CN107686523B - Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof - Google Patents
Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof Download PDFInfo
- Publication number
- CN107686523B CN107686523B CN201710831001.4A CN201710831001A CN107686523B CN 107686523 B CN107686523 B CN 107686523B CN 201710831001 A CN201710831001 A CN 201710831001A CN 107686523 B CN107686523 B CN 107686523B
- Authority
- CN
- China
- Prior art keywords
- beclin
- tumor
- phlip
- autophagy
- inducing polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4747—Apoptosis related proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides a tumor acidity response autophagy inducing polypeptide and a preparation method and application thereof. The gene sequences of the low pH insertion peptide (pHLIP) and the active fragment of Beclin 1 were chemically synthesized and ligated to the pET-32a expression vector via restriction sites to obtain a recombinant plasmid. The recombinant plasmid is transformed into Escherichia coli BL21(DE3), and an engineering bacterium pET-32a-pHLIP-Beclin 1/BL21(DE3) is obtained through screening. The engineering bacteria is induced and expressed by IPTG, thallus is collected, separated and purified to obtain target protein. The tumor acidity response autophagy inducing polypeptide can be positioned to a tumor acidic microenvironment through pHLIP, and the Beclin 1 active fragment is delivered to tumor cells in a targeted manner, so that the tumor cells are induced to undergo autophagic death, and the polypeptide can be applied to preparation of targeted anti-cancer drugs.
Description
Technical Field
The invention relates to the field of biotechnology pharmacy, in particular to a tumor acidity response autophagy inducing polypeptide, a preparation method thereof and application of the polypeptide in preparing a targeted anticancer drug.
Background
Beclin 1 plays an important role in the occurrence and development of tumors through the regulation of autophagy. Currently, Beclin 1 has been identified as a novel cancer suppressor gene. However, it is reported that: the deletion mutation of the Beclin 1 gene exists in 75% of ovarian cancer, 50% of breast cancer and 40% of prostate cancer, the expression level of the Beclin 1 protein is reduced, and the autophagy function is reduced. Therefore, if the expression of Beclin 1 in the tumor patients can be enhanced and the autophagy process is started, the tumor cells die due to excessive autophagy, and the purpose of inhibiting the tumor growth is achieved. However, Beclin 1 itself cannot enter cells, lacks tissue specificity and has poor in vivo stability, which greatly limits its application in tumor therapy.
Rapidly proliferating tumor cells have abnormal nutritional requirements and metabolic characteristics (Warburg effect) that give the tumor microenvironment some unique features that distinguish almost all malignant solid tumors from the surrounding normal tissue. Tumor tissue has a lower extracellular pH (pH 6.5-7.0) compared to healthy tissue (pH 7.2-7.4). Acidosis is an important marker for the tumor to progress from early stage to late stage, and can provide a new idea for tumor detection and targeted therapy. The targeting of the tumor acidic microenvironment is independent of the pathophysiological characteristics and biomarkers of tumor tissues, and can make up the defects of active targeting and passive targeting.
A low pH insertion peptide (pHLIP) is a water-soluble polypeptide derived from the bacteriorhodopsin C-helix, consisting of 36 amino acids, which inserts the C-terminus into the cell membrane by forming a stable transmembrane α -helix under acidic conditions. Therefore, pHLIP can be used as a targeting delivery carrier of a tumor acid microenvironment to deliver a target drug or gene into tumor cells.
Disclosure of Invention
The invention aims to provide a tumor acidity response autophagy inducing polypeptide, a preparation method thereof and application of the polypeptide in preparing a targeted anticancer drug.
The tumor acidity response autophagy inducing polypeptide comprises the following components in sequence from N end to C end: the tag protein Trx amino acid sequence, the tumor acidity response targeting molecule pHLIP sequence and the autophagy initiation factor Beclin 1 active fragment amino acid sequence on the pET-32a expression vector.
The invention provides a tumor acidity response autophagy inducing polypeptide, the amino acid sequence of which is SDQ ID NO: 1, consisting of 221 amino acids.
The nucleotide sequence of the gene for coding the tumor acidity response autophagy inducing polypeptide is SDQ ID NO: 2, consisting of 672 nucleotides.
A vector comprising the nucleotide sequence described above. The recombinant plasmid pET-32a-Trx-pHLIP-Beclin 1 is obtained after cloning a nucleotide fragment for coding pHLIP-Beclin 1 into a prokaryotic expression vector. The vector is a plasmid.
An engineering bacterium containing the carrier. The recombinant plasmid pET-32a-Trx-pHLIP-Beclin 1 is transformed into a bacterium, such as Escherichia coli BL21(DE3), to construct an engineering bacterium pET-32a-Trx-pHLIP-Beclin 1/BL21(DE 3).
A method for preparing tumor acidity response autophagy inducing polypeptide comprises the following steps: the gene sequences of pHLIP and Beclin 1 active fragments are chemically synthesized and are connected to a pET-32a expression vector through restriction enzyme sites to obtain a recombinant plasmid. The recombinant plasmid is transformed into Escherichia coli BL21(DE3), and the engineering bacterium pET-32a-Trx-pHLIP-Beclin 1/BL21(DE3) is obtained by screening. Inoculating the engineering bacteria into LB culture solution containing ampicillin, performing shaking culture at 37 deg.C until A600 nm is 0.6-0.8, adding IPTG to make its final concentration be 1mM, inducing at 16 deg.C overnight, collecting thallus, ultrasonically crushing, centrifuging, collecting supernatant, and purifying by affinity chromatography to obtain target protein.
Application of tumor acidity response autophagy inducing polypeptide in preparing anticancer drugs. The biological activity of the target protein Trx-pHLIP-Beclin 1 is verified by selecting a human breast cancer cell line MCF-7 through a crystal violet staining method, an Ad-mCherry-GFP-LC3B, a Western Blot and other means, and the experimental result shows that: under the condition of weak acidity (pH is 6.5), Trx-pHLIP-Beclin 1 can obviously inhibit the growth and proliferation of MCF-7, and the antitumor activity of the fragment is obviously superior to that of a single active fragment of Beclin 1. Western Blot detection of the change of the expression levels of autophagy-related proteins p62, LC3I and LC3II shows that the content of p62 is remarkably reduced and the content of LC3II is remarkably increased after cells are treated by Trx-pHLIP-Beclin 1, which indicates that Trx-pHLIP-Beclin 1 can induce tumor cells to generate autophagy.
Compared with the prior art, the invention has the beneficial effects that: the tumor acidity response autophagy inducing polypeptide provided by the invention has the advantages of simple preparation, high yield, strong antitumor activity and the like. The polypeptide can be quickly obtained by prokaryotic expression of escherichia coli, the yield can reach 21.8mg/L, and the antitumor activity of the polypeptide is obviously superior to that of a single Beclin 1 active fragment under a weak acidic condition, so that the polypeptide can be applied to preparation of targeted anticancer drugs.
Drawings
FIG. 1 PCR amplification of target gene pHLIP-Beclin 1 (lane 1 shows standard molecular weight, lane 2 shows target gene)
FIG. 2 shows the positive clone identification of pET-32a-Trx-pHLIP-Beclin 1 recombinant plasmid (lane 1 shows standard molecular weight; lanes 2 to 10 show target genes)
FIG. 312% SDS-PAGE protein gel electrophoresis detects the expression of the target protein and the tag protein. (M: Standard molecular weight; lane 1 shows supernatant protein samples obtained by subjecting empty plasmid-containing cells to overnight induction with 1mM IPTG at 16 ℃ and then to centrifugation; lanes 2, 3 and 4 show whole bacterial protein samples obtained by subjecting recombinant plasmid-containing cells to overnight induction with 1mM IPTG at 16 ℃ and then to sonication and centrifugation, and supernatant and precipitated protein samples obtained by centrifugation; lane 5 shows supernatant protein samples obtained by subjecting non-induced cells to ultrasonication and then to centrifugation)
FIG. 412% SDS-PAGE protein gel electrophoresis detection of the purification results of the target protein and the tag protein (M: standard molecular weight; lanes 1 and 2 are protein samples before and after the tag protein purification, respectively; lanes 3 and 4 are protein samples before and after the fusion protein purification, respectively)
FIG. 5 shows the results of the crystal violet assay for examining the inhibition of tumor cell growth by fusion proteins at different concentrations and a statistical chart (in the graph, A represents the cell proliferation after MCF-7 cells treated with 10. mu.M fusion protein at pH 7.4/6.5 were stained with crystal violet for 24h, B represents the absorbance after MCF-7 cells treated with 10. mu.M fusion protein at pH 7.4 were stained with crystal violet for 24h, and then dissolved in methanol using a microplate reader; C represents the absorbance after MCF-7 cells treated with 10. mu.M fusion protein at pH 6.5 for 24h, and dissolved in methanol using a microplate reader)
FIG. 6 detection of autophagy marker protein LC3II and p62 protein expression levels after MCF-7 cells treated with the fusion protein by Western Blot method (in the figure, A represents the protein expression levels of p62, LC3I and LC3II by Western Blot method 24 hours after MCF-7 cells treated with 10. mu.M fusion protein at pH 7.4/6.5. in the figure, B is derived from LC3-II/LC3-I and p62/GAPDH gray scale value analysis results of A in the figure)
FIG. 7A shows the number of autophagosomes and the statistical graph obtained by the Ad-mCherry-GFP-LC3B method (in the graph, A shows the number of fluorescent spots after MCF-7 cells were treated with 10. mu.M fusion protein at pH 7.4 for 24 hours, and B shows the number of fluorescent spots after MCF-7 cells were treated with 10. mu.M fusion protein at pH 6.5 for 24 hours).
Detailed Description
Example 1: construction of fusion protein plasmids
Chemically synthesized pHLIP-Beclin 1 gene sequence
GGATCCGCGGCGGAACAGAACCCGATTTATTGGGCGCGCTATGCGGATTGGCTGTTTACC ACCCCGCTGCTGCTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACCTGCGG CACCAACGTGTTTAACGCGACCTTTCATATTTGGCATAGCGGCCAGTTTGGCACCTAACT CGAG, and designing BamH I and Xho I cutting sites at both ends of the target protein gene sequence. Then, the target protein gene is connected into a pET-32a vector through the enzyme cutting sites, so as to obtain a target protein expression vector. (see FIGS. 1 and 2)
Example 2: expression and purification of fusion proteins
(1) Expression of fusion proteins
The fusion protein expression vector is transformed into BL21(DE3) escherichia coli, and 50 mu L of bacterial liquid is firstly inoculated into 5mL of LB liquid culture medium, and the mixture is cultured for 8 hours at 37 ℃ and 200rpm by a shaking table. The bacterial suspension was transferred to 500mL of LB liquid medium, cultured at 37 ℃ and 200rpm until OD becomes 0.6-0.8, and expression was induced overnight with IPTG (1mM) at 16 ℃ and 200 rpm. (see FIG. 3)
(2) Purification of fusion proteins
The bacterial liquid induced and expressed by IPTG is centrifuged (8000rpm, 10min), and the supernatant is discarded to collect the bacteria. The precipitate was blown off with a 10mM PBS (pH 7.4), disrupted by sonication, 13000rpm, centrifuged for 20min, and the supernatant was collected. The supernatant was purified by Ni ion affinity chromatography, and after total protein was sufficiently adsorbed, the affinity column was washed with 10mM PBS (pH 7.4) buffer until the color of coomassie brilliant blue detection solution was not changed. Washing with 60mM imidazole buffer solution, eluting with 300mM imidazole buffer solution, and collecting the eluate to obtain the tumor acidity response autophagy inducing polypeptide, wherein the amino acid sequence of the polypeptide is SDQ ID NO: and detecting by 1, 12% SDS polyacrylamide gel electrophoresis. (see FIG. 4)
Example 3: crystal violet staining method for detecting influence of autophagy-inducing polypeptide on cell proliferation
MCF-7 cells in exponential growth phase at 5X 103The culture plate is transferred into 96-well culture plate at 37 deg.C and contains 5% CO2After 24h incubation in the incubator, different concentrations of the tag protein Trx, Beclin 1, and fusion protein were added to fresh culture medium at pH 7.4/6.5, respectively, to final concentrations of 0 μ M, 10 μ M, 50 μ M, and 100 μ M, in this order, with five duplicate wells for each concentration. After incubation for 24h, the liquid in the wells was aspirated and cleaned twice with PBS buffer, 50. mu.L of 0.5% crystal violet solution was added to each well, after staining for 20min at room temperature, the liquid in the wells was aspirated and cleaned twice with PBS buffer, and observed under 4-fold microscope using a BioTek staining 5 full-well imager. After observation, 200. mu.L of methanol solution was added to each well, and the mixture was shaken at room temperature for 20 min. The absorbance of each well at a wavelength of 570nm was measured using a microplate reader. (see FIG. 5)
Example 4: western Blot method for detecting autophagy of cells
MCF-7 cells in exponential growth phase at 1X 106One/well was introduced into a cell culture dish at 37 ℃ with 5% CO2After 24h incubation in the incubator, Trx, Beclin 1, and fusion protein were added to a fresh culture medium at pH 7.4/6.5 to a final concentration of 10 μ M, respectively, and a fresh culture medium was added to the control group. After 24h incubation, the culture medium was aspirated, washed twice with PBS buffer, the cells were collected in a 15mL centrifuge tube using a cell scraper, centrifuged at 1100rpm for 5min, and the supernatant was discarded. Add 1mL PBS per tube and resuspend and transfer to 1.5mL centrifuge tube, centrifuge at 1100rpm for 5min, discard the supernatant. Will be provided withPMSF and cell lysate were mixed at a ratio of 1: mixing at a ratio of 100, adding 30 μ L of the mixed solution into each tube, placing on ice for 30min after resuspension, centrifuging at 13000rpm for 10min, transferring the supernatant into a 200 μ L centrifuge tube, and placing into ice. Using BCA protein detection kit, adding 2 μ L of each group of proteins into a 96-well plate, adding 200 μ L of color development solution, placing into a 37 ℃ incubator for 30min, detecting the absorbance value of each well at the wavelength of 570nm by using an enzyme-labeling instrument, calculating the protein content in each microliter of supernatant, taking 40 μ g of proteins, and boiling at 100 ℃ for 8 min. Preparing 15% SDS polyacrylamide gel, loading, running the gel at 60V, and regulating the voltage to 90V to run the gel to the 1cm position of the gel plate after the sample enters the separation gel. Transferring the membrane (72V, 45min), observing the membrane with ponceau red for 5min, washing the membrane with TBST solution for three times, each time for 7min, sealing the membrane with 5% skimmed milk for 1h, adding primary antibody, incubating overnight at 4 ℃, washing the membrane with TBST solution for three times, each time for 7min, adding secondary antibody, incubating at room temperature for 2h, washing the membrane with TBST solution for three times, each time for 7min, and exposing the membrane with ECL luminous solution in a dark room. (see FIG. 6)
Example 5: Ad-mCherry-GFP-LC3B method for observing autophagosome quantity
MCF-7 cells in exponential growth phase at 1X 106One/well was transferred to 24-well culture plates plated with coverslips and 5% CO at 37 deg.C2Adding 10MOI adenovirus containing mCherry-GFP-LC3B plasmid into an incubator after 24h incubation, respectively adding Trx, Beclin 1 and fusion protein into fresh culture solution with the pH value of 7.4/6.5 after 24h incubation until the final concentration is 10 mu M, adding fresh culture solution into a control group, sucking the culture solution in a well after 12h incubation, washing 3 times with PBS buffer solution, adding a fixing solution, taking out a cover glass after 30min fixation at 4 ℃, putting the cover glass on a glass slide on which an anti-fluorescence quenching solution is dripped, and sealing the glass slide by using a Delta Vision high-resolution live cell imaging system for observation. (see FIG. 7).
Sequence listing
<120> tumor acidity response autophagy inducing polypeptide and preparation method and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 221
<212> PRT
<213> Escherichia coli (Escherichia coli)
<400> 1
Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp
1 5 10 15
Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp
20 25 30
Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala Asp
35 40 45
Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn
50 55 60
Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly Ile Pro Thr Leu Leu
65 70 75 80
Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser
85 90 95
Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly
100 105 110
Ser Gly His Met His His His His His His Ser Ser Gly Leu Val Pro
115 120 125
Arg Gly Ser Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln
130 135 140
His Met Asp Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met
145 150 155 160
Ala Asp Ile Gly Ser Ala Ala Glu Gln Asn Pro Ile Tyr Trp Ala Arg
165 170 175
Tyr Ala Asp Trp Leu Phe Thr Thr Pro Leu Leu Leu Leu Asp Leu Ala
180 185 190
Leu Leu Val Asp Ala Asp Glu Gly Thr Cys Gly Thr Asn Val Phe Asn
195 200 205
Ala Thr Phe His Ile Trp His Ser Gly Gln Phe Gly Thr
210 215 220
<210> 2
<211> 672
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgagcgata aaattattca cctgactgac gacagttttg acacggatgt actcaaagcg 60
gacggggcga tcctcgtcga tttctgggca gagtggtgcg gtccgtgcaa aatgatcgcc 120
ccgattctgg atgaaatcgc tgacgaatat cagggcaaac tgaccgttgc aaaactgaac 180
atcgatcaaa accctggcac tgcgccgaaa tatggcatcc gtggtatccc gactctgctg 240
ctgttcaaaa acggtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg 300
aaagagttcc tcgacgctaa cctggccggt tctggttctg gccatatgca ccatcatcat 360
catcattctt ctggtctggt gccacgcggt tctggtatga aagaaaccgc tgctgctaaa 420
ttcgaacgcc agcacatgga cagcccagat ctgggtaccg acgacgacga caaggccatg 480
gctgatatcg gatccgcggc ggaacagaac ccgatttatt gggcgcgcta tgcggattgg 540
ctgtttacca ccccgctgct gctgctggat ctggcgctgc tggtggatgc ggatgaaggc 600
acctgcggca ccaacgtgtt taacgcgacc tttcatattt ggcatagcgg ccagtttggc 660
acctaactcg ag 672
Claims (6)
1. A tumor acidity-responsive autophagy-inducing polypeptide having the amino acid sequence of SEQ ID NO: 1.
2. a gene encoding the tumor acidity-responsive autophagy-inducing polypeptide of claim 1, having the nucleotide sequence of SEQ ID NO: 2.
3. a vector comprising the gene of claim 2.
4. An engineered bacterium comprising the vector of claim 3.
5. The method of claim 1, wherein the method of preparing the tumor acidity-responsive autophagy inducing polypeptide comprises the steps of: chemically synthesizing genes of pHLIP and Beclin 1 active fragments, connecting the genes to a pET-32a expression vector through restriction enzyme sites to obtain a recombinant plasmid pET-32a-pHLIP-Beclin 1; transforming the strain into escherichia coli BL21(DE3), and screening to obtain an engineering bacterium pET-32a-pHLIP-Beclin 1/BL21(DE 3); inoculating the engineering bacteria into LB culture solution containing ampicillin, performing shaking culture at 37 deg.C until A600 nm is 0.6-0.8, adding IPTG to make the final concentration be 1mM, inducing expression at 16 deg.C overnight, collecting thallus, performing ultrasonic disruption, centrifuging, collecting supernatant, and performing affinity chromatography separation and purification to obtain the target protein.
6. The use of the tumor acidity response autophagy inducing polypeptide according to claim 1 in the preparation of a targeted anticancer drug, wherein the cancer is ovarian cancer, breast cancer or prostate cancer with Beclin 1 gene deletion mutation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710831001.4A CN107686523B (en) | 2017-09-15 | 2017-09-15 | Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710831001.4A CN107686523B (en) | 2017-09-15 | 2017-09-15 | Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107686523A CN107686523A (en) | 2018-02-13 |
| CN107686523B true CN107686523B (en) | 2021-05-14 |
Family
ID=61156408
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710831001.4A Active CN107686523B (en) | 2017-09-15 | 2017-09-15 | Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107686523B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109517073A (en) * | 2018-11-30 | 2019-03-26 | 北京泽勤生物医药有限公司 | A kind of fusogenic peptide of targeting therapy on tumor and its application |
| KR20210015717A (en) * | 2019-07-31 | 2021-02-10 | 주식회사 레모넥스 | Anticancer drug and preparing method for porous silica particle |
| CN112426438B (en) * | 2019-11-14 | 2023-12-05 | 上海鑫湾生物科技有限公司 | Composition for regulating immune response in acidic environment, preparation method and application thereof |
| CN112300264A (en) * | 2020-11-09 | 2021-02-02 | 青岛大学附属医院 | Synthetic labeling method of novel radioactive labeling anticancer drug |
| CN113372455A (en) * | 2021-06-17 | 2021-09-10 | 山西大学 | Fusion protein TpG, encoding gene, recombinant plasmid, strain and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206281A (en) * | 2011-03-28 | 2011-10-05 | 中国人民解放军第三军医大学第一附属医院 | Fusion protein TETPH, expression vector and construction method thereof |
| CN104045717A (en) * | 2014-07-08 | 2014-09-17 | 国家纳米科学中心 | Tumor vessel blocker polypeptide, gene, expression vector and application thereof |
| WO2017093330A1 (en) * | 2015-12-03 | 2017-06-08 | Genethon | Compositions and methods for improving viral vector efficiency |
-
2017
- 2017-09-15 CN CN201710831001.4A patent/CN107686523B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206281A (en) * | 2011-03-28 | 2011-10-05 | 中国人民解放军第三军医大学第一附属医院 | Fusion protein TETPH, expression vector and construction method thereof |
| CN104045717A (en) * | 2014-07-08 | 2014-09-17 | 国家纳米科学中心 | Tumor vessel blocker polypeptide, gene, expression vector and application thereof |
| WO2017093330A1 (en) * | 2015-12-03 | 2017-06-08 | Genethon | Compositions and methods for improving viral vector efficiency |
Non-Patent Citations (2)
| Title |
|---|
| Self-assembled Autophagy-Inducing Polymeric Nanoparticles for Breast Cancer Interference In-Vivo;Yi Wang 等;《advanced materials》;20150424;第1798卷(第6期);第2627页右栏第2段，FIGURE S2 * |
| Tuning the insertion properties of pHLIP;Monika Musial-Siwek 等;《Biomembranes》;20100615;第27卷(第16期);摘要、表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107686523A (en) | 2018-02-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107686523B (en) | Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof | |
| CA2305809A1 (en) | Use of the tumour suppressor gene p33ing1 for modulation of p53 activity and in tumour diagnosis | |
| KR20100093523A (en) | Cell permeable runx3 recombinant proteins, polynucleotides encoding the same, and anticancer compositions including the same | |
| CN116120451A (en) | anti-CD 70 internalizing antibodies, antibody conjugates and uses thereof | |
| KR20050085448A (en) | Regulatory zinc finger proteins | |
| CN109053875B (en) | Mutant IGF-1, recombinant plasmid, recombinant protein and application | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN113667018B (en) | BR 2-anti-p 21Ras single-chain antibody fusion protein capable of entering tumor cells and preparation method thereof | |
| CN114989266A (en) | African swine fever virus pA104R protein immunosuppression related amino acid site and application thereof | |
| CN111944056B (en) | Apoptosis protein fusion type anti-HER-2 single-chain antibody and preparation method and application thereof | |
| CN113214360B (en) | RHAMM antagonistic polypeptide, derivative and application thereof | |
| CN113912694B (en) | CD 133-targeting binding proteins and uses | |
| CN111116733B (en) | Antigen peptide and nano antibody of interaction interface of targeted programmed death receptor 1 and PD-1 ligand 1 | |
| CN114891084B (en) | Application of gene recombinant sea cucumber peptide rAj-HRP in antitumor drugs | |
| CN109371102B (en) | Anti-tumor drug screening model with RHBDD1 as target and method thereof | |
| CN103951756B (en) | The fusion protein of TAT Yu PR domain and the application in preparing antitumor drug thereof | |
| CN1565621A (en) | Obtainment of cell growth inhibiting polypeptide and its usage | |
| US7485621B2 (en) | Tumor tag and the use thereof | |
| EP4365294A1 (en) | Application of plant jaz proteins and derived polypeptides in prevention and treatment of human and animal tumors | |
| CN115475234A (en) | Application of plant JAZ protein and derivative polypeptide in preventing and treating human and animal tumors | |
| Bakhshandeh et al. | Molecular Cloning of DARPins G3 in pET28b Expression Vector and Optimization of the Expression of This Protein in Escherichia Coli | |
| Zheng et al. | Characterization of ST13 protein expression in human colorectal cancer tissues | |
| WO2015174641A1 (en) | Aimp2-dx2-34s protein and preparation method therefor | |
| CN113563474A (en) | EpCAM-CD16-NKG2D trispecific antibody and application thereof | |
| KR101841646B1 (en) | Method for the preparation of AIMP2-DX2 as a target for anti-cancer drug discovery |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |