CN107686523A - A kind of tumor acidity response autophagy inducing polypeptide and its preparation method and application - Google Patents
A kind of tumor acidity response autophagy inducing polypeptide and its preparation method and application Download PDFInfo
- Publication number
- CN107686523A CN107686523A CN201710831001.4A CN201710831001A CN107686523A CN 107686523 A CN107686523 A CN 107686523A CN 201710831001 A CN201710831001 A CN 201710831001A CN 107686523 A CN107686523 A CN 107686523A
- Authority
- CN
- China
- Prior art keywords
- beclin
- phlip
- autophagy
- inducing polypeptide
- pet
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4747—Apoptosis related proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides a kind of tumor acidity response autophagy inducing polypeptide and its preparation method and application.The sequence, is connected on pET 32a expression vectors, obtains recombinant plasmid by the low pH insertion peptides (pHLIP) of chemical synthesis and the gene order of the active fragments of Beclin 1 by restriction enzyme site.By the recombinant plasmid transformed to e. coli bl21 (DE3), screening obtains engineering bacteria pET 32a pHLIP Beclin 1/BL21 (DE3).The engineering bacteria collects thalline, isolates and purifies acquisition destination protein through IPTG induced expressions.The tumor acidity response autophagy inducing polypeptide of the present invention can be positioned by pHLIP to acidic cancer microenvironment, the targeting of the active fragments of Beclin 1 is transported in tumour cell, so as to which autophagy death occurs for induced tumor cell, can be applied in targeted anticancer medicine is prepared.
Description
Technical field
The present invention relates to biotechnological pharmaceuticses field, and in particular to a kind of tumor acidity response autophagy inducing polypeptide and its preparation side
Method and application of the polypeptide in targeted anticancer medicine is prepared.
Background technology
Beclin 1 is played a significant role by the regulation to autophagy in the generation, development in tumour.At present, Beclin 1 has been
It is confirmed as a new tumor suppressor gene.But it is reported that:75% oophoroma, 50% breast cancer and 40% prostate cancer
The middle Delete mutation that the genes of Beclin 1 be present, the expressing quantities of Beclin 1 decline, and autophagy function reduces.Therefore, if energy
Strengthen the expression of Beclin 1 in these tumor patients, and then start autophagy process, tumour cell will because of excessive autophagy and
Death, reach the purpose for suppressing tumour growth.However, Beclin 1 itself can not enter cell, inorganizable specificity and
Internal stability is poor, and this just greatly limit its application in oncotherapy.
The tumour cell of fast breeding has abnormal nutritional need and metabolic characteristics (Warburg effects) so that tumour micro-loop
Border has some unique features, can make a distinction the normal structure of almost all of malignant solid tumor and surrounding.With health
Tissue compares (pH 7.2-7.4), and tumor tissues have lower external pH (pH 6.5-7.0).Acid poisoning is tumour from morning
Phase to an important symbol of late progression, can provide new thinking for lesion detection and targeted therapy.Acidic cancer micro-loop
Border targets the pathophysiological features and biomarker independent of tumor tissues, can make up active targeting and passive target
It is insufficient existing for mode.
Low pH insertion peptides (pH low insertion peptide, pHLIP) are derived from bacteria rhodopsin C spirals
A kind of water-soluble polypeptide, it is made up of 36 amino acid, it in acid condition can be by forming stable cross-film α spirals by C-terminal
Insert in cell membrane.Therefore, pHLIP can be used as acidic cancer microenvironment targeting delivery vehicles by purpose medicine or gene delivery extremely
In tumour cell.
The content of the invention
It is an object of the invention to propose that a kind of tumor acidity response autophagy inducing polypeptide and preparation method thereof and the polypeptide are being made
Application in standby targeted anticancer medicine.
The tumor acidity response autophagy inducing polypeptide of the present invention includes successively from N-terminal to C-terminal:Label on pET-32a expression vectors
Albumen Trx amino acid sequences, tumor acidity response targeted molecular pHLIP sequences and the active fragments of autophagy initiation factor Beclin 1
Amino acid sequence.
