CN108129564B

CN108129564B - Fully human anti-VEGF single-chain antibody and application thereof

Info

Publication number: CN108129564B
Application number: CN201711359721.1A
Authority: CN
Inventors: 谢珞琨; 满来; 李峥; 许春萍
Original assignee: Yicon Beijing Medical Science And Technology Co ltd; Beijing Gegen Biotechnology Co ltd
Current assignee: Yicon Beijing Medical Science And Technology Co ltd; Beijing Gegen Biotechnology Co ltd
Priority date: 2017-12-17
Filing date: 2017-12-17
Publication date: 2020-07-28
Anticipated expiration: 2037-12-17
Also published as: CN108129564A

Abstract

The invention discloses a fully human anti-VEGF single-chain antibody, which has a unique CDR region and has a high-specificity recognition capability on antigen. The single-chain antibody has excellent tumor binding effect and specific binding to different pancreatic cancer cell lines. The invention also discloses the application of the antibody coupled with the indicator in preparing in-vitro tumor diagnosis reagent and in-vivo biological imaging agent. When the imaging agent is applied to a tumor animal model, the single-chain antibody marked with near-infrared fluorescence can clearly show the size and the position of a mouse tumor, and has extremely high in-vivo imaging capability.

Description

Fully human anti-VEGF single-chain antibody and application thereof

Technical Field

The present invention relates to an antibody, and more particularly, to a single chain antibody.

Background

Tumors are the most life threatening diseases for humans. The world health organization research shows that the number of cancer attacks in China in 2012 is 306.5 ten thousands, which accounts for about one fifth of the worldwide attack; the number of cancer deaths is 220.5 ten thousand, accounting for about one fourth of the cancer deaths worldwide.

Clinical diagnosis techniques of tumors are also gradually increasing. From the initial detection of tumor markers, ultrasound, fluoroscopy and other means, more technologies of protein level and molecular level detection, CT, nuclear magnetism, PET, SPET, tumor minimally invasive biopsy and the like of tumor related factors are developed and widely applied clinically.

The diagnosis of tumors is divided into in vitro and in vivo diagnosis. Immunohistochemical staining of tumor tissue is an important indicator for the confirmation of tumors in vitro. In vivo diagnosis, tumor imaging is typically performed using imaging agents and then using instruments. In vivo imaging of tumors not only allows for early diagnosis of tumors, but also allows for real-time monitoring of the efficacy of anti-tumor therapy and the progression of tumors. Because it is a non-invasive examination, it brings little pain to patients, and has become an indispensable diagnostic means for clinically definite diagnosis and treatment of tumors. At present, radionuclide imaging and nuclear magnetism are commonly used for in vivo imaging of tumors in hospitals.

In recent years, optical imaging is widely applied to the field of tumor research with the advantages of non-invasiveness, real time, high resolution and the like, and can be used for early diagnosis of tumors and reflecting the anatomical structures and metabolic conditions of the tumors. Near-infrared fluorescence imaging is a hotspot of research in the field of optical molecular imaging at present, the spectral range of the near-infrared fluorescence imaging is 700-1000nm, the spontaneous fluorescence interference of a monitored organism and a monitored tissue in the waveband range is small, the tissue penetrating distance can reach several centimeters, and the imaging accuracy and sensitivity are improved.

The targets used to confirm the tumor are usually cell surface proteins. We find that Vascular Endothelial Growth Factor (VEGF) can also be used as a target for tumor diagnosis, and VEGF is a secreted soluble protein and can directly act on vascular endothelial cells to promote the proliferation of the vascular endothelial cells and increase the vascular permeability. Research shows that benign tumor angiogenesis is rare and the growth of blood vessels is slow; while angiogenesis is dense and rapidly growing in most malignant tumors. Therefore, angiogenesis plays an important role in the development and metastasis of tumors, and inhibition of this process would significantly prevent the development and spread metastasis of tumor tissues. Antibodies against vascular endothelial growth factor may be used in tissue section staining and confocal staining, as well as in vivo as tumor imaging agents.

With the increasing number of tumor targets, research using antibodies specific for tumor target antigens as indicators has been advanced. However, the conventional whole molecule antibody has a large molecular weight, cannot be rapidly distributed to the whole body, and cannot well bind to some shielded target sites, so that the feasibility of the antibody as an indicator is greatly reduced. However, genetic engineering techniques have created antibody fragments with small molecular weights that have only antigen binding functions, making this idea practical. However, the small molecular weight antibody fragment also has problems in application, such as poor stability, low specificity, presence of heterologous immune reaction, low adaptability of antibody to indicator, and the like, thereby limiting further application of the diagnostic means.

Disclosure of Invention

Based on the problems of the prior art, the invention aims to develop a single-chain antibody of anti-Vascular Endothelial Growth Factor (VEGF) with specific recognition capability, further provides a bioconjugate of an indicator and the antibody, and provides application of the bioconjugate in preparing in-vitro diagnostic reagents and in-vivo imaging agents.

Based on the above objects, the present invention provides, in a first aspect, a single-chain antibody against vegf, wherein the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain of the antibody are shown in SEQ ID nos. 1, 2 and 3, respectively, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain of the antibody are shown in SEQ ID nos. 5, 6 and 7, respectively.

In a preferred embodiment, the amino acid sequences of the light chain variable region and the heavy chain variable region of the antibody are shown in SEQ ID No.4 and 8, respectively.

In a more preferred embodiment, the variable region of the light chain and the variable region of the heavy chain of the antibody are linked by a linker polypeptide.

In a most preferred embodiment, the amino acid sequence of the linker polypeptide is shown in SEQ ID NO. 9.

Secondly, the invention provides a biomacromolecule conjugate which comprises any one of the antibodies.

In a preferred embodiment, in the conjugate, green fluorescent protein, near-infrared fluorescent protein or horseradish peroxidase is conjugated to the antibody. Finally, the invention provides the application of the conjugate in preparing tumor diagnosis preparations.

In a preferred technical scheme, the green fluorescent protein is coupled with the antibody, and the conjugate is prepared into an immunofluorescence diagnostic reagent.

In another preferred embodiment, the horseradish peroxidase is conjugated to the antibody, and the conjugate is prepared as an immunohistochemical diagnostic reagent.

In yet another preferred embodiment, the near-infrared fluorescent protein is conjugated to the antibody, and the conjugate is prepared as an in vivo fluorescence imaging agent.

The invention utilizes phage antibody library method to screen ScFv of high affinity anti-VEGF, then uses green fluorescent protein, horseradish peroxidase or near infrared fluorescent protein label coupling as in vitro immunofluorescence diagnosis, immunohistochemical diagnosis antibody and in vivo fluorescence imaging agent respectively, the anti-VEGF single chain antibody provided by the invention can specifically bind VEGF protein in tumor tissue, has excellent affinity, and the affinity constant is 2.14 × 10^-10And M. Whereas most autoantibodies have an affinity constant of less than 10^-5--8And M, so the anti-VEGF single-chain antibody can compete for the combination of the autoantibody and VEGF when used for in vivo diagnosis and development, and can stain and develop tumor cells and tissues after being coupled with a proper indicator, thereby showing the good prospect of the anti-EGFR single-chain antibody in the preparation of in vivo and in vitro diagnosis reagents. The invention selects the small antibody molecular fragment, and the single-chain antibody has small molecular weight and can be expressed in a prokaryotic cell expression system, so the production cost of the antibody drug can be greatly reduced. Moreover, the anti-VEGF single-chain antibody is obtained by screening an antibody library prepared from human antibody genes, has a gene sequence of full human origin and low immunogenicity, can be applied to a human body as a medicament, and is also a favorable factor for being used as an in vivo imaging agent.

Drawings

FIG. 1 is a graph showing the identification of VH and V L PCR products;

FIG. 2 is a vector map and a recombinant vector identification map;

FIG. 3 is a bar graph showing the binding assay between the VEGF ScFv and VEGF-165 protein; FIG. 4. identification of purified VEFG ScFv polyacrylamide gel electrophoresis;

FIG. 5 is a graph of the binding assay of VEGFR blocking VEGF ScFv with VEGF-165 protein;

FIG. 6 is a graph showing immunofluorescence results of FITC-labeled VEGF ScFv against pancreatic cancer tumor cells;

FIG. 7 shows histochemical coloration of horse radish peroxidase-labeled VEGF ScFv against mouse pancreatic cancer in situ tumors;

FIG. 8 is an in vivo imaging graph of near infrared fluorescence labeled VEGF ScFv on mouse pancreatic cancer orthotopic tumor.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are only illustrative and do not limit the scope of the present invention.

Example 1 preparation of anti-VEGF Single chain antibody

1.1 creation of high pool Capacity Natural antibody pools.

Separating human peripheral blood mononuclear lymphocytes, namely randomly selecting 100 healthy adults, extracting 10ml of peripheral blood of each human, diluting the peripheral blood by using 10% heparin-containing RPMI-1640 culture solution 1:1, adding the diluted peripheral blood to a centrifuge tube filled with lymphocyte separation liquid (the volume ratio of diluted venous blood to the lymphocyte separation liquid is 2:1), centrifuging the diluted venous blood for 17 minutes, extracting a milky mononuclear cell layer on the interface of the lymphocyte separation liquid, and washing the milky mononuclear cell layer twice by using PBS buffer.

1.2 extraction of Total RNA from cells

According to each 5 × 10⁶Adding Trizol reagent into cells/ml, blowing and cracking the cells, incubating at room temperature for 5 minutes, transferring into an EP tube treated by DEPC, adding 1/5 volumes of chloroform, violently shaking for 15 seconds, incubating at room temperature for 3 minutes, incubating at 4 ℃, centrifuging for 15 minutes at 10,000 × g, sucking the upper aqueous phase into a new centrifuge tube, adding 1/2 volumes of isopropanol, carrying out ice bath for 10 minutes, centrifuging for 10 minutes at 4 ℃, 12,000 × g, discarding the supernatant, adding 1ml of 75% ethanol, washing the precipitate at 4 ℃, centrifuging for 5 minutes at 7,500 × g, discarding the supernatant, drying the precipitate at room temperature, dissolving in RNase-free water or precipitating in absolute ethanol, and storing at-80 ℃ for later use.

1.3 reverse transcription Synthesis of the first strand cDNA

The total RNA is treated by RNase-free DNase I to eliminate residual genome DNA, 2 mu g of treated RNA sample and 1 mu l of oligo (dT)15(500 mu g/ml) are taken, DEPC water is added to 12 mu l, the mixture is heated for 10 minutes at 70 ℃, the mixture is taken out and then immediately placed in an ice bath, 5 × Buffer5 mu l, 5 mu l of dNTP (10 mmol/L), 1 mu l of RNase inhibitor and 1 mu l of MM L V reverse transcriptase are added, DEPC water is added to 25 mu l, the mixture is subjected to heat preservation for 60 minutes at 42 ℃ to carry out reverse transcription reaction, and the enzyme activity is inactivated at 70 ℃ for 15 minutes.

1.4 PCR amplification of VH and V L genes

The first cDNA chain synthesized by reverse transcription is used as a template, and expressed VH and V L genes are amplified by adopting human ScFv antibody library primers, wherein the reaction system comprises the following steps:

deionized water was added to a final volume of 50. mu.l.

Primer 1:5 'GAGCTCCAGATGACCCAGTCTCCT 3'

Primer 2:5 'ACTAGTGACGGATGGGCTCTGTGT 3'

PCR parameters: after denaturation at 94 ℃ for 3 min, 30 sec at 94 ℃ again; 30 seconds at 61 ℃; PCR was performed at 72 ℃ for 1 min for 30 cycles and final extension at 72 ℃ for 10 min. After the reaction, 5. mu.l of the reaction product was analyzed by 1% agarose gel electrophoresis.

PCR product recovery

(1) The PCR product was subjected to 1.5% agarose gel electrophoresis, and the objective DNA fragment was excised from the agarose gel and placed in a 1.5ml centrifuge tube.

(2) 400. mu.l of sol solution A was added and dissolved at 70 ℃ for 5 minutes until the gel was completely dissolved.

(3) Adding 200 mul of sol liquid B, mixing evenly, and sucking all liquid into a recovery column.

(4) Centrifuge at 12,000 × g for 1 minute and discard the waste.

(5) 500. mu.l of the neutralized solution was added thereto, and centrifuged at 12,000 × g for 1 minute, and the waste liquid was discarded.

(6) Add 700. mu.l of washing solution, centrifuge for 1 minute at 12,000 × g, and discard the waste.

Repeating the step (6) for 1 time.

(7) Centrifuge at 12,000 × g for 2 minutes, discard the waste, transfer the recovery column to a new receiver tube, and dry at room temperature for 5 minutes.

(8) 30. mu.l of deionized water was added, and the mixture was centrifuged at 12,000 × g for 1 minute to elute the DNA fragment and stored at-20 ℃ until use.

1.5 splicing of VH and V L by bridge PCR

The VH and V L fragments were concatenated using the VH and V L fragments prepared as templates.

And (3) PCR reaction system:

RSC-F:5’GCTGGAGATCAAAGGTGGCGGT3’

RSC-B:5’TGTAGCTGCACCTGAGATCCACC3’

the PCR conditions were pre-denaturation at 94 ℃ for 5 min, followed by 30 cycles with the following parameters: denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 45 seconds, extension at 72 ℃ for 1.5 minutes, and final extension at 72 ℃ for 10 minutes. The gel recovery step was repeated, the PCR product was dissolved in 30. mu.l ddH₂In O, FIG. 1 shows the identification of VH and V L PCR products, in which the right lane is the VH + V L concatemer.

1.6 to a phage vector,

sfi1 enzyme digestion vector and PCR product

The digestion was carried out at 37 ℃ for 2 hours, and the digested fragments were recovered in the same manner.

Ligation reaction

The above reactants were mixed well and centrifuged to settle at the bottom of the tube, and then connected overnight at 4 ℃. The digested fragment is connected with pComb3XSS vector fragment to construct recombinant plasmid. FIG. 2 is an electrophoretic identification chart of the recombinant vector. Wherein, the right lane is the restriction map of the recombinant fragment pComb3XSS vector, and the left lane is the molecular weight marker.

1.7 transformation and expression

Transforming (electrically transferring) the constructed vector (plasmid) into Escherichia coli (specific Escherichia coli), amplifying the Escherichia coli, adding helper phage, and collecting the recombinant phage which is a phage antibody library.

The detected library capacity of the natural ScFv antibody library of the hundreds of people is 2 x 10¹⁰Completely meet the requirement of antibody screening.

1.8 screening of VEGF antibodies

Taking 10ul of the monoclonal antibody from an antibody library, amplifying the monoclonal antibody in escherichia coli, collecting the amplified antibody library, coating E L ISA plates with VEGF A subtype protein, adding the antibody library, incubating, washing non-specific phage, digesting specifically bound phage, infecting the digested phage on escherichia coli, coating the plates, picking monoclonal cenobium, inducing in a small amount, taking supernatant of the monoclonal bacteria after inducing in a small amount as E L ISA screening positive clone, and selecting high affinity and specificity (the affinity reaches 10) after multiple verification^-8-10^-9KD) were subjected to antibody expression. FIG. 3 shows the binding assay of the selected VEGF ScFv to VEGF-165 protein. Among them, clone 5, which had the highest OD value, showed a high specific affinity, was selected for further sequence analysis.

Through sequence analysis, the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the light chain of the ScFv clone are respectively shown in SEQ ID NO.1, 2 and 3, and the amino acid sequences of the CDR1, CDR2 and CDR3 regions of the heavy chain of the antibody are respectively shown in SEQ ID NO.5, 6 and 7.

The amino acid sequences of the light chain variable region and the heavy chain variable region of the antibody are respectively shown in SEQ ID NO.4 and 8.

The single-chain antibody provided by the invention is derived from a phage antibody library of human origin, so that the sequence of the single-chain antibody is completely human, and the single-chain antibody is used as a treatment in a human bodyThe use of therapeutic medicine or in vivo imaging diagnosis reagent lays the foundation of low immunogenicity, the antibody is further modified, the connecting polypeptide shown as SEQ ID No.9 is added between the light chain and the heavy chain, the nucleotide sequence (SEQ ID No.10) for encoding the single-chain antibody is cloned into pGEM-T Easy and transformed into Escherichia coli DH5 α for storage, when preparing the single-chain antibody, the nucleotide sequence for encoding the single-chain antibody is cloned into an expression vector pET30 and then transformed into a corresponding expression bacterium B L₂₁(DE₃) In the method, the optimal expression condition is screened for carrying out a large amount of induced expression, and finally, the optimal purification method and buffer solution are selected to obtain the antibody protein. FIG. 4 shows the identification of purified VEFG ScFv polyacrylamide gel electrophoresis.

Escherichia coli DH5 α is stored in the chamber, and the genotype is supE44 delta lacU169

hsdR17recA1end1gyr96thi-1relA1, used for plasmid amplification and transformation.

Escherichia coli B L₂₁(DE₃) The genotype is hsdS gal (lambda cIts857ind1Sam7nin5lacUV5-T7) for recombinant protein expression.

pGEM-T Easy: clones for PCR products were purchased from Promega corporation.

Prokaryotic expression plasmid vectors pET30, pET42 and pGEX-4t-1 are all preserved in the room.

Purification of VEGF Single chain antibodies

The fusion protein VEGF ScFv-GH-His6 containing the six histidine tags was filtered through a 0.45 μm filter and prepared for column chromatography.

The HisTrap kit affinity column was equilibrated with Binding Buffer 10ml and the prepared sample to be purified was added. The flow rate was adjusted to be about 8-10 drops/min.

The column was washed using a Binding Buffer.

The column was eluted using 6ml of Elution Buffer. Collecting the eluent by tubes. A small amount of the protein was subjected to SDS-PAGE, and the results are shown in FIG. 4, in which the target band was around 25KD and the tubes rich in the target protein were stored at-70 ℃.

Example 2 blocking assay of binding of VEGFR to VEGF Single chain antibody and VEGF-165 protein

The results are shown in figure 5. from figure 5, it can be seen that as the concentration of VEGFR2 increases, the smaller the OD value, which means that VEGFR2 has a stronger blocking effect on the binding of VEGF single-chain antibody and VEGF-165, i.e. the VEGF single-chain antibody can block the binding of VEGF-165 to its receptor VEGFR2 in the body₅₀The value was 0.002 mg/ml.

Example 3 cellular immunofluorescence staining (confocal) of Green fluorescent protein (FITC) -labeled VEGF ScFv

The binding of VEGF ScFv to tumor cells was verified using the pancreatic cancer cell line panc-1.

First, FITC was used to label VEGF ScFv, as follows:

(1) the antibody to be crosslinked (concentration. gtoreq.1 mg/ml) was dialyzed against the crosslinking reaction solution three times (4 ℃ C.) to pH 9.0. The preparation method of the crosslinking reaction liquid comprises the following steps: 7.56g NaHCO₃，1.06g Na₂CO₃7.36g NaCl, added with water to a volume of 1L.

(2) FITC was dissolved in DMSO at a concentration of 1 mg/ml. FITC for each cross-linking should be prepared fresh and protected from light.

(3) FITC was slowly added to the antibody solution at a ratio of 1mg to 150 μ g of P: F (antibody: FITC), mixed with the antibody by gently shaking while adding, and reacted at 4 ℃ for 8 hours in the dark.

(4) 5 mol/L of NH were added₄Cl to a final concentration of 50 mmol/L, the reaction was terminated at 4 ℃ for 2 hours.

(5) The cross-linked material was dialyzed in PBS for more than four times until the dialysate was clear.

(6) And (4) identifying a cross-linked substance.

The protein concentration (mg/ml) is [ A280-0.31 × A495]/1.4, the F/P ratio is 3.1 × A495/[ A2800.31 × A495], the value is between 2.5 and 6.5, the FITC cross-linked antibody is placed in phosphate buffer with pH7.4, 0.1% NaN3 and 1% BSA are added, and the mixture is stored at 4 ℃ in the dark.

Then, cell staining was performed by the following steps:

1) cells were seeded in confocal special petri dishes and washed three times with ice PBS for 5 minutes each.

2) When the cells were semi-dry, they were covered with 4% cold paraformaldehyde for 15 minutes and protected from light.

3) After the paraformaldehyde was aspirated, the column was washed three times with ice PBS for 5 minutes each.

4) Cells were covered with 0.5% Triton X-100 for 10 min and washed three times with ice PBS for 5 min each.

5) The imported fetal calf serum was blocked for 30 minutes at room temperature.

6) Primary anti-VEGF ScFv: FBS 1:200 was formulated.

7) Add primary anti-cover cells and wrap in tinfoil overnight at 4 ℃ in the dark.

8) The next day, cells were removed and allowed to re-warm to room temperature for about 1 hour.

9) Washed twice with 1 ‰ Tween ice for 5 min each time on a shaker. One wash with ice PBS for 5 min on a shaker.

10) DAPI stained nuclei, 1 drop per dish, completely covering the cells.

11) Washed twice with 1 ‰ Tween ice for 5 min each time on a shaker. One wash with ice PBS for 5 min on a shaker.

12) Adding the anti-fluorescence quenching sealing tablet and keeping out light.

13) And (4) operating the computer confocol.

As shown in FIG. 6, VEGF ScFv labeled with green fluorescent protein can bind to VEGF in the cytoplasm of panc-1 cells, so that the whole cells show green color, DAPI stains the cell nucleus blue, and the two colors coincide with each other, indicating that the green fluorescence shows cell morphology, and the VEGF ScFv can image the cells.

Example 4 immunohistochemical staining of three pancreatic cancer cells by VEGF ScFv

Three types of pancreatic cancer cells were used to make mouse orthotopic carcinomas. The tumor tissue was frozen and sectioned, and the tissue section was stained with a VEGF ScFv labeled with horseradish peroxidase, and the effect of the VEGF ScFv on the color development of the tumor tissue was observed.

VEGF ScFv was first labeled with horseradish peroxidase. The method comprises the following steps:

(1) 5mg of HRP was weighed out and dissolved in 1ml of distilled water.

(2) Adding 0.2ml of newly prepared 0.1M NaIO into the supernatant₄The solution was stirred at room temperature for 20 minutes in the absence of light.

(3) The above solution was filled into a dialysis bag, dialyzed against 1mM sodium acetate buffer pH4.4 at 4 ℃ overnight.

(4) Mu.l of 0.2M carbonate buffer pH9.5 is added to raise the pH of the above hydroformylation RP to 9.0-9.5, and 10mg of IgG (antibody, or SPA5mg) is immediately added to 1ml of 0.01M carbonate buffer, and the mixture is gently stirred at room temperature for 2 hours in the absence of light.

(5) Adding 0.1ml of newly prepared 4mg/ml NaBH 4 solution, uniformly mixing, and standing at 4 ℃ for 2 hours.

(6) The above solution was filled into dialysis bags and dialyzed against 0.15M PH7.4PBS at 4 ℃ overnight.

(7)10000 × g, centrifuging at 4 ℃ for 30 minutes;

(8) the supernatant was transferred to another tube and the volume 1:1, adding glycerol to make the final concentration reach 50%;

(9) storing at-20 deg.C.

Then, immunohistochemical staining is carried out by a direct method, the method is simple and rapid, and the VEGFScFv labeled by specificity is combined with the antigen in the tissue cells.

The operation process comprises the following steps:

(1) freezing the slices, fixing, and drying with PBS; paraffin sections were deparaffinized to water, digested for 30 min, and washed with PBS.

(2) The appropriate dilution of fluorescent antibody was added dropwise to the tissue sections, wet box at 37 ℃ temperature 1 h incubation, PBS 3 × 3 minutes.

(3) And (3) carrying out lining dyeing on 0.01% Evan blue for 1-3 minutes, washing with PBS for 3 × 3 minutes, washing with distilled water for 2 times, and removing NaCl crystals.

(4) Buffered glycerol mounting at pH 9.0.

(5) And (6) microscopic examination.

As shown in FIG. 7, three cells, Aspc1, Panc1 and Bxpc3, were used to establish a mouse tumor model, and a part of the tumor tissue was frozen and sectioned, and then antibody staining was performed, so that the tumor cells were stained brown with VEGF ScFv single-chain antibody. The coloring is uniform and the dyeing is specific. Therefore, the VEGF ScFv single-chain antibody can be used as an in vitro biopsy histochemical stain.

Example 5 use of VEGF ScFv as an in vivo fluorescence imaging agent

The VEGF ScFv is marked by near infrared fluorescence (IRDye800), and then the VEGF ScFv is injected into a liver cancer in-situ tumor model mouse through tail vein, and the distribution of the fluorescence-marked single-chain antibody in the tumor model mouse is observed.

The method for labeling the probe is the same as the FITC labeling method. As shown in fig. 8, a: the distribution of fluorescently labeled probes in the mouse was collected at different time points. The fluorescent color comprises three colors of blue, green and red, the red is a specific color, and the others are background colors. The mouse liver tumor tissue was seen to exhibit red fluorescence 10 minutes after tail vein injection, and the probe had concentrated at the tumor site. Liver red fluorescence began to decrease after 20 minutes, and after 1 hour it was essentially metabolized well with only scattered red spots considered lymph node color development. B: dissecting a tumor model mouse, taking out tissues of a plurality of parts, such as organs of intestines, lymph nodes, liver cancer tissues, trachea, lung, kidney and the like, comparing the residual fluorescence intensity of the organs, finding that only the liver cancer tissues have specific fluorescence coloring, and further proving that the fluorescence labeling probe has the specific coloring to the tumor tissues.

Sequence listing

<110> Beijing Gegen Biotechnology Ltd

Jiekang (Beijing) pharmaceutical science and technology Co., Ltd

<120> fully human anti-VEGF single-chain antibody and application thereof

<160>10

<170>PatentIn version 3.3

<210>1

<211>6

<212>PRT

<213>Homo sapiens

<400>1

Gln Ser Val Glu Thr Asn

1 5

<210>2

<211>3

<212>PRT

<213>Homo sapiens

<400>2

Gly Ala Ser

1

<210>3

<211>10

<212>PRT

<213>Homo sapiens

<400>3

Gln Gln Tyr Lys Asn Trp Pro Pro Val Thr

1 5 10

<210>4

<211>95

<212>PRT

<213>Homo sapiens

<400>4

Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Arg Ala

1 5 10 15

Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Glu Thr Asn Leu Ala Trp

20 25 30

Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Ala

35 40 45

Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser

50 55 60

Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser Glu Asp Ser

65 70 75 80

Ala Val Tyr Tyr Cys Gln Gln Tyr Lys Asn Trp Pro Pro Val Thr

85 90 95

<210>5

<211>8

<212>PRT

<213>Homo sapiens

<400>5

Gly Asp Ser Ile Thr Arg Tyr Tyr

1 5

<210>6

<211>7

<212>PRT

<213>Homo sapiens

<400>6

Ile Gly Tyr Ser Gly Thr Thr

1 5

<210>7

<211>9

<212>PRT

<213>Homo sapiens

<400>7

Ala Arg Arg Trp Ser Gly Ile Asp Tyr

1 5

<210>8

<211>104

<212>PRT

<213>Homo sapiens

<400>8

Gln Val Gln Leu Gln Gln Trp Gly Pro Gly Leu Val Lys Pro Ser Glu

1 5 10 15

Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Asp Ser Ile Thr Arg Tyr

20 25 30

Tyr Trp Ser Trp Ile Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu

35 40 45

Gly Tyr Ile Gly Tyr Ser Gly Thr Thr Ser Tyr Asn Pro Ser Leu Gln

50 55 60

Ser Arg Ala Thr Ile Ser Arg Asp Thr Ser Lys Asn Gln Phe Ser Leu

65 70 75 80

Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Gly Val Tyr Tyr Cys Ala

85 90 95

Arg Arg Trp Ser Gly Ile Asp Tyr

100

<210>9

<211>11

<212>PRT

<213>Homo sapiens

<400>9

Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10

<210>10

<211>732

<212>DNA

<213>Homo sapiens

<400>10

gagctccaga tgacccagtc tcctgccacc ctgtctgtgt ctcccgggga aagagccacc 60

ctctcctgca gggccagtca gagtgtggaa accaacttag cctggtacca gcagaaacct 120

ggccaggctc ccaggctcct catatatggt gcatccacca gggccactgg tatcccagcc 180

aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag cctgcagtct 240

gaagattctg cagtttatta ctgtcagcag tataagaact ggcctcccgt cacttttggc 300

cgggggacca agctggagat caaaggtggc ggtggcggtt ctggtggtgg tggatctcag 360

gtgcagctac agcagtgggg cccaggactg gtaaagcctt cggagaccct gtccctcacc 420

tgcactgtct ctggtgactc cataactcgt tactactgga gctggatccg gcagtcccca 480

ggaaagggac tggaatggct tggatatatc ggttacagtg ggaccaccag ttacaacccc 540

tccctccaga gtcgagccac catctcaaga gacacgtcca agaatcagtt ctccctgaag 600

ttgagctctg tgaccgccgc agacacaggc gtttattact gtgcgagacg gtggagtggc 660

attgactact ggggccaggg aaccctggtc accgtctcct cagcctccac acagagccca 720

tccgtcacta gt 732

Claims

1. A fully human anti-VEGF single-chain antibody, wherein the amino acid sequences of the light chain variable region and the heavy chain variable region of the single-chain antibody are respectively shown in SEQ ID NO.4 and 8.

2. The single chain antibody of claim 1, wherein the light chain variable region and the heavy chain variable region of said single chain antibody are linked by a linker polypeptide.

3. The single chain antibody of claim 2, wherein the amino acid sequence of said linker polypeptide is as set forth in SEQ id No. 9.

4. A biomacromolecule conjugate in which a green fluorescent protein, near infrared fluorescence or horseradish peroxidase is conjugated to a single-chain antibody according to any one of claims 1 to 3.

5. Use of the conjugate of claim 4 for the preparation of a tumor diagnostic formulation.

6. The use according to claim 5, wherein said green fluorescent protein is conjugated to said single chain antibody, and said conjugate is prepared as an immunofluorescent diagnostic reagent.

7. The use of claim 5, wherein said horseradish peroxidase is conjugated to said single-chain antibody, and said conjugate is prepared as an immunohistochemical diagnostic reagent.

8. The use of claim 5, wherein the near-infrared fluorescence is conjugated to the single-chain antibody, and the conjugate is prepared as an in vivo fluorescence imaging agent.