CN108003239B

CN108003239B - Fully human anti-EGFR single-chain antibody and application thereof

Info

Publication number: CN108003239B
Application number: CN201711355416.5A
Authority: CN
Inventors: 谢珞琨; 满来; 李峥; 许春萍
Original assignee: Yicon Beijing Medical Science And Technology Co ltd; Beijing Gegen Biotechnology Co ltd
Current assignee: Yicon Beijing Medical Science And Technology Co ltd; Beijing Gegen Biotechnology Co ltd
Priority date: 2017-12-16
Filing date: 2017-12-16
Publication date: 2020-10-23
Anticipated expiration: 2037-12-16
Also published as: CN108003239A

Abstract

The invention discloses a fully human anti-EGFR single-chain antibody, which has a unique CDR region and has high specific recognition capability on antigen. The single-chain antibody has excellent tumor binding effect and specific binding to different types of tumor cell lines. The invention also discloses the application of the antibody coupled with the indicator in preparing in-vitro tumor diagnosis reagent and in-vivo biological imaging agent, when the imaging agent is applied to a tumor animal model, the single-chain antibody marked with near infrared fluorescence can clearly show the size and the position of the mouse tumor, and has extremely high in-vivo imaging capability.

Description

Fully human anti-EGFR single-chain antibody and application thereof

Technical Field

The present invention relates to an antibody, and more particularly, to a single chain antibody.

Background

Tumors are the most life threatening diseases for humans. The world health organization research shows that the number of cancer attacks in China in 2012 is 306.5 ten thousands, which accounts for about one fifth of the worldwide attack; the number of cancer deaths is 220.5 ten thousand, accounting for about one fourth of the cancer deaths worldwide.

Clinical diagnosis techniques of tumors are also gradually increasing. From the initial detection of tumor markers, ultrasound, fluoroscopy and other means, more technologies of protein level and molecular level detection, CT, nuclear magnetism, PET, SPET, tumor minimally invasive biopsy and the like of tumor related factors are developed and widely applied clinically.

Epidermal Growth Factor Receptor (EGFR)₎Is a transmembrane receptor with tyrosine kinase activity, is commonly expressed in epidermal cells of human body, andstromal cells exist in various human malignant tumors, and are highly expressed, so that the stromal cells are closely related to the occurrence and development of malignant tumors. High expression of EGFR can promote proliferation, angiogenesis, adhesion, invasion and metastasis of tumor cells. EGFR signaling is involved in apoptosis, proliferation, differentiation, migration, and cell cycle cycling of cells, and is closely related to the formation and progression of tumors. By blocking the combination of EGFR and its ligand, the signal transmission of EGFR to cells can be inhibited, thereby achieving the effect of inhibiting the growth and migration of tumor cells. Based on the property of EGFR to lose control over overexpression in human tumorigenesis, its role as a marker for tumorigenesis is receiving increasing attention in the field of tumor diagnosis.

The diagnosis of tumors is divided into in vitro and in vivo diagnosis. Immunohistochemical staining of tumor tissue is an important indicator for the confirmation of tumors in vitro. In vivo diagnosis, tumor imaging is typically performed using imaging agents and then using instruments. In vivo imaging of tumors not only allows for early diagnosis of tumors, but also allows for real-time monitoring of the efficacy of anti-tumor therapy and the progression of tumors. Because it is a non-invasive examination, the pain to the patient is small, and it has become the necessary diagnostic means for clinical diagnosis and tumor treatment. At present, radionuclide imaging and nuclear magnetism are commonly used for in vivo imaging of tumors in hospitals.

In recent years, optical imaging is widely applied to the field of tumor research with the advantages of non-invasiveness, real time, high resolution and the like, and can be used for early diagnosis of tumors and reflecting the anatomical structures and metabolic conditions of the tumors. Near-infrared fluorescence imaging is a hotspot of research in the field of optical molecular imaging at present, the spectral range of the near-infrared fluorescence imaging is 700-1000nm, the spontaneous fluorescence interference of a monitored organism and a monitored tissue in the waveband range is small, the tissue penetrating distance can reach several centimeters, and the imaging accuracy and sensitivity are improved.

With the increasing number of tumor targets, research using antibodies specific for tumor target antigens as indicators has been advanced. However, the current whole molecule antibody has a large molecular weight, cannot be rapidly distributed to the whole body, and cannot well bind to some shielded target positions, so the feasibility of the antibody as an indicator is greatly reduced. Even if genetic engineering techniques create antibody fragments with small molecular weight that have only antigen-binding function, so that this idea can be realized, the antibodies of the prior art have limited further application of this diagnostic means due to problems such as low specificity and low adaptability of antibody-indicator conjugation.

Disclosure of Invention

Based on the problems of the prior art, the invention aims to develop a single-chain antibody with specific recognition capability against Endothelial Growth Factor Receptor (EGFR), and further provides a detection antibody which can be used as an in vitro diagnostic reagent and an in vivo imaging agent.

Based on the above objects, the present invention provides, in a first aspect, a fully human anti-EGFR single chain antibody, wherein the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain of the antibody are shown in SEQ ID nos. 1, 2 and 3, respectively, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain of the antibody are shown in SEQ ID nos. 5, 6 and 7, respectively.

In a preferred embodiment, the amino acid sequences of the light chain variable region and the heavy chain variable region of the antibody are shown in SEQ ID No.4 and 8, respectively.

In a more preferred embodiment, the variable region of the light chain and the variable region of the heavy chain of the antibody are linked by a linker polypeptide.

In a most preferred embodiment, the amino acid sequence of the linker polypeptide is shown in SEQ ID NO. 9.

Secondly, the invention provides a biomacromolecule conjugate which comprises any one of the antibodies.

In a preferred embodiment, in the conjugate, a near-infrared fluorescent protein or horseradish peroxidase is conjugated to the antibody.

Finally, the invention provides the application of the conjugate in preparing tumor diagnosis preparations.

In a preferred technical scheme, the near-infrared fluorescent protein is coupled with the antibody, and the conjugate is prepared into an immunofluorescence diagnostic reagent.

In another preferred embodiment, the horseradish peroxidase is conjugated to the antibody, and the conjugate is prepared as an immunohistochemical diagnostic reagent.

In yet another preferred embodiment, the near-infrared fluorescent protein is conjugated to the antibody, and the conjugate is prepared as an in vivo fluorescence imaging agent.

The invention utilizes a phage antibody library method to screen ScFv with high affinity and anti-EGFR, and then uses horse radish peroxidase or near infrared fluorescence labeling coupling as an in vitro immunofluorescence diagnosis antibody, an immunohistochemical diagnosis antibody and an in vivo fluorescence imaging agent respectively. The anti-EGFR single-chain antibody provided by the invention can be specifically combined with EGFR protein in tumor tissues, and has excellent affinity, and the affinity constant is 5.37 multiplied by 10^-10And M. Whereas most autoantibodies have an affinity constant of less than 10^-5--8M, therefore, the anti-EGFR single-chain antibody can compete for the combination of the autoantibody and the EGFR surface antigen when used for in vivo diagnosis and development, and can stain and develop tumor cells and tissues after being coupled with a proper indicator, thereby showing the good prospect of the anti-EGFR single-chain antibody in the preparation of in vivo and in vitro diagnosis reagents. The invention selects the small antibody molecular fragment, and the single-chain antibody has small molecular weight and can be expressed in a prokaryotic cell expression system, so the production cost of the antibody drug can be greatly reduced. The single-chain antibody provided by the invention is derived from a human phage antibody library, so that the sequence of the single-chain antibody is fully human, and the single-chain antibody has very low immunogenicity when used as a therapeutic drug or an in vivo imaging diagnostic reagent in a human body.

Drawings

FIG. 1 is a graph identifying VH and VL PCR products;

FIG. 2 is a vector map and a recombinant vector identification map;

FIG. 3 is a bar graph of the binding assay of the selected EGFR ScFv to EGFR protein;

FIG. 4 shows the identification chart of the purified EGFR ScFv polyacrylamide gel electrophoresis;

FIG. 5 is a graph of EGF blocking the binding of EGFR ScFv to EGFR protein;

FIG. 6A is a graph showing the immunofluorescence result of the near-infrared fluorescence labeled EGFR ScFv against colon cancer tumor cells HT 29;

FIG. 6B is a graph showing immunofluorescence results blocked by non-fluorescently labeled EGFR ScFv;

FIG. 7 is a diagram showing the histochemical chromogenic microscope for liver metastasis of mouse colon cancer by horseradish peroxidase-labeled EGFR ScFv;

FIG. 8 is an in vivo imaging of near infrared fluorescence labeled EGFR ScFv against mouse pancreatic cancer orthotopic tumors.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of the present invention.

Example 1 preparation of anti-EGFR Single chain antibody

1.1 creation of high pool Capacity Natural antibody pools.

Isolation of human peripheral blood mononuclear lymphocytes: 100 healthy adults were randomly selected and 10ml of peripheral blood was drawn from each adult. Diluted with 10% heparin-containing RPMI-1640 culture solution 1:1, added to a centrifuge tube containing lymphocyte separation solution (volume ratio of diluted venous blood to lymphocyte separation solution is 2:1), centrifuged at 2,000 Xg for 17 minutes. Sucking the milky white mononuclear cell layer on the interface of the lymphocyte separation solution, and washing twice by using PBS buffer solution.

1.2 extraction of Total RNA from cells

Every 5X 10⁶cells/ml were lysed by adding Trizol reagent and pipetting the cells. Incubate at room temperature for 5 minutes, transfer to DEPC treated EP tubes, add 1/5 volumes of chloroform, shake vigorously for 15 seconds, incubate at room temperature for 3 minutes. Centrifuge at 10,000 Xg for 15 minutes at 4 ℃ and aspirate the upper aqueous phase into a new centrifuge tube, add 1/2 volumes of isopropanol and ice-wash for 10 minutes. After centrifugation at 12,000 Xg for 10 minutes at 4 ℃ the supernatant was discarded and the precipitate was washed with 1ml of 75% ethanol. Centrifuging at 7,500 Xg for 5 min at 4 deg.C, removing supernatant, drying the precipitate at room temperature, dissolving in RNase-free water or precipitating in absolute ethanol, -80Storing at deg.C for use.

1.3 reverse transcription Synthesis of the first strand cDNA

Total RNA was first treated with RNase-free DNase I to eliminate residual genomic DNA. Mu.g of the treated RNA sample and 1. mu.l of oligo (dT)15 (500. mu.g/ml) were taken, supplemented with DEPC water to 12. mu.l, heated at 70 ℃ for 10 minutes. Taking out, immediately placing in an ice bath, and sequentially adding 5 multiplied by Buffer of 5 mu l; dNTP (10mmol/L) 5. mu.l; 1 mul RNase inhibitor and 1 mul MMLV reverse transcriptase, adding DEPC water to 25 mul, keeping the temperature at 42 ℃ for 60 minutes to carry out reverse transcription reaction, and inactivating the enzyme activity at 70 ℃ for 15 minutes.

1.4PCR amplification of VH and VL genes

The first cDNA chain synthesized by reverse transcription was used as a template, and the expressed VH and VL genes were amplified using human ScFv antibody library primers. The reaction system is as follows:

primer 1 (forward): 5 'GAGCTCCAGATGACCCAGTC 3'

Primer 2 (reverse): 5 'TTTAATCTCCAGTCGTGTCCC 3'

PCR parameters: after denaturation at 94 ℃ for 3 min, 30 sec at 94 ℃ again; 30 seconds at 61 ℃; PCR was performed at 72 ℃ for 1 min for 30 cycles and final extension at 72 ℃ for 10 min. After the reaction, 5. mu.l of the reaction product was analyzed by 1% agarose gel electrophoresis.

PCR product recovery

(1) The PCR product was subjected to 1.5% agarose gel electrophoresis, and the objective DNA fragment was excised from the agarose gel and placed in a 1.5ml centrifuge tube.

(2) 400. mu.l of sol solution A was added and dissolved at 70 ℃ for 5 minutes until the gel was completely dissolved.

(3) Adding 200 mul of sol liquid B, mixing evenly, and sucking all liquid into a recovery column.

(4) Centrifuge at 12,000 Xg for 1 min and discard the waste.

(5) 500. mu.l of the neutralized solution was added, centrifuged at 12,000 Xg for 1 minute, and the waste solution was discarded.

(6) Add 700. mu.l of washing solution, centrifuge at 12,000 Xg for 1 minute, discard the waste.

Repeating the step 6) for 1 time.

(7) After centrifugation at 12,000 Xg for 2 minutes, the waste liquid was discarded, and the recovery column was transferred to a new receiver tube and dried at room temperature for 5 minutes.

(8) 30. mu.l of deionized water was added, centrifuged at 12,000 Xg for 1 minute, and the DNA fragment was eluted and stored at-20 ℃ until use.

1.5 bridging PCR method for splicing VH and VL

The VH and VL fragments were concatenated using the prepared VH and VL fragments as templates.

And (3) PCR reaction system:

RSC-F：5’GAGCTCCAGATGACCCAGTCTCCA3’

RSC-B：5’ACTAGTCACATCCGGAGCCTTGGT3’

the PCR conditions were pre-denaturation at 94 ℃ for 5 min, followed by 30 cycles with the following parameters: denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 45 seconds, extension at 72 ℃ for 1 and a half minutes, and final extension at 72 ℃ for 10 minutes. The gel recovery step was repeated, the PCR product was dissolved in 30. mu.l ddH₂And (4) in O. FIG. 1 shows agarose gel electrophoresis of VH + VL concatemers in the right lane and DNA molecular weight markers in the left lane.

1.6 to a phage vector,

sfi1 enzyme digestion vector and PCR product

The digestion was carried out at 37 ℃ for 2 hours, and the digested fragments were recovered in the same manner.

Ligation reaction

The above reactants were mixed well and centrifuged to settle at the bottom of the tube, and then connected overnight at 4 ℃. The digested fragment is connected with pComb3XSS vector fragment to construct recombinant plasmid. FIG. 2 is an electrophoretic identification chart of the recombinant vector. Wherein, the left lane is the restriction map of the recombinant fragment pComb3XSS vector, and the right lane is the molecular weight marker.

1.7 transformation and expression

Transforming (electrically transferring) the constructed vector (plasmid) into Escherichia coli (specific Escherichia coli), amplifying the Escherichia coli, adding helper phage, and collecting the recombinant phage which is a phage antibody library.

The detected library capacity of the natural ScFv antibody library of the hundreds of people is 2 x 10¹⁰Completely meet the requirement of antibody screening.

1.8 screening of EGFR antibodies

Taking 10ul of antibody from an antibody library, amplifying in escherichia coli, collecting the amplified antibody library, coating an ELISA plate with EGFR protein, adding the antibody library, incubating, washing non-specific phage, digesting specifically bound phage, infecting the digested phage with escherichia coli, coating the plate, selecting a monoclonal cenobium, inducing in a small amount, taking the supernatant of the induced monoclonal cenobium as an ELISA screening positive clone, verifying for many times, respectively measuring the affinity of the antibody by using two methods, namely ELISA affinity measurement and Biacore measurement, selecting the antibody with high affinity and specificity (the affinity reaches 10)^-9-10^-10M) for antibody expression. FIG. 3 shows the binding assay of the EGFR ScFv and EGFR protein thus selected. Among them, clone No. 7 has the highest OD value, showing that it has high specific affinity as high as 5.37X 10^-10M, selecting the clone to carry out further sequence analysis.

Through sequence analysis, the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain of the ScFv clone are respectively shown in SEQ ID NO.1, 2 and 3, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain of the antibody are respectively shown in SEQ ID NO.5, 6 and 7.

The amino acid sequences of the light chain variable region and the heavy chain variable region of the antibody are respectively shown in SEQ ID NO.4 and 8.

The single-chain antibody provided by the invention is derived from a humanized phage antibody library, so that the sequence of the single-chain antibody is fully humanized, and a low immunogenicity foundation is laid for the use of the antibody as a therapeutic drug or an in vivo imaging diagnostic reagent in a human body.

The antibody was further modified by adding a linker polypeptide as shown in SEQ ID NO.9 between the light and heavy chains. The nucleotide sequence (SEQ ID NO.10) encoding the single-chain antibody was cloned into pGEM-T Easy and transformed into E.coli DH5 alpha for storage. When preparing the single-chain antibody, the nucleotide sequence coding the single-chain antibody is cloned into an expression vector PET28a⁺Vector, retransformed into the corresponding BL₂₁(DE₃) In the host bacteria of the escherichia coli, the optimal expression conditions are screened for carrying out a large amount of induced expression, and finally, the optimal purification method and buffer solution are selected to obtain the antibody protein. FIG. 4 shows the purified EGFR ScFv polyacrylamide gel electrophoresis identification chart.

Coli DH5 α was stored in this chamber and the genotype was: supE44 Δ lacU169

hsdR17recA1end1gyr96thi-1relA1, used for plasmid amplification and transformation.

Escherichia coli BL₂₁(DE₃) The genotype is hsdS gal (lambda cIts857ind1Sam7nin5lacUV5-T7) for recombinant protein expression.

pGEM-T Easy: clones for PCR products were purchased from Promega corporation.

Prokaryotic expression plasmid vectors pET28a, pET42 and pGEX-4t-1 are all preserved in the room.

Purification of EGFR Single chain antibodies

EGFR ScFv-His6 containing a six histidine tag was filtered through a 0.45 μm filter to prepare a column.

The HisTrap kit affinity column was equilibrated with Binding Buffer 10ml and the prepared sample to be purified was added. The flow rate was adjusted to be about 8-10 drops/min.

The column was washed using a Binding Buffer.

The column was eluted using 6ml of Elution Buffer. Collecting the eluent by tubes. A small amount of the protein was subjected to SDS-PAGE, and the results are shown in FIG. 4, in which the target band was around 25KD and the tubes rich in the target protein were stored at-70 ℃.

Example 2 blocking assay of EGF for binding to EGFR Single chain antibody and EGFR protein

The EGFR single-chain antibody can block the binding of EGFR protein and EGF which is a ligand of the EGFR single-chain antibody through competition ELISA test verification.

Different dilutions of EGF were mixed with EGFR single chain antibody, added to wells coated with EGFR protein, incubated for 1 hour, and subjected to conventional ELISA procedures. The results are shown in FIG. 5. As can be seen from fig. 5, as the EGF concentration is increased, the smaller the OD value, which means that the EGF has a stronger blocking effect on the binding of the EGFR single-chain antibody and EGFR. The results show that the EGFR single-chain antibody can block the combination of the EGFR and the EGF serving as a ligand in the body, and the IC of the EGFR single-chain antibody is calculated₅₀The value was 0.005 mg/ml.

Example 3 cellular immunofluorescence staining (confocal) of near Infrared fluorescently labeled EGFR ScFv

Binding of EGFR ScFv to tumor cells was verified using the colon cancer cell line HT 29.

Firstly, near-infrared fluorescence labeling of EGFR ScFv is carried out, and the steps are as follows:

(1) the antibody to be crosslinked (concentration. gtoreq.1 mg/ml) was dialyzed against the crosslinking reaction solution three times (4 ℃ C.) to pH 9.0.

The preparation method of the crosslinking reaction liquid comprises the following steps: 7.56g NaHCO₃，1.06g Na₂CO₃7.36g of NaCl, and water was added to the solution to a volume of 1L.

(2) Near infrared fluorescent protein (IRDye800) was dissolved in DMSO at a concentration of 1 mg/ml. The near-infrared fluorescent protein used in each cross-linking should be prepared fresh and protected from light.

(3) The near infrared fluorescent protein was slowly added to the antibody solution at a ratio of P: F (antibody: near infrared fluorescent protein) of 1mg:150 μ g, and gently shaken while adding to mix the antibody solution uniformly, followed by reaction at 4 ℃ in the dark for 8 hours.

(4) Adding 5mol/L NH₄Cl to a final concentration of 50mmol/L, and the reaction was terminated at 4 ℃ for 2 hours.

(5) The cross-linked material was dialyzed in PBS for more than four times until the dialysate was clear.

(6) And (4) identifying a cross-linked substance.

The protein concentration (mg/ml) is [ A280-0.31 xA 495]/1.4, the F/P ratio is 3.1 xA 495/[ A280-0.31 xA 495], and the value is between 2.5 and 6.5.

The near-infrared fluorescent protein cross-linked antibody is put into phosphate buffer solution with pH7.4, and 0.1 percent NaN is added₃1% BSA, stored at 4 ℃ in the dark.

Then, cell staining was performed by the following steps:

1) cells were seeded in confocal special petri dishes and washed three times with ice PBS for 5 minutes each.

2) When the cells were semi-dry, they were covered with 4% cold paraformaldehyde for 15 minutes and protected from light.

3) After the paraformaldehyde was aspirated, the column was washed three times with ice PBS for 5 minutes each.

4) Cells were covered with 0.5% Triton X-100 for 10 min and washed three times with ice PBS for 5 min each.

5) The imported fetal calf serum was blocked for 30 minutes at room temperature.

6) Primary anti-EGFR ScFv: FBS 1:200 was formulated.

7) Add primary anti-cover cells and wrap in tinfoil overnight at 4 ℃ in the dark.

8) The next day, cells were removed and allowed to re-warm to room temperature for about 1 hour.

9) Washed twice with 1 ‰ Tween ice for 5 min each time in a shaker. One wash with ice PBS for 5 min on a shaker.

10) DAPI stained nuclei, 1 drop per dish, completely covering the cells.

11) Washed twice with 1 ‰ Tween ice for 5 min each time in a shaker. One wash with ice PBS for 5 min on a shaker.

12) Adding the anti-fluorescence quenching sealing tablet and keeping out light.

13) And (4) operating the computer confocol.

The results are shown in FIGS. 6A and 6B. Fig. 6A shows that EGFR ScFv labeled with red fluorescent protein can bind to EGFR on the surface of HT29 cell membrane, making the whole cell appear red, DAPI stains the nucleus blue, and the two colors coincide with each other, indicating that the red fluorescence shows cell morphology, and fig. 6B shows that the staining of HT29 cells with EGFR ScFv not labeled with fluorescence can be blocked, and a significant decrease in red fluorescence of the cells can be seen. Indicating that the EGFR ScFv is specific for binding to HT29 cells. The results of the examples show that the EGFR ScFv can image cells.

Example 4 immunohistochemical staining of colorectal cancer cells by EGFR ScFv

HT29 cells were used to generate a liver metastasis model of colon cancer in mice. And (3) taking a tumor tissue for frozen section, staining the tissue section by using an EGFR ScFv marked by horseradish peroxidase, and observing the color development effect of the EGFR ScFv on the tumor tissue.

First, the EGFR ScFv was labeled with horseradish peroxidase. The method comprises the following steps:

(1) 5mg of HRP was weighed out and dissolved in 1ml of distilled water.

(2) Adding 0.2ml of newly prepared 0.1M NaIO into the supernatant₄The solution was stirred at room temperature for 20 minutes in the absence of light.

(3) The above solution was filled into a dialysis bag, dialyzed against 1mM sodium acetate buffer pH4.4 at 4 ℃ overnight.

(4) Mu.l of 0.2M carbonate buffer pH9.5 was added to raise the pH of the above-described hydroformylation HRP to 9.0-9.5, and 10mg of IgG antibody (or SPA5mg) was immediately added thereto, followed by gentle stirring in 1ml of 0.01M carbonate buffer at room temperature for 2 hours in the absence of light.

(5) Adding 0.1ml of newly formulated 4mg/ml NaBH₄Mixing the solutions, and standing at 4 deg.C for 2 hr.

(6) The above solution was filled into dialysis bags and dialyzed against 0.15M PH7.4PBS at 4 ℃ overnight.

(7) Centrifugation was carried out at 10000 Xg for 30 minutes at 4 ℃.

(8) The supernatant was transferred to another tube and the volume 1:1 Glycerol was added to bring the final concentration to 50%.

(9) Storing at-20 deg.C.

Then, immunohistochemical staining is carried out by a direct method, the method is simple and rapid, and the EGFR ScFv which is specifically marked is combined with the antigens in the tissue cells.

The operation process comprises the following steps:

(1) freezing the slices, fixing, and drying with PBS; paraffin sections were deparaffinized to water, digested for 30 min, and washed with PBS.

(2) The appropriate dilution of fluorescent antibody was added dropwise to the tissue sections, wet box at 37 ℃ temperature 1 h incubation, PBS wash 3x 3 minutes.

(3) And (3) carrying out lining dyeing on 0.01% Evan blue for 1-3 minutes, washing with PBS for 3 multiplied by 3 minutes, washing with distilled water for 2 times, and removing NaCl crystals.

(4) Buffered glycerol mounting at pH 9.0.

(5) And (6) microscopic examination.

The results are shown in FIG. 7. HT29 cells are used for establishing a mouse colon cancer liver metastasis tumor model, a part of tumor tissues are taken for frozen tissue section, then antibody staining is carried out, and the tumor cells are stained brown by the EGFR ScFv single-chain antibody. The coloring is uniform and the dyeing is specific. Therefore, the EGFR ScFv single-chain antibody can be used as an in vitro biopsy histochemical stain.

Example 5 use of EGFR ScFv as in vivo fluorescence imaging Agents

EGFR ScFv is marked by near infrared fluorescence (IRDye800), then pancreatic cancer in situ tumor model mice are injected into tail veins, and the distribution of the fluorescence-marked single-chain antibody in the tumor model mice is observed.

The results are shown in FIG. 8. A: pancreatic cancer orthotopic tumor mice photo, it can be seen that pancreatic tissue is ulcerated, tumorigenic. By utilizing the self-luminous imaging of pancreatic cancer cells, the position of pancreatic carcinoma in situ in a mouse body can be seen, and the mouse skin can be seen to have bright spots which are skin metastasis focuses. B: the distribution of fluorescently labeled probes in the mouse was collected at different time points. The fluorescent color comprises three colors of blue, green and red, the red is a specific color, and the others are background colors. The mouse liver tumor tissue was seen to exhibit red fluorescence after 1 hour of tail vein injection, and the probe had accumulated at the tumor site. Liver red fluorescence began to decrease after 6 hours and was essentially cleared after 12 hours. C: self-illuminated 3D imaging. D: 3D imaging of near infrared fluorescence. The imaging sites of the probe and the probe are consistent, so that the near infrared marked EGFR ScFv probe can be used for in vivo imaging.

Sequence listing

<110> Beijing Gegen Biotechnology Ltd

Jiekang (Beijing) pharmaceutical science and technology Co., Ltd

<120> fully human anti-EGFR single-chain antibody and application thereof

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>6

<212>PRT

<213>Homo sapiens

<400>1

Gln Ser Ile Ser Ser Tyr

1 5

<210>2

<211>3

<212>PRT

<213>Homo sapiens

<400>2

Ala Ala Ser

1

<210>3

<211>8

<212>PRT

<213>Homo sapiens

<400>3

Gln Gln Ser Tyr Ser Thr Pro Thr

1 5

<210>4

<211>412

<212>PRT

<213>Homo sapiens

<400>4

Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg

1 5 10 15

Val Thr Ile Thr Cys Arg Ala Ser Gln Ser IleSer Ser Tyr Leu Asn

20 25 30

Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala

35 40 45

Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly

50 55 60

Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp

65 70 75 80

Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Tyr Ser Thr Pro Thr Gly Ala

85 90 95

Gly Cys Thr Cys Cys Ala Gly Ala Thr Gly Ala Cys Cys Cys Ala Gly

100 105 110

Thr Cys Thr Cys Cys Ala Thr Cys Cys Thr Cys Cys Cys Thr Gly Thr

115 120 125

Cys Thr Gly Cys Ala Thr Cys Thr Gly Thr Ala Gly Gly Ala Gly Ala

130 135 140

Cys Ala Gly Ala Gly Thr Cys Ala Cys Cys Ala Thr Cys Ala Cys Thr

145 150 155 160

Thr Gly Cys Cys Gly Gly Gly Cys Ala Ala Gly Thr Cys Ala Gly Ala

165 170 175

Gly Cys Ala Thr Thr Ala Gly Cys Ala Gly Cys Thr Ala Thr Thr Thr

180 185 190

Ala Ala Ala Thr Thr Gly Gly Thr Ala Thr Cys Ala Gly Cys Ala Gly

195 200 205

Ala Ala Ala Cys Cys Ala Gly Gly Gly Ala Ala Ala Gly Cys Cys Cys

210 215 220

Cys Thr Ala Ala Ala Cys Thr Cys Cys Thr Gly Ala Thr Cys Thr Ala

225 230 235 240

Thr Gly Cys Thr Gly Cys Ala Thr Cys Cys Ala Gly Thr Thr Thr Gly

245 250 255

Cys Ala Ala Ala Gly Thr Gly Gly Gly Gly Thr Cys Cys Cys Ala Thr

260 265 270

Cys Ala Ala Gly Gly Thr Thr Cys Ala Gly Thr Gly Gly Cys Ala Gly

275 280 285

Thr Gly Gly Ala Thr Cys Thr Gly Gly Gly Ala Cys Ala Gly Ala Thr

290 295 300

Thr Thr Cys Ala Cys Thr Cys Thr Cys Ala Cys Cys Ala Thr Cys Ala

305 310 315 320

Gly Cys Ala Gly Thr Cys Thr Gly Cys Ala Ala Cys Cys Thr Gly Ala

325 330 335

Ala Gly Ala Thr Thr Thr Thr Gly Cys Ala Ala Cys Thr Thr Ala Cys

340 345 350

Thr Ala Cys Thr Gly Thr Cys Ala Ala Cys Ala Gly Ala Gly Thr Thr

355 360 365

Ala Cys Ala Gly Thr Ala Cys Cys Cys Cys Cys Ala Cys Cys Thr Thr

370 375 380

Cys Gly Gly Cys Cys Ala Ala Gly Gly Gly Ala Cys Ala Cys Gly Ala

385 390 395 400

Cys Thr Gly Gly Ala Gly Ala Thr Thr Ala Ala Ala

405 410

<210>5

<211>8

<212>PRT

<213>Homo sapiens

<400>5

Gly Phe Thr Phe Ser Ser Tyr Asp

1 5

<210>6

<211>8

<212>PRT

<213>Homo sapiens

<400>6

Ile Ser Tyr Asp Gly Asp Ser Lys

1 5

<210>7

<211>14

<212>PRT

<213>Homo sapiens

<400>7

Ala Lys Ala Thr Ser Gly Leu Ser Asp Thr Pro Leu Asp His

1 5 10

<210>8

<211>502

<212>PRT

<213>Homo sapiens

<400>8

Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser

1 5 10 15

Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Asp

20 25 30

Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala

35 40 45

Val Ile Ser Tyr Asp Gly Asp Ser Lys Tyr Ser Ala Asp Ser Val Arg

50 55 60

Gly Arg Phe Ile Ile Ser Arg Asp Asn Ser Glu Asn Thr Val Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Thr Glu Asp Thr Ala Val Tyr Tyr Cys Ala

85 90 95

Lys Ala Thr Ser Gly Leu Ser Asp Thr Pro Leu Asp His Gly Ala Gly

100 105 110

Gly Thr Gly Cys Ala Gly Cys Thr Gly Gly Thr Gly Gly Ala Gly Thr

115120 125

Cys Thr Gly Gly Gly Gly Gly Ala Gly Gly Cys Thr Thr Gly Gly Thr

130 135 140

Ala Cys Ala Gly Cys Cys Thr Gly Gly Gly Gly Gly Gly Thr Cys Cys

145 150 155 160

Cys Thr Gly Ala Gly Ala Cys Thr Cys Thr Cys Cys Thr Gly Thr Gly

165 170 175

Cys Ala Gly Cys Cys Thr Cys Thr Gly Gly Ala Thr Thr Cys Ala Cys

180 185 190

Cys Thr Thr Cys Ala Gly Thr Ala Gly Cys Thr Ala Cys Gly Ala Cys

195 200 205

Ala Thr Gly Cys Ala Cys Thr Gly Gly Gly Thr Cys Cys Gly Cys Cys

210 215 220

Ala Gly Gly Cys Thr Cys Cys Ala Gly Gly Cys Ala Ala Gly Gly Gly

225 230 235 240

Gly Cys Thr Gly Gly Ala Gly Thr Gly Gly Gly Thr Gly Gly Cys Thr

245 250 255

Gly Thr Thr Ala Thr Ala Thr Cys Ala Thr Ala Thr Gly Ala Thr Gly

260 265 270

Gly Ala Gly Ala Thr Thr Cys Thr Ala Ala Ala Thr Ala Cys Thr Cys

275280 285

Thr Gly Cys Ala Gly Ala Cys Thr Cys Cys Gly Thr Gly Ala Gly Gly

290 295 300

Gly Gly Cys Cys Gly Ala Thr Thr Cys Ala Thr Cys Ala Thr Cys Thr

305 310 315 320

Cys Cys Ala Gly Ala Gly Ala Cys Ala Ala Cys Thr Cys Cys Gly Ala

325 330 335

Gly Ala Ala Cys Ala Cys Ala Gly Thr Cys Thr Ala Thr Cys Thr Gly

340 345 350

Cys Ala Ala Ala Thr Gly Ala Ala Cys Ala Gly Cys Cys Thr Gly Ala

355 360 365

Gly Ala Ala Cys Thr Gly Ala Gly Gly Ala Cys Ala Cys Gly Gly Cys

370 375 380

Thr Gly Thr Thr Thr Ala Thr Thr Ala Cys Thr Gly Thr Gly Cys Gly

385 390 395 400

Ala Ala Ala Gly Cys Cys Ala Cys Gly Thr Cys Ala Gly Gly Thr Thr

405 410 415

Thr Gly Ala Gly Cys Gly Ala Thr Ala Cys Cys Cys Cys Ala Cys Thr

420 425 430

Thr Gly Ala Cys Cys Ala Cys Thr Gly Gly Gly Gly Cys Cys Ala Gly

435 440445

Gly Gly Ala Ala Cys Cys Cys Thr Gly Gly Thr Cys Ala Cys Cys Gly

450 455 460

Thr Cys Thr Cys Cys Thr Cys Ala Gly Cys Ala Cys Cys Cys Ala Cys

465 470 475 480

Cys Ala Ala Gly Gly Cys Thr Cys Cys Gly Gly Ala Thr Gly Thr Gly

485 490 495

Ala Cys Thr Ala Gly Thr

500

<210>9

<211>11

<212>PRT

<213>Homo sapiens

<400>9

Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10

<210>10

<211>744

<212>DNA

<213>Homo sapiens

<400>10

gagctccaga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60

atcacttgcc gggcaagtca gagcattagc agctatttaa attggtatca gcagaaacca 120

gggaaagccc ctaaactcct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180

aggttcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct 240

gaagattttg caacttacta ctgtcaacag agttacagta cccccacctt cggccaaggg 300

acacgactgg agattaaagg tggcggtggc ggttctggtg gtggtggatc tgaggtgcag 360

ctggtggagt ctgggggagg cttggtacag cctggggggt ccctgagact ctcctgtgca 420

gcctctggat tcaccttcag tagctacgac atgcactggg tccgccaggc tccaggcaag 480

gggctggagt gggtggctgt tatatcatat gatggagatt ctaaatactc tgcagactcc 540

gtgaggggcc gattcatcat ctccagagac aactccgaga acacagtcta tctgcaaatg 600

aacagcctga gaactgagga cacggctgtt tattactgtg cgaaagccac gtcaggtttg 660

agcgataccc cacttgacca ctggggccag ggaaccctgg tcaccgtctc ctcagcaccc 720

accaaggctc cggatgtgac tagt 744

Claims

1. A fully human anti-EGFR single-chain antibody, wherein the amino acid sequences of the light chain variable region and the heavy chain variable region of the single-chain antibody are respectively shown as SEQ ID NO.4 and 8.

2. The single chain antibody of claim 1, wherein the light chain variable region and the heavy chain variable region of said single chain antibody are linked by a linker polypeptide.

3. The single chain antibody of claim 2, wherein the amino acid sequence of said linker polypeptide is as set forth in SEQ id No. 9.

4. A biomacromolecule conjugate in which a near-infrared fluorescent protein or horseradish peroxidase is conjugated to a single-chain antibody according to any one of claims 1 to 3.

5. Use of the conjugate of claim 4 for the preparation of a tumor diagnostic formulation.

6. The use according to claim 5, wherein the near-infrared fluorescent protein is conjugated to the single-chain antibody, and the conjugate is prepared as an immunofluorescent diagnostic reagent.

7. The use of claim 5, wherein said horseradish peroxidase is conjugated to said single-chain antibody, and said conjugate is prepared as an immunohistochemical diagnostic reagent.

8. The use of claim 5, wherein the near-infrared fluorescent protein is conjugated to the single-chain antibody, and the conjugate is prepared as an in vivo fluorescence imaging agent.