The present invention provides a kind of tumor acidity response autophagy inducing polypeptide, and its amino acid sequence is SDQ ID NO:1, by 221
Amino acid forms.
The gene of the tumor acidity response autophagy inducing polypeptide is encoded, its nucleotides sequence is classified as SDQ ID NO:2, by 672
Nucleotides forms.
A kind of carrier, contain nucleotide sequence described above.It is by coding pHLIP-Beclin 1 nucleotide fragments gram
It is grand to the recombinant plasmid pET-32a-Trx-pHLIP-Beclin 1 obtained after prokaryotic expression carrier.The carrier is a germplasm
Grain.
A kind of engineering bacteria, contain carrier described above.Be by recombinant plasmid pET-32a-Trx-pHLIP-Beclin 1 convert to
In a kind of bacterium, such as e. coli bl21 (DE3), engineering bacteria pET-32a-Trx-pHLIP-Beclin 1/BL21 are built into
(DE3)。
A kind of preparation method of tumor acidity response autophagy inducing polypeptide, comprises the following steps:Chemical synthesis pHLIP and Beclin
The gene order of 1 active fragment, it is connected to by restriction enzyme site on pET-32a expression vectors, obtains restructuring matter
Grain.By in recombinant plasmid transformed to e. coli bl21 (DE3), screening obtains engineering bacteria pET-32a-Trx-pHLIP-Beclin
1/BL21(DE3).The engineering bacteria is inoculated into the LB nutrient solutions containing ampicillin, 37 DEG C of shaken cultivations to A 600nm are
During 0.6-0.8, adding IPTG makes its final concentration of 1mM, 16 DEG C of inductions overnight, collects thalline, and supernatant is collected by centrifugation in ultrasonication,
Destination protein is obtained through affinitive layer purification.
Tumor acidity responds application of the autophagy inducing polypeptide in cancer therapy drug is prepared.Led to from human breast carcinoma cell lines MCF-7
Cross the means such as crystal violet staining assay, Ad-mCherry-GFP-LC3B and Western Blot and carry out verifying purpose albumen Trx-
PHLIP-Beclin 1 biological activity, test result indicates that:Under the conditions of faintly acid (pH=6.5), Trx-pHLIP-
Beclin 1 can significantly inhibit MCF-7 growth and propagation, and its antitumor activity is significantly better than the single active tablets of Beclin 1
Section.Western Blot detect the change of autophagy GAP-associated protein GAP p62, LC3I and LC3II expression, and as a result display uses Trx-
P62 contents significantly reduce, LC3II contents dramatically increase after the processing cells of pHLIP-Beclin 1, show Trx-pHLIP-
Beclin 1 can induce tumour cell and autophagy occur.
Compared with prior art, beneficial effects of the present invention:Tumor acidity response autophagy inducing polypeptide provided by the invention has
Prepare the advantages that easy, yield is high, antitumor activity is strong.The polypeptide can quickly be obtained by escherichia coli prokaryotic expression, yield
Up to 21.8mg/L, its antitumor activity is significantly better than the single active fragments of Beclin 1 under mildly acidic conditions, therefore can
Applied in targeted anticancer medicine is prepared.
Brief description of the drawings
The target gene PCR amplification figures of Fig. 1 pHLIP-Beclin 1 (swimming lane 1 is standard molecular weight, and swimming lane 2 is target gene)
(swimming lane 1 is standard molecular weight to the recombinant plasmid positive clone identification figures of Fig. 2 pET-32a-Trx-pHLIP-Beclin 1, swimming
Road 2 to 10 is purpose gene)
Fig. 3 12%SDS-PAGE proteins gel electrophoresis testing goal albumen and label protein expression of results.(M:Standard molecular weight;
Swimming lane 1 represents to induce overnight through 1mM IPTG under the conditions of 16 DEG C containing empty plasmid thalline, after ultrasonication, centrifuges to obtain upper
Albumin sample;Swimming lane 2,3 and 4 represents to induce overnight through 1mM IPTG under the conditions of 16 DEG C containing recombinant plasmid thalline, and ultrasound is broken
The supernatant protein precipitation sample that the whole bacterial protein sample and centrifugation obtained after broken obtains;Swimming lane 5 represents the thalline without induction
After ultrasonication, obtained supernatant protein sample is centrifuged)
Fig. 4 12%SDS-PAGE proteins gel electrophoresis testing goal albumen and label protein expression and purification result (M:Standard molecule
Amount;Swimming lane 1,2 is respectively label protein rear albumen sample before purification;Swimming lane 3,4 is respectively albumen sample before and after fusion protein purification)
Fig. 5 crystal violet methods study various concentrations fusion protein to growth of tumour cell histamine result and statistical chart (A expressions in figure
After the crystallized purple dyeing of MCF-7 cells 24h being handled under the conditions of pH=7.4/6.5 using 10 μM of fusion proteins, cell propagation feelings
Condition.B is represented after being handled the crystallized purple dyeing of MCF-7 cells 24h using 10 μM of fusion proteins under the conditions of pH=7.4 in figure, first
Alcohol dissolving uses ELIASA measure light absorption value.C represents to handle MCF-7 using 10 μM of fusion proteins under the conditions of pH=6.5 in figure
After the crystallized purple dyeing of cell 24h, methanol dissolving uses ELIASA measure light absorption value)
Autophagy labelled protein LC3II and p62 albumen table after Fig. 6 Western Blot method detection fusions albumen processing MCF-7 cells
(after A expressions handle MCF-7 cells 24h under the conditions of pH=7.4/6.5 using 10 μM of fusion proteins in figure, used up to horizontal
Western blot methods detect p62, LC3I and LC3II protein expression level.B derives from the LC3-II/LC3-I of A in figure in figure
With p62/GAPDH gray values analysis result)
(A is represented under the conditions of pH=7.4 in figure for Fig. 7 Ad-mCherry-GFP-LC3B methods observation autophagosome quantity and statistical chart
After handling MCF-7 cells 24h using 10 μM of fusion proteins, counted by fluorescent spot and judge autophagy situation.B is represented in pH=in figure
After handling MCF-7 cells 24h using 10 μM of fusion proteins under the conditions of 6.5, counted by fluorescent spot and judge autophagy situation.C in figure
The A and B fluorescent spot points statistical result in figure.
Embodiment
Embodiment 1:The structure of fusion protein plasmid
The gene orders of chemical synthesis pHLIP-Beclin 1
GGATCCGCGGCGGAACAGAACCCGATTTATTGGGCGCGCTATGCGGATTGGCTGTTTACC
ACCCCGCTGCTGCTGCTGGATCTGGCGCTGCTGGTGGATGCGGATGAAGGCACCTGCGG
CACCAACGTGTTTAACGCGACCTTTCATATTTGGCATAGCGGCCAGTTTGGCACCT AACT CGAG, and in the purpose
The both ends of protein gene sequence separately design BamH I and Xho I restriction enzyme sites.Then, destination protein gene is passed through into above-mentioned enzyme
Enzyme site is connected in pET-32a carriers, so as to obtain destination protein expression vector.(see Fig. 1 and 2)
Embodiment 2:The expression and purifying of fusion protein
(1) expression of fusion protein
Above-mentioned fusion protein expression vector is transformed into BL21 (DE3) Escherichia coli, first connects 50 μ L bacterium solutions to 5mL LB liquid
In culture medium, 37 DEG C, 200rpm, shaking table culture 8h.Bacterium solution is transferred in 500mL LB fluid nutrient mediums, 37 DEG C,
200rpm, cultivate to OD=0.6-0.8, with 16 DEG C, 200rpm of IPTG (1mM), stay overnight induced expression.(see Fig. 3)
(2) purifying of fusion protein
The bacterium solution of above-mentioned IPTG induced expressions is centrifuged into (8000rpm, 10min), abandons supernatant, receives bacterium.Precipitation uses 10mM PBS
(pH=7.4) solution dispels, carrying out ultrasonic bacteria breaking, 13000rpm, centrifuges 20min, collects supernatant.It is pure using Ni ion affinity chromatography methods
Change supernatant, after total protein fully adsorbs, with 10mM PBS (pH=7.4) buffer solution for cleaning affinity column, be washed till Coomassie brilliant blue
It is non-discolouring to detect liquid.60mM imidazole buffers wash it is miscellaneous, 300mM imidazole buffers elution, collect eluent, that is, obtain tumor acidity
Autophagy inducing polypeptide is responded, its amino acid sequence is SDQ ID NO:1,12%SDS polyacrylamide gel electrophoresis detects.(see
Fig. 4)
Embodiment 3:Crystal violet staining assay detection autophagy inducing polypeptide cell proliferation influences
The MCF-7 cells of exponential phase of growth are with 5 × 103Individual/hole is passed to 96 well culture plates, 37 DEG C of CO for containing 5%2Incubator is incubated
After 24h, label protein Trx, Beclin 1, the fusion egg of various concentrations are added in pH=7.4/6.5 fresh mediums respectively
0 μM, 10 μM, 50 μM, 100 μM is followed successively by final concentration in vain, each concentration sets five multiple holes.Liquid in exhaustion hole after incubation 24h,
PBS cleans twice, the 50 μ L of addition per hole, 0.5% crystal violet solution, liquid in the hole that exhausted after room temperature dyeing 20min,
PBS rinses twice, uses the complete opening imagers of BioTek Cytation 5,4 times of Microscopic observations.Added after observation per hole
200 μ L methanol solutions, shaken at room temperature 20min.Absorbance of each hole at 570nm wavelength is detected using ELIASA.(see Fig. 5)
Embodiment 4:Western Blot methods detect cell autophagy
The MCF-7 cells of exponential phase of growth are with 1 × 106Individual/hole is passed in Tissue Culture Dish, 37 DEG C of CO for containing 5%2Incubator is incubated
After educating 24h, Trx, Beclin 1, fusion protein are added in pH=7.4/6.5 fresh mediums respectively to final concentration of 10 μM,
Control group adds fresh medium.Exhausted nutrient solution after incubation 24h, and PBS is cleaned twice, scraped using cell and receive cell
Combine in 15mL centrifuge tubes, 1100rpm centrifugation 5min, abandon supernatant.Often pipe plus 1mL PBS, which are resuspended, is transferred to 1.5mL centrifuge tubes
In, 1100rpm centrifugation 5min, abandon supernatant.By PMSF and cell pyrolysis liquid with 1:100 ratios mix, and often pipe adds 30 μ L mixing
Liquid, 30min on ice is positioned over after resuspension, 13000rpm centrifugation 10min, supernatant is transferred in 200 μ L centrifuge tubes, is put into ice
In.Using BCA protein detection kits, 2 μ L will be taken to add 96 orifice plates per histone, and add 200 μ L nitrite ions to be put into 37 DEG C of cultures
Case 30min, ELIASA detect absorbance of each hole at 570nm wavelength, protein content contained by every microlitre of supernatant of calculating, take 40 μ g
Albumen, 100 DEG C are boiled 8min.15%SDS polyacrylamide gels, loading are prepared, 60V runs glue, and sample is adjusted after entering separation gel
Whole voltage is that 90V runs glue at offset plate 1cm.Transferring film (72V, 45min), Ponceaux dyeing 5min observations, TBST solution washing three
It is secondary, each 7min, 5% skim milk closing 1h, primary antibody, 4 DEG C of overnight incubations are connect, TBST solution is washed three times, each 7min, connect
Secondary antibody, is incubated at room temperature 2h, and TBST solution is washed three times, each 7min, exposed using ECL luminescent solutions darkroom.(see Fig. 6)
Embodiment 5:Ad-mCherry-GFP-LC3B methods observe autophagosome quantity
The MCF-7 cells of exponential phase of growth are with 1 × 106Individual/hole is incoming to be covered with 24 well culture plates of cover glass, is contained at 37 DEG C
5% CO2Incubator adds the adenovirus that 10MOI contains mCherry-GFP-LC3B plasmids after being incubated 24h, divides after being incubated 24h
Trx, Beclin 1, fusion protein are added not in pH=7.4/6.5 fresh mediums to final concentration of 10 μM, control group adds
Fresh medium, nutrient solution in the hole that exhausts after 12h is cultivated, PBS cleans 3 times, fixer is added, after 4 DEG C of fixed 30min
Take out cover glass be put into drop have mounting on the slide of anti-fluorescent quenching liquid, by Delta Vision high-resolution living cells into
As system is observed.(see Fig. 7).
Sequence table
<120>A kind of tumor acidity response autophagy inducing polypeptide and its preparation method and application
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 221
<212> PRT
<213>Escherichia coli (Escherichia coli)
<400> 1
Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp
1 5 10 15
Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp
20 25 30
Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala Asp
35 40 45
Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn
50 55 60
Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly Ile Pro Thr Leu Leu
65 70 75 80
Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser
85 90 95
Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ser Gly
100 105 110
Ser Gly His Met His His His His His His Ser Ser Gly Leu Val Pro
115 120 125
Arg Gly Ser Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln
130 135 140
His Met Asp Ser Pro Asp Leu Gly Thr Asp Asp Asp Asp Lys Ala Met
145 150 155 160
Ala Asp Ile Gly Ser Ala Ala Glu Gln Asn Pro Ile Tyr Trp Ala Arg
165 170 175
Tyr Ala Asp Trp Leu Phe Thr Thr Pro Leu Leu Leu Leu Asp Leu Ala
180 185 190
Leu Leu Val Asp Ala Asp Glu Gly Thr Cys Gly Thr Asn Val Phe Asn
195 200 205
Ala Thr Phe His Ile Trp His Ser Gly Gln Phe Gly Thr
210 215 220
<210> 2
<211> 672
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
atgagcgata aaattattca cctgactgac gacagttttg acacggatgt actcaaagcg 60
gacggggcga tcctcgtcga tttctgggca gagtggtgcg gtccgtgcaa aatgatcgcc 120
ccgattctgg atgaaatcgc tgacgaatat cagggcaaac tgaccgttgc aaaactgaac 180
atcgatcaaa accctggcac tgcgccgaaa tatggcatcc gtggtatccc gactctgctg 240
ctgttcaaaa acggtgaagt ggcggcaacc aaagtgggtg cactgtctaa aggtcagttg 300
aaagagttcc tcgacgctaa cctggccggt tctggttctg gccatatgca ccatcatcat 360
catcattctt ctggtctggt gccacgcggt tctggtatga aagaaaccgc tgctgctaaa 420
ttcgaacgcc agcacatgga cagcccagat ctgggtaccg acgacgacga caaggccatg 480
gctgatatcg gatccgcggc ggaacagaac ccgatttatt gggcgcgcta tgcggattgg 540
ctgtttacca ccccgctgct gctgctggat ctggcgctgc tggtggatgc ggatgaaggc 600
acctgcggca ccaacgtgtt taacgcgacc tttcatattt ggcatagcgg ccagtttggc 660
acctaactcg ag 672
Claims (6)
1. a kind of tumor acidity responds autophagy inducing polypeptide, it is characterised in that is included successively from N-terminal to C-terminal:PET-32a expression carries
Label protein Trx amino acid sequences, tumor acidity response targeted molecular pHLIP sequences and autophagy initiation factor Beclin 1 on body
The amino acid sequence of active fragment;Its amino acid sequence is SDQ ID NO:1.
2. encoding the gene of tumor acidity response autophagy inducing polypeptide described in claim 1, its nucleotides sequence is classified as SDQ ID
NO:2.
3. a kind of carrier, contain the nucleotide sequence described in claim 2.
4. a kind of engineering bacteria, contain the carrier described in claim 3.
5. the preparation method of tumor acidity response autophagy inducing polypeptide as claimed in claim 1, is mainly included the following steps that:Change
The gene order of synthesis pHLIP and the active fragments of Beclin 1 is learned, pET-32a tables are connected to by restriction enzyme site
Up on carrier, recombinant plasmid pET-32a-pHLIP-Beclin 1 is obtained;E. coli bl21 (DE3) is transformed into, is screened
Obtain engineering bacteria pET-32a-pHLIP-Beclin 1/BL21 (DE3);The engineering bacteria is inoculated into the LB containing ampicillin to train
In nutrient solution, 37 DEG C of shaken cultivations to A 600nm are 0.6-0.8, and adding IPTG makes final concentration of 1mM, and 16 DEG C are stayed overnight induced expressions,
Thalline is collected, supernatant is collected by centrifugation in ultrasonication, is purified through affinity protein purification and obtains destination protein.
6. application of the tumor acidity response autophagy inducing polypeptide as claimed in claim 1 in targeted anticancer medicine is prepared.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710831001.4A CN107686523B (en) | 2017-09-15 | 2017-09-15 | Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710831001.4A CN107686523B (en) | 2017-09-15 | 2017-09-15 | Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107686523A true CN107686523A (en) | 2018-02-13 |
CN107686523B CN107686523B (en) | 2021-05-14 |
Family
ID=61156408
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710831001.4A Active CN107686523B (en) | 2017-09-15 | 2017-09-15 | Tumor acidity response autophagy inducing polypeptide and preparation method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107686523B (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110698565A (en) * | 2018-11-30 | 2020-01-17 | 北京泽勤生物医药有限公司 | Tumor-targeting CD38-pHLIP fusion peptides |
CN112300264A (en) * | 2020-11-09 | 2021-02-02 | 青岛大学附属医院 | Synthetic labeling method of novel radioactive labeling anticancer drug |
WO2021093881A1 (en) * | 2019-11-14 | 2021-05-20 | 上海鑫湾生物科技有限公司 | Composition for regulating immune response in acidic environment, and preparation method therefor and use thereof |
CN113372455A (en) * | 2021-06-17 | 2021-09-10 | 山西大学 | Fusion protein TpG, encoding gene, recombinant plasmid, strain and application thereof |
CN114206320A (en) * | 2019-07-31 | 2022-03-18 | 雷莫内克斯生物制药有限公司 | Anticancer agent and method for producing porous silica particles |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102206281A (en) * | 2011-03-28 | 2011-10-05 | 中国人民解放军第三军医大学第一附属医院 | Fusion protein TETPH, expression vector and construction method thereof |
CN104045717A (en) * | 2014-07-08 | 2014-09-17 | 国家纳米科学中心 | Tumor vessel blocker polypeptide, gene, expression vector and application thereof |
WO2017093330A1 (en) * | 2015-12-03 | 2017-06-08 | Genethon | Compositions and methods for improving viral vector efficiency |
-
2017
- 2017-09-15 CN CN201710831001.4A patent/CN107686523B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102206281A (en) * | 2011-03-28 | 2011-10-05 | 中国人民解放军第三军医大学第一附属医院 | Fusion protein TETPH, expression vector and construction method thereof |
CN104045717A (en) * | 2014-07-08 | 2014-09-17 | 国家纳米科学中心 | Tumor vessel blocker polypeptide, gene, expression vector and application thereof |
WO2017093330A1 (en) * | 2015-12-03 | 2017-06-08 | Genethon | Compositions and methods for improving viral vector efficiency |
Non-Patent Citations (2)
Title |
---|
MONIKA MUSIAL-SIWEK 等: "Tuning the insertion properties of pHLIP", 《BIOMEMBRANES》 * |
YI WANG 等: "Self-assembled Autophagy-Inducing Polymeric Nanoparticles for Breast Cancer Interference In-Vivo", 《ADVANCED MATERIALS》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110698565A (en) * | 2018-11-30 | 2020-01-17 | 北京泽勤生物医药有限公司 | Tumor-targeting CD38-pHLIP fusion peptides |
CN114206320A (en) * | 2019-07-31 | 2022-03-18 | 雷莫内克斯生物制药有限公司 | Anticancer agent and method for producing porous silica particles |
WO2021093881A1 (en) * | 2019-11-14 | 2021-05-20 | 上海鑫湾生物科技有限公司 | Composition for regulating immune response in acidic environment, and preparation method therefor and use thereof |
CN112300264A (en) * | 2020-11-09 | 2021-02-02 | 青岛大学附属医院 | Synthetic labeling method of novel radioactive labeling anticancer drug |
CN113372455A (en) * | 2021-06-17 | 2021-09-10 | 山西大学 | Fusion protein TpG, encoding gene, recombinant plasmid, strain and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN107686523B (en) | 2021-05-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107686523A (en) | A kind of tumor acidity response autophagy inducing polypeptide and its preparation method and application | |
CN109762070B (en) | Fusion antigen for detecting echinococcosis, encoding gene thereof, host cell and kit | |
CN111521816B (en) | Time-resolved fluorescence immunochromatographic assay test strip for echinococcosis granulosus of cattle and preparation method thereof | |
CN106543272A (en) | Multifunctional label fusion protein and its expression and application | |
CN108546287A (en) | A kind of antitumor fungal immunomodulatory protein Fip-bbo and its application | |
CN107304231B (en) | Mycobacterium tuberculosis fusion protein and application thereof | |
CN112851792A (en) | Preparation method and application of grass carp TNF-alpha recombinant protein | |
CN111574608A (en) | Specific detection antigen of echinococcosis granulosus of cattle and application thereof | |
CN111518188B (en) | Specific detection antigen of echinococcosis granulosus of cattle and application thereof | |
CN107903307A (en) | A kind of high-affinity EDB FN targeting proteins peptides and its application | |
CN111796090B (en) | Time-resolved fluorescence immunochromatographic assay test strip for echinococcosis granulosus of cattle and preparation method thereof | |
CN108003239B (en) | Fully human anti-EGFR single-chain antibody and application thereof | |
CN106459172A (en) | TRAIL double target mutant protein MuR5S4TR, and preparation method and application thereof | |
CN109053875A (en) | Saltant type IGF-1, recombinant plasmid, recombinant protein and application | |
CN111944056B (en) | Apoptosis protein fusion type anti-HER-2 single-chain antibody and preparation method and application thereof | |
CN101921335A (en) | Hybrid tumor generating anti-AMP-18 (Antrum Mucosalprotein-18) monoclonal antibody as well as anti-AMP-18 monoclonal antibody and application thereof in gastric carcinoma detection | |
CN110078832B (en) | ZZ domain-based secondary antibody and preparation method and application thereof | |
CN115166235A (en) | African swine fever virus double-antigen sandwich antibody detection kit and preparation method thereof | |
CN102993283B (en) | Antigen protein for mycobacterium tuberculosis and application | |
CN112812192B (en) | ProA/G-dRep fusion protein serving as nucleic acid-antibody conjugate universal carrier and application thereof | |
CN108841830A (en) | The active antigens and high-affinity antibody of people's ischemic-type injury of kidney clinical detection NGAL | |
CN110128540A (en) | A kind of wide spectrum secondary antibody based on portable glucose meter | |
CN110004170A (en) | The recombinant plasmid of the gene of SMIM25 containing someone, genetic engineering bacterium, recombinant protein, more anti-and preparation method and application | |
CN109576229A (en) | A kind of monoclonal antibody hybridoma cell strain and its application for secreting anti-AGR2 | |
CN109734792A (en) | People CNTN1 antigen, people's CNTN1 antibody assay kit and the preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |