results of the present invention indicate that under normal feeding conditions, the oxygen consumption and carbon dioxide production of SIRT3 K223R mice are significantly higher than that of wild type mice, indicating that the metabolism of SIRT3 is at a higher level (Fig. 9). Furthermore, the liver mitochondrial components of mice were isolated for fatty acid oxidation mass spectrometry. The results showed that the long-chain fatty acid products in SIRT3 K223R mouse liver cells were significantly lower than those in wild-type mice, indicating that SIRT3 K223R has higher activity. In starvation, the long-chain fatty acid product of wild-type mouse hepatocytes was significantly reduced, but there was no significant change in SIRT3 K223R mice (Fig. 10).

Example 8 SIRT3 K223R enhances IL-4-induced oxidative phosphorylation metabolism and M2 phenotype in macrophages

Bone marrow macrophages were isolated from SIRT3WT and SIRT3K223R mice, treated with IL-4 for 24 hours under in vitro culture conditions, and analyzed for cellular oxygen consumption and FACS analysis of CD206+CD301+ macrophage (M2) by Seahorse. -4 induced a significant increase in oxygen consumption and formation of M2 cells in SIRT3 K223R macrophages compared to wild-type macrophages (Fig. 11), indicating that SIRT3 K223R mutations can enhance oxidative phosphorylation metabolism and M2 phenotype of macrophages.

Example 9 Increase in the number and proportion of CD8+ memory T cells in the spleen of SIRT3 K223R mice

T cells differentiate and mature in the thymus, and mature CD8+ and CD4+ T cells enter the spleen and lymph nodes. The results of the present invention indicate that the thymus and spleen of SIRT3 K223R mice are significantly increased, and the total number of cells is increased (Fig. 12-a, b). Further flow FACS analysis showed that there was no abnormal proportion of cells in all stages of T cell development, but CD4 SP (single positive, SP)/CD8SP/Double Positive (DP)/Double Negative (DN) and DN1/3/4 The number of cells has increased significantly. Similar results were obtained in the spleen, CD8+ memory T cells (TCM)/effector memory T cells and

The number of cells in T cells increased significantly, and the proportion of cells in which TCM accounts for CD8+T cells also increased significantly (Fig. 12-c). Taken together, SIRT3 K223R does not affect the development of T cells, but can lead to an increase in the number of T cells, especially CD8 + TCM.

Example 10 SIRT3 K223R Mouse CD8+ Memory T Cell Survival Enhancement

In order to further explore the reasons for the increase in the number of CD8+ T cells cells, the present invention started from two aspects. First, the cell proliferation potential was detected by FACS Ki67 staining, and the results showed that the proliferation potential of CD8+T cells in SIRT3 K223R mice did not change significantly (Fig. 13-a). On the other hand, staining results by PI (propidium iodide) cell viability showed that the cell viability KR group of CD8+TCM and TN was significantly higher than that of the WT group (Fig. 13-b). This result suggests that SIRT3 K223R of the present invention may increase the survival viability of CD8+TCM and TN. Therefore, the present invention sorts CD8+ TN cells in the spleen (

CD8+T cells isolation kit, Stem cell) was activated in vitro with anti-CD3/CD8+IL2 for 3 days, and then induced with cytokine IL15 for 3 days to obtain T memory (IL15-TM) (Buck et al., 2016). Then, using 7AAD staining method to detect cell viability (van der Windt et al., 2012), the viability of CD8+TN and IL15-TM (1x10 ⁵ ) cultured in vitro for 3 days without stimulation was examined. The results showed that SIRT3 K223R The in vitro viability of CD8+ TN/IL15-TM cells was significantly higher than that of the WT group (Fig. 13-c, d). At the same time, the present invention injected IL15-TM into the recipient mice of CD45.1, and detected the survival number in the spleen and surrounding lymph nodes 2 days later, which was consistent with the survival in vitro, and the K223R group IL15-TM was in the spleen and The in vivo viability in the lymph nodes was also higher than in the WT group (Fig. 13-e, f).

Example 11 Effect of SIRT3 K223R on the metabolism pattern of CD8+ memory T cells

Similar to the results obtained in the liver, SIRT3 K223R regulates mitochondrial status and metabolic patterns of CD8+ T cells. Mitochon-tracker Green was used to label mitochondria and detected by FACS. The results showed that the K8R group CD8+IL15-TM (memory) T cell mito-tracker MFI was significantly higher than the WT group, indicating an increase in mitochondrial mass, suggesting an increase in mitochondrial fusion mito fusion (Fig. 14-a). The same result was obtained with immunofluorescence mito-tracker Green. The mitochondrial mass in K223RTM was higher than that in the WT group, and there was an increase in mito fusion (Fig. 14-b). In addition, using JC-1 staining to detect mitochondrial membrane potential MMP (Mitochondrial membrane potential), SIRT3 K223R group TE and TM JC-1monomers were significantly lower than WT group, indicating that its MMP is higher than WT group, K223R more stable MMP is beneficial Maintain the normal physiological function of the cells (Fig. 14-c). Further metabolic flow results showed an increase in SIRT3 K223RTM oxidative phosphorylation OCR (Fig. 14-d); at the same time, TM cells increased their ability to utilize long-chain fatty acids and produced more ATP and Acetyl-coA (Fig. 14-e) . In summary, the mitochondrial mass and fusion of SIRT3-K223R CD8+IL15-TM increased, the membrane potential MMP increased; the metabolic mode favored the increase of oxidative phosphorylation, and the ability to utilize long-chain fatty acids increased, which could produce ATP energy more effectively. . Changes in the above metabolic patterns are beneficial to the long-term survival of TM cells.

Example 12 SIRT3 K223R enhances CD8+ memory T cell viability in T cell antitumor

CD8+ T cells are important effector cells of the immune system against tumors. To study whether SIRT3 K223R enhances the ability of CD8+TM to survive in anti-tumor, SIRT3 K223R CD45.2 OT1 mice (CD8+T) were constructed. The cells can be activated by the ovalbumin polypeptide OVA Peptide (257-264), antigen-specific activation, and after isolation of CD8+TN from WT and K223R mice, TN is activated in vitro using the OVA peptide as an antigen, and IL15-TM is also induced using IL15. Then, the same number (1x10 ⁶ ) of WR and KR group IL15-TM cells were adoptively transferred to recipient mouse CD45.1 mice by tail vein injection. Seven days after adoptive transfer of IL15-TM, MC-38 colon cancer cells (1×10 ⁶ ) were inoculated on the back of recipient mice, and tumor growth was continuously monitored. The results showed that the size and weight of tumor growth in the K223R CD8+IL15-TM recipient mice were lower than those in the WT group, and the proportion of CD45.2+ and OVA-specific epitopes in the K223R tumor-infiltrating T cells was high. In the WT group (Figure 15). The above results indicate that SIRT3 K223R can enhance the viability of CD8+TM through changes in metabolic patterns, and is more conducive to its role in anti-tumor.

Example 13 Cell Starvation Method

Normal cell culture was performed in Dulbecco's modified Eagle's medium (DMEM, 4500 mg/l glucose, 4 mM L-glutamine) containing 10% serum. When starved, the cells were cultured in serum-free DMEM (1000 mg/l glucose, 4 mM L-glutamine). In the process, the processing time is 4 hours.

Example 14 Nuclei, cytoplasm and mitochondrial separation

Collect cells: wash once with PBS, digest the cells with trypsin at a concentration of 0.25%, collect the cells by centrifugation, collect the tissues: store the tissues on ice after the animals are sacrificed, no more than one hour; wash the cells: pre-cool with ice bath The cell pellet was gently resuspended in PBS, a small amount of cells were taken for counting, and the remaining cells were pelleted by centrifugation at 600 °C for 5 minutes at 600 °C, and the supernatant was discarded; the tissue was washed: the cut tissue was weighed in a 1.5 ml centrifuge tube, and the weight was about For 50-100 mg, wash once with PBS, and cut the tissue into very fine pieces with scissors; add 1 ml of mitochondrial fraction [210 mM mannitol, 70 mM sucrose, 5 mM Tris-HCl (pH 7.5), 1 mM EGTA, 0.5 mg/ml BSA] to cells or tissues, gently pipe the cells, place on ice for 10-15 minutes; transfer the cell suspension to Dounce homogenizer, homogenate for about 30 times; identification of homogenate effect: different cells with different homogenates The number of homogenizations required for the device varies and needs to be optimized. Usually, about 2 ul of cell homogenate can be taken after homogenization 10 times, 30-50 ul of trypan blue staining solution is added, and the ratio of trypan blue staining positive (blue) cells is observed under a microscope. If the proportion of positive cells is less than 50%, increase the homogenate by 5 times. Then, the same sample was taken for trypan blue staining. When the positive ratio exceeds 50%, the homogenization can be stopped and the next step is performed; the cell homogenate is centrifuged at 600 ° C for 10 minutes at 4 ° C to precipitate into the nucleus P1; carefully transfer the supernatant S1 to another centrifuge tube, 11,000 g, 4 After centrifugation at ° C for 10 minutes, the supernatant S2 was carefully removed, and the precipitated P2 was the isolated cell mitochondria.

Use of mitochondria: If used for functional or enzymatic activity studies of intact mitochondria, 150-200 ul of mitochondrial stock solution [1.5M sucrose, 1 mM EGTA, 10 mM Tris HCl (pH 7.5)] can be added to the isolated mitochondria sample and resuspended. Mitochondria; if used for protein analysis of mitochondria, the mitochondrial samples obtained by separation may be lysed by mitochondrial lysate with PMSF added before use. The mitochondria after lysis can be used for SDS-PAGE, Western blot, IP, and determination of some enzyme activities in mitochondria.

The present invention detects the localization of three major de-SUMO proteases (SENP1-SENP3) in cells: SENP1 is mainly located in the nucleus, but SENP1 protein can also be detected in cytoplasmic and mitochondrial components; SENP2 is mostly localized in the nucleus; SENP3 It is present in every component of the cell. Further separation of mitochondrial components revealed that SENP3 protein is located in the mitochondrial outer membrane, while SENP1 protein can be localized in the mitochondrial matrix (Fig. 16).

Example 15 immunofluorescence experiment

The well-crawled slides were gently rinsed once with PBS in a culture plate; the slides were fixed with 4% paraformaldehyde for 15 minutes at room temperature; the slides were rinsed 3 times with PBS for 3 minutes each; 0.1 was prepared with PBS %Triton X-100, room temperature permeation for 20 minutes; PBS rinse the slides 3 times for 3 minutes each time; add 10% goat serum on the slides, block at room temperature for 30 minutes; aspirate the blocking solution, add each slide Sufficient amount of primary antibody diluted with PBS and placed in a wet box, incubate at 4 ° C overnight; PBS rinse the slide 3 times for 3 minutes each time; blot the excess liquid on the climbing plate and add the diluted fluorescent secondary antibody to avoid The cells were incubated for 30 minutes at room temperature; the slides were rinsed 3 times in the dark for PBS for 3 minutes; the slides were sealed with an anti-fluorescence quencher and the images were observed under a fluorescence microscope.

The results of the present invention indicate that co-localization of SENP1 with mitochondrial protein markers is significantly increased with prolonged starvation time (Fig. 18) with a scale of 50 microns.

Example 16 immunocolloidal gold method

4% paraformaldehyde (PFA) and 0.2% glutaraldehyde (GA) were fixed at room temperature for 1 hour. After the cells are fixed, the fixative is removed by centrifugation, washed with PB buffer, and the supernatant is removed by low-speed centrifugation, and the cells are resuspended with a little buffer. The tube was heated to 37 ° C, while 12% (w / v) gelatin was heated to 37 ° C, gelatin was added dropwise and gently stirred, the cells were resuspended in 12% gelatin, permeated at 37 ° C for 10 minutes, centrifuged The cells are allowed to settle and the gelatin is cured at a low temperature. The cell-containing portion at the tip of the centrifuge tube was cut into several small pieces of 1 mm ³ by a knife. The cut pieces were placed in 2.3 M sucrose and soaked overnight at 4 ° C. The appropriate rotation speed and angle were selected to prevent the sample pieces from drying out or colliding with the centrifuge tube wall. The sample temperature, knife temperature and freezer temperature were -80 °C. Before the ultra-thin sectioning, semi-thin sections with a thickness of about 200 nm were obtained, which were observed by toluidine blue staining and localized, and the cells with more cells were selected for repair. Make ultra-thin sections. The sample temperature, the knife temperature and the freezer temperature were set to -120 ° C, and ultra-thin sectioning was carried out to obtain an ultra-thin section having a thickness of about 70 nm, which was cut with sucrose and pressed onto a carrier on which a Formvar film was placed. The net was inverted on 2% gelatin plate, kept at 37 ° C for more than 20 minutes; 0.02 M glycine was washed twice for 2 minutes each time; 1% bovine serum albumin BSA was incubated for 2 minutes; diluted antibody with 1% BSA, 4 °C was incubated overnight in a wet box; rinsed with 0.1% BSA 4 times for 2 minutes each time; immunogold labeled, incubated for 25 minutes at room temperature; 2% washed with 0.1% BSA, 2 minutes each time, 4 times with PBS, 2 times each time Minutes; 1% glutaraldehyde, 5 minutes; wash twice in PBS for 5 minutes, rinse with double distilled water for at least 6 times, 1 minute each time; 2% uranyl acetate UA (pH7), 5 minutes; Double-distilled water; cellulose-acetic acid uranyl acetate (MC-UA) was incubated and embedded on ice. After the first two drops of MC-UA droplets were rapidly incubated, the third MC-UA droplet was entered. And stay for 5-10 minutes, take out the net, suck off excess MC-UA droplets, dry to form a film, observe by electron microscope.

In the present invention, after MEF cells were subjected to ultrathin sectioning, the SENP1 protein in the cells was labeled with immunocolloidal gold, and the results showed that the SENP1 protein was not only found in the nucleus and cytoplasm but also in the mitochondria (Fig. 17). Cyto represents cytoplasm, Mt represents mitochondria, N represents nucleus, and the scale is 500 nm.

Example 17 Identification of Phosphorylation of SENP1

Flag-SENP1 was first transfected into 293T cells, and cells were harvested 24-48 h after transfection; gently rinsing with PBS, adding 1 ml of PBS, and transferring the cell suspension to 1.5 ml EP tube by gun or cell scraping. After centrifugation at 800 g for 5 minutes at 4 ° C, discard the supernatant; after extracting the mitochondrial fraction, add appropriate amount of cell IP lysis buffer [50 mM Tris-HCl (pH 7.4), 400 mM NaCl, 1% Triton X-100, 0.1% SDS, 1 mM PMSF, PhosSTOP cocktail and protease inhibitors], cleavage on ice or 4 ° C for 30 minutes, 40 Hz ultrasound 3 times, each time 10 s; after lysis of the lysate was centrifuged at 12,000 g for 10 minutes, a small amount of lysate was used as a control, and the remaining lysate was added. M2-affinity gel (Sigma, A2220) was incubated at 4 ° C for 2 h with slow shaking for immunoprecipitation; after the reaction, it was centrifuged at 3,000 g for 1 minute at 4 ° C, and the M2-affinity gel was centrifuged to the bottom of the tube, and the supernatant was carefully aspirated. Wash 3-4 times with 1 ml of lysis buffer, and finally add 2 x SDS loading buffer and cook at 95 ° C for 5 minutes. The prepared samples were subjected to Western blot and detected by Anti-Flag (Sigma, M2) and Anti-Phosphoserine/threonine (Abeam, ab17464) antibodies.

The results showed that the phosphorylation of SENP1 protein was enhanced when the cells were starved; if the λ-Ppase phosphatase was simultaneously treated on this basis, the phosphorylation of SENP1 protein could not be detected (Fig. 19).

Example 18 Identification of SENP1 S180 Site Phosphorylation Method

The primers for mutating SENP1 S180 to A (alanine) were designed on the QuikChange website. The sequence of SENP1-S180A was amplified by PCR using the pFLAG-SENP1 plasmid as a template. After transformation, the plasmid was extracted and verified by sequencing. Whether the mutation is successful. The successfully mutated SENP1-S180A plasmid was transfected into 293T cells, and the phosphorylation level of SENP1 was detected by immunoprecipitation and western blot. The mitochondrial components of the same cells were isolated and the localization of SENP1 was detected by western blot.

The results showed that when the SENP1 S180 phosphorylation mutation, its localization in the mitochondria was significantly reduced, and the overall SUMOylation modification in the mitochondria was enhanced, but the mutation did not affect its localization in the nucleus and cytoplasm (Fig. 20).

Example 19 Screening Method for Altering Sensitization of SENP1 S180

The Flag-SENP1 plasmid was transfected into 293T, and after 24 hours, compound AICAR (500 μM), A769662 (500 μM), Comp. C (4 μM), lactic acid (20 mM) or cytokine IL-4 (20 ng) was added to the medium. /ml), cells were collected after 4-6 hours, phosphorylation of SENP1 at position 180 was detected by immunoprecipitation and western blot, and the mitochondrial components of the cells were isolated to detect the amount of SENP1 mitochondria.

The protection of the present invention is not limited to the above embodiment. Variations and advantages that may be conceived by those skilled in the art are intended to be included within the scope of the invention and the scope of the appended claims.

Claims (15)

1. A compound for promoting phosphorylation of SENP1 in the preparation of a deacetylating activity activator of SIRT3, a medicament for treating a disease associated with mitochondrial metabolism, a medicament for preventing and/or treating a tumor, or a medicament for preventing and/or treating an immune-related disease .
2. A compound that promotes phosphorylation of serine at position 180 of SENP1 in the preparation of a deacetylating activity activator of SIRT3, a drug that modulates mitochondrial metabolic function, a drug for preventing and/or treating a tumor, or a drug for preventing and/or treating an immune-related disease Application in .
3. A compound that promotes the transport of SENP1 from the cytoplasm into the mitochondria in the preparation of a deacetylation activity activator of SIRT3, a drug that modulates mitochondrial metabolic function, a drug that prevents and/or treats a tumor, or a drug that prevents and/or treats an immune-related disease application.
4. The protein kinase AMPK is used to prepare a phosphorylation-modified drug at the S180 site of SENP1, a deacetylation activity activator of SIRT3, a drug that regulates mitochondrial metabolism, a drug for preventing and/or treating tumors, or a preventive and/or therapeutic immune-related disease. The application of the drug.
5. Protein kinase AMPK activators are used to prepare drugs that promote S180 site phosphorylation of SENP1, deacetylase activity activators of SIRT3, drugs that regulate mitochondrial metabolic function, drugs for the prevention and/or treatment of tumors, or prevention and/or treatment The application of drugs for immune related diseases.
6. A compound that promotes SIRT3 deacetylation activity is useful in the preparation of a deacetylation activity activator of SIRT3, a drug that modulates mitochondrial metabolic function, a drug that prevents and/or treats a tumor, or a drug that prevents and/or treats an immune-related disease.
7. A compound that promotes SIRT3 de-SUMO modification or is capable of mutating a SIRT3 SUMO modification site in the preparation of a deacetylation activity activator of SIRT3, a drug that modulates mitochondrial metabolic function, a drug for preventing and/or treating a tumor, or a prevention and/or treatment The application of drugs for immune related diseases.
8. A compound that promotes the lysine SUMO modification site at position 288 of SIRT3 to SUMO modification or cleavage of the lysine SUMO modification site at position 288 of SIRT3 in the preparation of a deacetylation activity activator of SIRT3, which regulates mitochondrial metabolism A drug, a drug for preventing and/or treating a tumor, or a drug for preventing and/or treating an immune-related disease.
9. The use according to any one of claims 1 to 8, wherein the mitochondrial metabolic function-related diseases include obesity, tumor, aging, and neurodegenerative diseases.
10. The use according to any one of claims 1 to 8, wherein the treatment of a mitochondrial metabolism-related disease comprises promoting fatty acid oxidation and oxidative phosphorylation in mitochondrial mitochondria.
11. The use according to any one of claims 1 to 8, which is a tumor, an obesity, a chronic viral infectious disease, or a neurodegenerative disease.
12. The use according to any one of claims 1 to 8, wherein the preventing and/or treating a tumor means inhibiting the growth of tumor cells and promoting the antitumor activity of the memory T cells.
13. The use according to any one of claims 1 to 8, wherein the immune-related disease comprises an autoimmune disease or a chronic viral infectious disease.
14. The use according to any one of claims 1 to 8, wherein the prevention and/or treatment of an immune-related disease affects activation, promotion/prolongation of macrophages and T cells by regulating the activity of immune cells

    

    The survival of the cells, increase the number of lymphocytes including memory T cells, increase the number of peripheral lymphocytes, increase the mitochondrial fusion process, and promote the hematopoietic function of blood stem cells.
15. The use according to any one of claims 1 to 8, wherein the activator or drug is for T cells.

Images