CN108129564A - A kind of anti-vegf single-chain antibody in full people source and its application - Google Patents

A kind of anti-vegf single-chain antibody in full people source and its application Download PDF

Info

Publication number
CN108129564A
CN108129564A CN201711359721.1A CN201711359721A CN108129564A CN 108129564 A CN108129564 A CN 108129564A CN 201711359721 A CN201711359721 A CN 201711359721A CN 108129564 A CN108129564 A CN 108129564A
Authority
CN
China
Prior art keywords
antibody
conjugate
vegf
chain antibody
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201711359721.1A
Other languages
Chinese (zh)
Other versions
CN108129564B (en
Inventor
谢珞琨
满来
李峥
许春萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yi Kang (beijing) Pharmaceutical Technology Co Ltd
Beijing Gegen Biological Technology Co Ltd
Original Assignee
Yi Kang (beijing) Pharmaceutical Technology Co Ltd
Beijing Gegen Biological Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yi Kang (beijing) Pharmaceutical Technology Co Ltd, Beijing Gegen Biological Technology Co Ltd filed Critical Yi Kang (beijing) Pharmaceutical Technology Co Ltd
Priority to CN201711359721.1A priority Critical patent/CN108129564B/en
Publication of CN108129564A publication Critical patent/CN108129564A/en
Application granted granted Critical
Publication of CN108129564B publication Critical patent/CN108129564B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0013—Luminescence
    • A61K49/0017—Fluorescence in vivo
    • A61K49/0019—Fluorescence in vivo characterised by the fluorescent group, e.g. oligomeric, polymeric or dendritic molecules
    • A61K49/0045—Fluorescence in vivo characterised by the fluorescent group, e.g. oligomeric, polymeric or dendritic molecules the fluorescent agent being a peptide or protein used for imaging or diagnosis in vivo
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/001—Preparation for luminescence or biological staining
    • A61K49/0013—Luminescence
    • A61K49/0017—Fluorescence in vivo
    • A61K49/005—Fluorescence in vivo characterised by the carrier molecule carrying the fluorescent agent
    • A61K49/0058—Antibodies
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G01N33/533—Production of labelled immunochemicals with fluorescent label
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G01N33/532—Production of labelled immunochemicals
    • G01N33/535—Production of labelled immunochemicals with enzyme label or co-enzymes, co-factors, enzyme inhibitors or enzyme substrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Radiology & Medical Imaging (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a kind of anti-vegf single-chain antibody in full people source, the single-chain antibody has unique CDR region, the recognition capability to antigen with high degree of specificity.The single-chain antibody has excellent tumor combination effect again, has specific binding to different types of pancreatic carcinoma.The invention also discloses be coupled application of the antibody of indicator in Vitro Tumor diagnostic reagent and vivo biodistribution preparation is prepared.When the preparation is applied on animal model for tumour, the single-chain antibody of near-infrared fluorescent, which is marked, can clearly show the size and location of mouse tumor, have high in-vivo imaging ability.

Description

A kind of anti-vegf single-chain antibody in full people source and its application
Technical field
The present invention relates to a kind of antibody, more specifically it relates to a kind of single-chain antibody.
Background technology
Tumour is to threaten the disease of human survival maximum.The Cancer in China morbidity in 2012 of World Health Organization's studies have shown that Number is 306.5 ten thousand, accounts for about 1/5th of whole world morbidity；Number of cancer deaths is 220.5 ten thousand, accounts for about global cancer mortality people Several a quarters.
The clinical diagnosis technology of tumour is also being gradually increased.From hands such as the detecting of initial tumor marker, ultrasound, perspectives Section, the detection of the protein level and molecular level of more tumor related genes, CT, nuclear-magnetism, PET, SPET till now, with And biopsy of tumor micro-wound etc. technology all clinically extensive uses.
The diagnosis of tumour is divided into vitro and in vivo diagnosis.In vitro, the immunohistochemical staining of tumor tissues is to make a definite diagnosis One important indicator of tumour.In-vivo diagnostic usually assists some instruments to carry out tumor imaging again using some developers.It is swollen Knurl in-vivo imaging can not only early diagnose tumour, and can monitor the effect of antineoplaston and the progress of tumour in real time Situation.Because it is noninvasive test, the pain brought to patient is small, has become clinical definite and treats the essential of tumour Diagnostic means.Imaging uses radionuclide image and nuclear-magnetism in the common tumour body of Hospitals at Present.
In recent years, optical imagery is widely used in tumor research neck with advantages such as its Non-Invasive, real-time, resolution ratio height Domain can early diagnose tumour, reflect tumour anatomical structure and metabolic condition.Near-infrared fluorescence imaging is current optics The hot spot of molecular imaging area research, spectral region 700-1000nm, in this wavelength band be monitored organism with The autofluorescence interference of tissue is smaller, penetrates tissue distance and may be up to several centimeters, improves the accuracy and sensitivity of imaging.
Usually all it is cell surface protein for making a definite diagnosis the target spot of tumour.And we have found that vascular endothelial growth factor (VEGF) target of a diagnosing tumor is can also be used as, VEGF is secreting type soluble protein, can be directly acted on intravascular Chrotoplast promotes vascular endothelial cell proliferation, increases vasopermeability.Research shows that benign tumour angiogenesis is rare, blood vessel It is slow-growing；And the angiogenesis of most of malignant tumours is intensive and growth is rapid.Therefore, angiogenesis turns in the development of tumour It plays an important role during moving, inhibits this process that will significantly prevent the development and diffusion transfer of tumor tissues.It is anti-angiogenic The antibody of endothelial growth factors can be used in tissue section strain and confocal dyeing, can similarly be used and be made in vivo For tumor imaging agent.
As tumor targets are on the increase, by the use of specific for cancer target antigen antibody as indicator research Gradually going deep into.But traditional whole immunoglobulin molecular weight is larger, can not be distributed to whole body quickly, can not tie well The a little shielded target position of unification, so antibody is had a greatly reduced quality as the feasibility of indicator.But technique for gene engineering creates The small antibody fragment of the molecular weight of only antigen binding function so that this imagination is achieved.But this small-molecular-weight Also there are problems in the application in antibody fragment, such as stability is poor, and specificity is not high, there are allogeneic immune reaction, And the coupling fitness of antibody and indicator it is not high the problems such as and limit further applying for this diagnostic means.
Invention content
It is a kind of anti-with specific recognition capability the purpose of the present invention is developing based on problem of the existing technology The single-chain antibody of vascular endothelial growth factor (VEGF), and then the bioconjugate of a kind of indicator and the antibody coupling is provided, And provide application of the conjugate in external diagnosis reagent and in-vivo imaging agent is prepared.
Based on foregoing invention purpose, present invention firstly provides a kind of single-chain antibody of anti-vascular endothelial growth factor, institutes The amino acid sequence in CDR1, CDR2 and CDR3 area of the light chain of antibody is stated respectively as shown in SEQ ID NO.1,2 and 3, it is described anti- The amino acid sequence in CDR1, CDR2 and CDR3 area of the heavy chain of body is respectively as shown in SEQ ID NO.5,6 and 7.
In a preferred technical solution, the light chain variable region of the antibody and the amino acid sequence of heavy chain variable region point Not as shown in SEQ ID NO.4 and 8.
In one more preferably technical solution, the light chain variable region and heavy chain variable region of the antibody are more by connecting Peptide is connected.
In a highly preferred technical solution, the amino acid sequence of the connecting peptides is as shown in SEQ ID NO.9.
Secondly, the present invention provides a kind of large biological molecule conjugate, the conjugate contains any of the above-described antibody.
In a preferred technical solution, in the conjugate, green fluorescent protein, near-infrared fluorescent albumen or Horseradish peroxidase and the antibody coupling.Finally, the present invention provides above-mentioned conjugate in diagnosing tumor preparation is prepared Application.
In a preferred technical solution, the green fluorescent protein and the antibody coupling, the conjugate are made Standby is immunofluorescence diagnostic reagent.
In another preferred technical solution, the horseradish peroxidase and the antibody coupling, the conjugate It is prepared as immunodiagnosis reagent.
In another preferred technical solution, the near-infrared fluorescent albumen and the antibody coupling, the conjugate It is prepared as internal fluorescence imaging agent.
The present invention screens the ScFv of high-affinity anti-vegf using phage antibody library method, then using green fluorescence egg In vain, horseradish peroxidase or the coupling of near-infrared fluorescent protein labeling, are examined respectively as the diagnosis of ion vitro immunization fluorescence, immunohistochemistry Disconnected antibody and internal fluorescent imaging agent.Anti-vegf single-chain antibody provided by the invention can be specifically bound in tumor tissues Vegf protein, with excellent affinity, affinity constant is 2.14 × 10-10M.And the affinity of most of autoantibodies Constant is less than 10-5--8M, thus the present invention anti-vegf single-chain antibody be used for diagnostic imaging in vivo when can compete autoantibody with VEGF is combined, by with tumour cell and tissue can be dyed and be imaged after suitable indicator coupling, it is shown that The anti-EGFR single-chain antibody of the present invention is preparing internal and external diagnostic reagent using upper good prospect.Since the present invention selects Be antibody small molecule segment, the molecular weight of the single-chain antibody is small, can be expressed in procaryotic cell expression system, therefore can Greatly reduce the production cost of antibody drug.Also, the anti-vegf single-chain antibody of the present invention is prepared using human immunoglobulin gene Screening obtains in the antibody library formed, and gene order is full people source, and immunogenicity is low, can be used as medicinal application to people Body, this is also can be as a favorable factor of internal developer.
Description of the drawings
Fig. 1 .VH and VL PCR product qualification figures；
Fig. 2 Vector maps and recombinant vector qualification figure；
Figure compared with the combination experiment column for VEGF ScFv and the VEGF-165 albumen that Fig. 3 are filtered out；Fig. 4 are after purification VEFG ScFv polyacrylamide gel electrophoresis qualification figures；
The combination trial curve figure of Fig. 5 .VEGFR blocking VEGF ScFv and VEGF-165 albumen；
The VEGF ScFv of Fig. 6 .FITC labels are to the immunofluorescence results figure of human pancreatic carcinoma cell；
The VEGF ScFv of Fig. 7 horseradish peroxidase-labeleds are to mouse pancreas cancer primary tumor Histochemical staining figure；
The VEGF ScFv of Fig. 8 near-infrared fluorescents label are to the in-vivo imaging figure of mouse pancreas cancer primary tumor.
Specific embodiment
The invention will now be further described with reference to specific embodiments, the advantages and features of the present invention will be with description and It is apparent.But these embodiments are only exemplary, do not form any restrictions to protection scope of the present invention.
The preparation of 1 anti-vegf single-chain antibody of embodiment
The foundation in 1.1 high storage capacity natural antibody libraries.
Detach the single karyolymph cell of human peripheral：100 normal adults are randomly selected, are extracted per human peripheral 10ml.With the RPMI-1640 culture solutions 1 containing 10% heparin:1 dilution is added to the centrifuge tube (dilution equipped with lymphocyte separation medium The volume ratio of venous blood and lymphocyte separation medium is 2:1) in, 2,000 × g is centrifuged 17 minutes.Draw lymphocyte separation medium Interface milky mononuclearcell layer, PBS buffer solution are washed twice.
The extraction of 1.2 cell total rnas
By every 5 × 106The ratio of cells/ml adds in Trizol reagents, and piping and druming cell is allowed to crack.5 points of incubation at room temperature Clock is moved into the EP pipes handled through DEPC, is added in the chloroform of 1/5 volume, acutely oscillation 15 seconds, is incubated at room temperature 3 minutes.4 DEG C, 10,000 × g is centrifuged 15 minutes, is drawn in upper strata aqueous phase to a new centrifuge tube, adds in the isopropanol of 1/2 volume, ice bath 10 Minute.4 DEG C, 12,000 × g is centrifuged 10 minutes, abandons supernatant, adds in 75% ethyl alcohol of 1ml cleaning precipitation.4 DEG C, 7,500 × g centrifugations 5 minutes, supernatant is abandoned, drying at room temperature precipitation is dissolved in the water of no RNase or is deposited in absolute ethyl alcohol, -80 DEG C save backup.
1.3 reverse transcriptions synthesize the first chains of cDNA
First total serum IgE is handled with the DNase I of no RNase to eliminate the genomic DNA of remaining.Take processed 2 μ of RNA sample G and Oligo (dT) 15 (500 μ g/ml) 1 μ l adds DEPC water to 12 μ l, 70 DEG C, heats 10 minutes.Ice is placed in after taking-up at once In bath, 5 × Buffer5 μ l are sequentially added；dNTP(10mmol/L)5μl；1 μ l, MMLV reverse transcriptase of RNase inhibitor, 1 μ l are mended DEPC water is added 42 DEG C, to keep the temperature 60 minutes to 25 μ l and carry out reverse transcription reaction, 70 DEG C, inactivate enzymatic activity within 15 minutes.
1.4 PCR amplification VH and VL genes
The first chains of cDNA are synthesized as template using reverse transcription, using VH the and VL bases expressed by people's ScFv antibody library primer amplifications Cause.Reaction system is as follows：
It is 50 μ l to add deionized water to final volume.
Primer 1:5’GAGCTCCAGATGACCCAGTCTCCT3’
Primer 2:5’ACTAGTGACGGATGGGCTCTGTGT3’
PCR parameters：94 DEG C denaturation 3 minutes after, then with 94 DEG C 30 seconds；61 DEG C 30 seconds；72 DEG C 1 minute, carry out PCR, totally 30 A cycle, last 72 DEG C extend 10 minutes.5 μ l reaction products is taken to carry out 1% agarose gel electrophoresis analysis after reaction.
PCR product recycles
(1) PCR product carries out 1.5% agarose gel electrophoresis, and target DNA fragment is cut from Ago-Gel, is put into In 1.5ml centrifuge tubes.
(2) 400 μ l sol solutions A are added in, 70 DEG C dissolve 5 minutes, until gel all dissolves.
(3) 200 μ l sol solutions B are added in, suck whole liquid in recovery column after being mixed.
(4) 12,000 × g are centrifuged 1 minute, abandon waste liquid.
(5) 500 μ l neutralizers are added in, 12,000 × g is centrifuged 1 minute, abandons waste liquid.
(6) 700 μ l cleaning solutions are added in, 12,000 × g is centrifuged 1 minute, abandons waste liquid.
Repeat step (6) 1 times.
(7) 12,000 × g are centrifuged 2 minutes, are abandoned waste liquid, recovery column are moved into new reception pipe, drying at room temperature 5 minutes.
(8) 30 μ l deionized waters are added in, 12,000 × g is centrifuged 1 minute, and eluted dna segment is saved backup in -20 DEG C.
1.5 bridging PCR methods carry out the splicing of VH and VL
Using VH the and VL segments of preparation as template, the series connection of VH and VL segments is carried out.
PCR reaction systems：
RSC-F:5’GCTGGAGATCAAAGGTGGCGGT3’
RSC-B:5’TGTAGCTGCACCTGAGATCCACC3’
PCR reaction conditions are 94 DEG C of pre-degenerations 5 minutes, then carry out 30 cycles by following parameter：94 DEG C are denaturalized 30 seconds, 60 DEG C are annealed 45 seconds, and 72 DEG C extend 1.5 minutes, and last 72 DEG C extend 10 minutes.Glue recycling step is repeated, PCR product is dissolved in 30 μ l ddH2In O.Fig. 1 is VH and VL PCR product qualification figures, and wherein right lanes are VH+VL concatermers.
1.6 are connected on phage vector,
Sfi1 digestions carrier and PCR product
37 DEG C of digestions 2 hours recycle endonuclease bamhi with identical method.
Coupled reaction
The abundant mixing of above-mentioned reactant and after centrifuging it being made to be sunken to tube bottom, 4 DEG C of connections are overnight.Segment after digestion with PComb3XSS carrier segments connect, and are built into recombinant plasmid.Fig. 2 is recombinant vector electroresis appraisal figure.Wherein, right lanes are Recombinant fragments pComb3XSS carrier restriction enzyme mappings, left side swimming lane are molecular weight marker.
1.7 conversions and expression
By the carrier built (plasmid) conversion (electricity turns) to (specific Escherichia coli) in Escherichia coli, large intestine bar is expanded Bacterium simultaneously adds helper phage, and the bacteriophage collected after recombination is exactly phage antibody library.
The storage capacity of hundred naive ScFv antibody libraries is 2*10 after testing10, fully meet the needs of antibody screening.
The screening of 1.8VEGF antibody
10ul is taken out from antibody library to expand in Escherichia coli, collects the antibody library after amplification, VEGF A subtype proteins Antibody library is added in after coating elisa plate, non-specific bacteriophage is rinsed after incubation, specific bond bacteriophage is digested, will disappear after enrichment The phage-infect Escherichia coli coated plate of change, picking monoclonal cenobium simultaneously induce in a small amount, the monoclonal bacterium supernatant after a small amount of inductions ELISA screening positive clones are done, by multiple authentication, choosing affinity and specificity, all high (affinity reaches 10-8-10-9KD) Positive colony carry out antibody expression.Fig. 3 is the combination experiment of VEGF ScFv and the VEGF-165 albumen filtered out.Wherein No. 5 The OD value highests of clone show the specific affinity of its height having, and choose the clone and carry out further sequence point Analysis.
By sequence analysis, the amino acid sequence in CDR1, CDR2 and CDR3 area of the light chain of ScFv clones is respectively such as SEQ Shown in ID NO.1,2 and 3, the amino acid sequence in CDR1, CDR2 and CDR3 area of the heavy chain of the antibody is respectively such as SEQ ID Shown in NO.5,6 and 7.
The light chain variable region of the antibody and the amino acid sequence of heavy chain variable region are respectively as shown in SEQ ID NO.4 and 8.
Single-chain antibody provided by the invention derives from the phage antibody library in people source, therefore its sequence is full people source, this Low immunogenicity basis has been established for use of the antibody as medicine or in-vivo imaging diagnostic reagent in human body.It is right The antibody is further changed structure, connecting peptides of the addition as shown in SEQ ID NO.9 between light chain and heavy chain.It should by coding The nucleotide sequence (SEQ ID NO.10) of single-chain antibody is cloned into pGEM-T Easy, and is transformed into bacillus coli DH 5 alpha preservation. When preparing the single-chain antibody, the nucleotide sequence for encoding the single-chain antibody is cloned into expression vector pET30, then is transformed into corresponding Express bacterium BL21(DE3) in, screening optimum condition of the expression carries out a large amount of induced expressions, finally selects best purification process and delays Fliud flushing obtains antibody protein.Fig. 4 is VEFG ScFv polyacrylamide gel electrophoresis qualification figures after purification.
Bacillus coli DH 5 alpha is preserved for this room, and genotype is：supE44ΔlacU169 HsdR17recA1end1gyr96thi-1relA1, for the amplification and conversion of plasmid.
Escherichia coli BL21(DE3), genotype is hsdS gal (λ cIts857ind1Sam7nin5lacUV5-T7), is used for The expression of recombinant protein.
pGEM-T Easy：For the clone of PCR product, purchased from Promega companies.
Prokaryotic expression plasmid vector pET30, pET42, pGEX-4t-1 are that this room preserves.
The purifying of VEGF single-chain antibodies
By containing there are six the fusion protein VEGF ScFv-GH-His6 of histidine mark with 0.45 μm of membrane filtration, prepare Cross column.
After HisTrap kit affinity columns are balanced with Binding Buffer 10ml, the sample to be purified being already prepared to is added in Product.It is about 8-10 drops/minute to adjust flow velocity.
Column is washed using Binding Buffer.
Pillar is eluted using 6ml Elution Buffer.It is in charge of collection eluent.A small amount of progress SDS-PAGE identifications are taken, As a result as shown in Figure 4, purpose band is in 25KD or so, each Guan Yu -70 DEG C of preservations rich in destination protein.
Embodiment 2.VEGFR is to VEGF single-chain antibodies and the protein bound blocking tests of VEGF-165
- 165 albumen of blocking VEGF and its receptor VEGFR2 are capable of by competitive ELISA verification experimental verification VEGF single-chain antibodies With reference to.The VEGFR of different dilutions is mixed with VEGF single-chain antibodies, addition has been coated in the hole of VEGF-165 albumen, is incubated 1 Hour.Carry out routine ELISA operations.As a result as shown in Figure 5.As seen from Figure 5, as VEGFR2 concentration constantly increases, OD values are got over It is small, it is meant that the blocking effect that VEGFR2 combines VEGF single-chain antibodies and VEGF-165 is stronger.I.e. the VEGF single-chain antibodies can To block the combination of VEGF-165 and its receptor VEGFR2 in body.It is computed its IC50It is worth for 0.002mg/ml.
The immunofluorescent staining (confocal) of the VEGF ScFv of 3. green fluorescent protein of embodiment (FITC) label
Utilize combinations of the pancreatic carcinoma panc-1 verifications VEGF ScFv to tumour cell.
FITC first marks VEGF ScFv, and step is as follows：
(1) it will treat that crosslinked antibody (concentration >=1mg/ml) dialyses three times (4 DEG C), until pH=9.0 to cross-linking reaction liquid.It hands over Connection reaction liquid making method：7.56g NaHCO3, 1.06g Na2CO3, 7.36g NaCl add water to be settled to 1L.
(2) FITC is dissolved in DMSO, a concentration of 1mg/ml.Be crosslinked every time the FITC that uses should all Fresh, be protected from light.
(3) by P:F (antibody：FITC)=1mg:FITC is slowly added in antibody-solutions by the ratio of 150 μ g, side edged Gently shaking makes it be uniformly mixed with antibody, and 4 DEG C of dark place is reacted 8 hours.
(4) NH of 5mol/L is added in4Cl to final concentration 50mmol/L, 4 DEG C terminate reaction 2 hours.
(5) cross-linking agent is dialysed four times or more in PBS, until dialyzate is limpid.
(6) identification of cross-linking agent.
Protein concentration (mg/ml)=[A280-0.31 × A495]/1.4, F/P ratios:3.1×A495/[A280 0.31× A495], which should be between 2.5~6.5.The crosslinked antibody of FITC should be placed in the phosphate buffer of pH7.4, added in 0.1%NaN3,1%BSA, 4 DEG C of dark places preserve.
Then cell dyeing is carried out, step is as follows：
1) in the burnt special culture dish of copolymerization, ice PBS is washed three times, every time 5 minutes cell kind.
2) it when cell is half-dried, covers and fixes 15 minutes with 4% cold paraformaldehyde, be protected from light.
3) it after sucking paraformaldehyde, is washed three times, every time 5 minutes with ice PBS.
4) 0.5%Triton X-100 cover cell 10 minutes, and ice PBS is washed three times, every time 5 minutes.
5) import fetal calf serum room temperature is closed 30 minutes.
6) an anti-vegf ScFv is prepared:FBS=1:200.
7) primary antibody covering cell is added in, tinfoil wraps up 4 degree and is protected from light overnight.
8) next day takes out cell and warms to room temperature again about 1 hour.
9) 1 ‰ Tween of ice is washed twice, and 5 minutes in shaking table every time.Ice PBS is washed once, and 5 minutes in shaking table.
10) DAPI contaminates core, is dripped per ware 1, covers all cell.
11) 1 ‰ Tween of ice is washed twice, and 5 minutes in shaking table every time.Ice PBS is washed once, and 5 minutes in shaking table.
12) anti-fluorescent quenching mountant is added in, is protected from light.
13) machine confocol on.
As shown in fig. 6, the VEGF ScFv of label green fluorescent protein can combine the VEGF in panc-1 cell cytosols, So that entire cell shows green, nuclei dyeing au bleu, two kinds of color additions mutually coincide by DAPI, illustrate that the green fluorescence is shown What is shown is cellular morphology, which can be imaged cell.
Embodiment 4.VEGF ScFv are to the immunohistochemical staining of three kinds of pancreatic cancer cells
Mouse carcinoma in situ is made using three kinds of pancreatic cancer cells.Tumor tissues is taken to carry out frozen section, use horseradish peroxide The VEGF ScFv of compound enzyme label carry out tissue section strain, and observation VEGF ScFv are to the color developing effect of tumor tissues.
VEGF ScFv are subjected to horseradish peroxidase-labeled first.Step is as follows：
(1) 5mg HRP are weighed to be dissolved in 1ml distilled water.
(2) the 0.1M NaIO that 0.2ml newly matches are added in upper liquid4Solution is protected from light stirring 20 minutes at room temperature.
(3) above-mentioned solution is fitted into bag filter, dialysed to the sodium-acetate buffer of 1mM PH4.4,4 DEG C overnight.
(4) add 20 μ l 0.2M PH9.5 carbonate buffer solutions, the PH of more than Quanization Bedside-stand RP is made to be increased to 9.0~9.5, so 10mg IgG (antibody or SPA5mg) are added in immediately afterwards in 1ml 0.01M carbonate buffer solutions, room temperature, which is protected from light, is gently mixed 2 Hour.
(5) 4 liquid of 4mg/ml NaBH that 0.1ml is added newly to match, mixing, then put 4 DEG C 2 hours.
(6) above-mentioned liquid is fitted into bag filter, dialysed to 0.15M PH7.4PBS, 4 DEG C overnight.
(7) 4 DEG C of 10000 × g are centrifuged 30 minutes；
(8) supernatant is moved into another pipe, by volume 1：1 adds in glycerine, makes final concentration up to 50%；
(9) -20 DEG C of preservations are put.
Then direct method carries out immunohistochemical staining, easy, quick, with the VEGFScFv and histocyte of specific marker Endoantigen combines.
Operating process：
(1) frozen section is washed through fixation, airing PBS；Paraffin section de-waxing digests 30 minutes, PBS is washed to water.
(2) suitably dilution fluorescence antibody is added dropwise on tissue sections, is incubated 1 hour for 37 DEG C in wet box, PBS washes 3 × 3 points Clock.
(3) 0.01% Azo-Blues lining dye 1~3 minute, PBS is washed 3 × 3 minutes, and distillation washing 2 times removes NaCl crystallizations.
(4) pH9.0 buffers glycerine mounting.
(5) microscopy.
As shown in fig. 7, respectively using Aspc1, these three cells of Panc1, Bxpc3 establish mouse tumor model, take part Tumor tissues carry out frozen tissue section, then carry out antibody dyeing, it is seen that tumour cell is contaminated by VEGF ScFv single-chain antibodies Into brown.Uniform coloring, in specific stain.Therefore the VEGF ScFv single-chain antibodies can be used as external biopsy chemistry Coloring agent application.
Applications of the embodiment 5.VEGF ScFv as internal fluorescence imaging agent
VEGF ScFv are marked with near-infrared fluorescent (IRDye800), then tail vein injection liver cancer situ tumor model is small Mouse observes distribution of the fluorescent marker single-chain antibody in tumor model mouse body.
Label probe method is the same as FITC labeling methods.As shown in figure 8, A：Different time points are acquired, fluorescence labeling probe exists Distribution in Mice Body.Fluorescence color has three kinds of blue, green and red, and red is specificity coloring, and other is bias light Color.See that red fluorescence is just presented in mouse liver tumor tissues to tail vein injection after ten minutes, probe has been collected at tumour portion Position.Liver red fluorescence starts to reduce after twenty minutes, and analytic metabolism is clean after 1 hour, is only dispersed in punctation, and consideration is leaching Fawn on colour developing.B：Tumor model mouse is dissected, multiple site tissues are taken out, such as intestines, lymph node, liver cancer tissue, tracheae, lung, kidney Organs are waited, compare their remaining fluorescence intensities, find only have liver cancer tissue to also have specificity fluorescent coloring, further proving should Fluorescence labeling probe colours the specificity of tumor tissues.
Sequence table
<110>Beijing Ge Gen bio tech ltd
Also health（Beijing）Pharmaceutical Technology Co., Ltd
<120>A kind of full people source anti-vegf single-chain antibody and its application
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 6
<212> PRT
<213> Homo sapiens
<400> 1
Gln Ser Val Glu Thr Asn
1 5
<210> 2
<211> 3
<212> PRT
<213> Homo sapiens
<400> 2
Gly Ala Ser
1
<210> 3
<211> 10
<212> PRT
<213> Homo sapiens
<400> 3
Gln Gln Tyr Lys Asn Trp Pro Pro Val Thr
1 5 10
<210> 4
<211> 95
<212> PRT
<213> Homo sapiens
<400> 4
Met Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Arg Ala
1 5 10 15
Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Glu Thr Asn Leu Ala Trp
20 25 30
Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Gly Ala
35 40 45
Ser Thr Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Ser
50 55 60
Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Ser Glu Asp Ser
65 70 75 80
Ala Val Tyr Tyr Cys Gln Gln Tyr Lys Asn Trp Pro Pro Val Thr
85 90 95
<210> 5
<211> 8
<212> PRT
<213> Homo sapiens
<400> 5
Gly Asp Ser Ile Thr Arg Tyr Tyr
1 5
<210> 6
<211> 7
<212> PRT
<213> Homo sapiens
<400> 6
Ile Gly Tyr Ser Gly Thr Thr
1 5
<210> 7
<211> 9
<212> PRT
<213> Homo sapiens
<400> 7
Ala Arg Arg Trp Ser Gly Ile Asp Tyr
1 5
<210> 8
<211> 104
<212> PRT
<213> Homo sapiens
<400> 8
Gln Val Gln Leu Gln Gln Trp Gly Pro Gly Leu Val Lys Pro Ser Glu
1 5 10 15
Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Asp Ser Ile Thr Arg Tyr
20 25 30
Tyr Trp Ser Trp Ile Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu
35 40 45
Gly Tyr Ile Gly Tyr Ser Gly Thr Thr Ser Tyr Asn Pro Ser Leu Gln
50 55 60
Ser Arg Ala Thr Ile Ser Arg Asp Thr Ser Lys Asn Gln Phe Ser Leu
65 70 75 80
Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Gly Val Tyr Tyr Cys Ala
85 90 95
Arg Arg Trp Ser Gly Ile Asp Tyr
100
<210> 9
<211> 11
<212> PRT
<213> Homo sapiens
<400> 9
Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10
<210> 10
<211> 732
<212> DNA
<213> Homo sapiens
<400> 10
gagctccaga tgacccagtc tcctgccacc ctgtctgtgt ctcccgggga aagagccacc 60
ctctcctgca gggccagtca gagtgtggaa accaacttag cctggtacca gcagaaacct 120
ggccaggctc ccaggctcct catatatggt gcatccacca gggccactgg tatcccagcc 180
aggttcagtg gcagtgggtc tgggacagag ttcactctca ccatcagcag cctgcagtct 240
gaagattctg cagtttatta ctgtcagcag tataagaact ggcctcccgt cacttttggc 300
cgggggacca agctggagat caaaggtggc ggtggcggtt ctggtggtgg tggatctcag 360
gtgcagctac agcagtgggg cccaggactg gtaaagcctt cggagaccct gtccctcacc 420
tgcactgtct ctggtgactc cataactcgt tactactgga gctggatccg gcagtcccca 480
ggaaagggac tggaatggct tggatatatc ggttacagtg ggaccaccag ttacaacccc 540
tccctccaga gtcgagccac catctcaaga gacacgtcca agaatcagtt ctccctgaag 600
ttgagctctg tgaccgccgc agacacaggc gtttattact gtgcgagacg gtggagtggc 660
attgactact ggggccaggg aaccctggtc accgtctcct cagcctccac acagagccca 720
tccgtcacta gt 732

Claims (10)

1. a kind of anti-vegf single-chain antibody in full people source, which is characterized in that CDR1, CDR2 and CDR3 area of the antibody light chain Amino acid sequence is respectively as shown in SEQ ID NO.1,2 and 3, the amino acid in CDR1, CDR2 and CDR3 area of the heavy chain of antibody Sequence is respectively as shown in SEQ ID NO.5,6 and 7.
2. antibody according to claim 1, which is characterized in that the light chain variable region of the antibody and the ammonia of heavy chain variable region Base acid sequence is respectively as shown in SEQ ID NO.4 and 8.
3. antibody according to claim 2, which is characterized in that the light chain variable region and heavy chain variable region of the antibody pass through Connecting peptides are connected.
4. antibody according to claim 3, which is characterized in that the amino acid sequence of the connecting peptides such as SEQ ID Shown in NO.9.
5. a kind of large biological molecule conjugate, which is characterized in that the conjugate contains any antibody of claim 1-4.
6. conjugate according to claim 5, which is characterized in that in the conjugate, green fluorescent protein, near-infrared Fluorescence or horseradish peroxidase and the antibody coupling.
7. application of the conjugate in diagnosing tumor preparation is prepared described in claim 6.
8. application according to claim 7, which is characterized in that the green fluorescent protein and the antibody coupling, it is described Conjugate is prepared as immunofluorescence diagnostic reagent.
9. application according to claim 7, which is characterized in that the horseradish peroxidase and the antibody coupling, institute It states conjugate and is prepared as immunodiagnosis reagent.
10. application according to claim 7, which is characterized in that the near-infrared fluorescent and the antibody coupling, the idol Connection object is prepared as internal fluorescence imaging agent.
CN201711359721.1A 2017-12-17 2017-12-17 Fully human anti-VEGF single-chain antibody and application thereof Active CN108129564B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711359721.1A CN108129564B (en) 2017-12-17 2017-12-17 Fully human anti-VEGF single-chain antibody and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711359721.1A CN108129564B (en) 2017-12-17 2017-12-17 Fully human anti-VEGF single-chain antibody and application thereof

Publications (2)

Publication Number Publication Date
CN108129564A true CN108129564A (en) 2018-06-08
CN108129564B CN108129564B (en) 2020-07-28

Family

ID=62390424

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711359721.1A Active CN108129564B (en) 2017-12-17 2017-12-17 Fully human anti-VEGF single-chain antibody and application thereof

Country Status (1)

Country Link
CN (1) CN108129564B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115724968A (en) * 2021-08-27 2023-03-03 三优生物医药(上海)有限公司 VEGF binding molecules and uses thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011103702A1 (en) * 2010-02-25 2011-09-01 百迈博药业有限公司 Fully human monoclonal antibody to vegf, preparation method and use thereof
CN102875676A (en) * 2011-07-13 2013-01-16 无锡天演生物技术有限公司 Human anti-human VEGF monoclonal antibody molecule and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011103702A1 (en) * 2010-02-25 2011-09-01 百迈博药业有限公司 Fully human monoclonal antibody to vegf, preparation method and use thereof
CN102875676A (en) * 2011-07-13 2013-01-16 无锡天演生物技术有限公司 Human anti-human VEGF monoclonal antibody molecule and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
K.A.SMITH等: "Isolation and characterisation of vascular endothelial growth factor-165 specific scFv fragments by phage display", 《INTERNATIONAL JOURNAL OF ONCOLOGY》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115724968A (en) * 2021-08-27 2023-03-03 三优生物医药(上海)有限公司 VEGF binding molecules and uses thereof
CN115724968B (en) * 2021-08-27 2023-08-08 三优生物医药(上海)有限公司 VEGF binding molecules and uses thereof

Also Published As

Publication number Publication date
CN108129564B (en) 2020-07-28

Similar Documents

Publication Publication Date Title
EP3473649A1 (en) Anti-cd47 monoclonal antibody and application thereof
US9164097B2 (en) Formulations targeting IGFBP7 for diagnosis and therapy of cancer
AU2012292120B2 (en) Novel anti-CXCR4 antibody and its use for the detection and diagnosis of cancer
PL199353B1 (en) Specific binding molecules for scintigraphy, conjugates containing them and therapeutic method for treatment of angiogenesis
US20110200525A1 (en) Vhh antibody fragments for use in the detection and treatment of cancer
CN106164672B (en) Diagnostic cell-surface prostate cancer antigen
MXPA96006218A (en) Tirosine kinase receptor of flt4 and its endiagnostic and tera use
JP7105304B2 (en) Use of anti-HER2 antibody-drug conjugates in the treatment of urothelial carcinoma
CN103119063A (en) Recombinant antibody structures binding to and blocking the activity of vascular endothelial growth factor 2 (VEGFR- 2 /KDR)
CN103717620A (en) Use of the antibody I-3859 for the detection and diagnosis of cancer
CN108059681B (en) Bispecific antibody fusion protein resisting VEGF and EGFR and application thereof
CN114478778A (en) anti-Tim-3 nano antibody and application thereof
CN108003239B (en) Fully human anti-EGFR single-chain antibody and application thereof
CN107987168B (en) Single-chain double-specific antibody for resisting VEGF and EGFR and application thereof
CN108129564A (en) A kind of anti-vegf single-chain antibody in full people source and its application
AU2020366846A1 (en) Humanized antibody and method for using the same
CN114685664B (en) Single-domain antibody for resisting human B lymphocyte surface antigen CD20 and application thereof
CN106749659B (en) Anti-human CRP antibody and application thereof
KR20020079888A (en) Novel antibody with specificity for colon cancer
CN103130896B (en) Monoclonal antibody for resisting cell surface ectopic expression, and preparation method and application thereof
KR20210122813A (en) Antibodies and functional fragments thereof
CN112724253B (en) Antibody of anti-human vault protein and application thereof
CN112079928B (en) anti-PD-L1 monoclonal antibody
JP2012115243A (en) Anti-mt1-mmp single-stranded antibody and radioactive molecule imaging probe using the same
WO2017147247A1 (en) Anti-sas1b antibodies and methods of use

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant