CN102993283B - Antigen protein for mycobacterium tuberculosis and application - Google Patents

Antigen protein for mycobacterium tuberculosis and application Download PDF

Info

Publication number
CN102993283B
CN102993283B CN201210521551.3A CN201210521551A CN102993283B CN 102993283 B CN102993283 B CN 102993283B CN 201210521551 A CN201210521551 A CN 201210521551A CN 102993283 B CN102993283 B CN 102993283B
Authority
CN
China
Prior art keywords
mycobacterium tuberculosis
antigen
add
tuberculosis
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201210521551.3A
Other languages
Chinese (zh)
Other versions
CN102993283A (en
Inventor
何正国
李雨庆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN201210521551.3A priority Critical patent/CN102993283B/en
Publication of CN102993283A publication Critical patent/CN102993283A/en
Application granted granted Critical
Publication of CN102993283B publication Critical patent/CN102993283B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Abstract

The invention belongs to the technical field of genetic engineering, relates to the technical field of molecular diagnosis of communicable diseases, and in particular relates to a preparation of an antigen protein for mycobacterium tuberculosis, and application of the antigen protein in reparation of a kit for diagnosing and detecting tuberculosis. The amino acid sequence of the antigen protein for mycobacterium tuberculosis is shown in SEQ ID NO: 3 in a sequence table, and the protein sequence is shown in SEQ ID NO: 4 in the sequence table. As the biological tests shown, the prepared antigen protein for mycobacterium tuberculosis, provided by the invention, can be applied to the preparation of the kit for diagnosing and detecting the tuberculosis.

Description

A kind of antigen protein of mycobacterium tuberculosis and application
Technical field
The present invention is that application number is 201010231572.2 divisional application.
The invention belongs to gene engineering technology field, also relate to transmissible disease molecular diagnostic techniques field, be specifically related to 3 kinds of antigen of mycobacterium tuberculosis albumen and in the application of preparing in diagnosis of tuberculosis detection kit.
Background technology
Animal bacteria sexually transmitted disease is day by day serious to the threat of human health, impacts and affect to national economy and social stability.Mycobacterium tuberculosis (Mycobacterium tuberculosis, Main Pathogenic Bacteria lungy) be a kind of pathogenic bacteria of serious harm human health, the whole world has 1/3rd populations to carry the mycobacterium tuberculosis in latent state, annual nearly two million peoples die from tuberculosis (Raviglione M C.TheTB epidemic from 1992 to 2002.Tuberculosis (Edinb), 2003,83:4-14.).In recent years, mycobacterium tuberculosis merges the appearance of human immunodeficiency virus (HIV) infection and multiple-drug resistance tuberculosis bacterial strain, severeer to the threat of mankind's public health service.Therefore, simple, quick, the responsive diagnostic techniques of exploitation tuberculosis and resistant tuberculosis, becomes current control Critical policies lungy and means.
Up to the present, Case definition lungy is mainly directly to observe under the microscope the phlegm smear method of mycobacterium tuberculosis clinically.But the sensitivity of sputum specimen bacteriology checking is very low, mainly also carry out comprehensive diagnos tuberculosis according to clinical symptom and imaging data clinically.And another Case definition tubercule bacillus is cultivated " gold standard " as diagnosis of tuberculosis, need to expend a large amount of time, also need to have high-caliber technician's operation simultaneously, limit its application in clinical diagnosis of tuberculosis.
Researchist utilizes various emerging molecular biology and modern Immunology and technology, developed some detection methods likely, such as the full-automatic cultivation of Quick mycobacteria and detection, phage biological TRAP and phage biloluminescence method, utilize DNA or RNA amplification technique, utilize Novel free epidemiology method etc.But these technology all need operator expensive and hi-tech level, limited they the popularization of low income country and application, and these national tuberculosis infection rates are often all higher.
Given this, the present patent application people, according to three antigen protein encoding genes that early stage, screening obtained from mycobacterium tuberculosis genome sequence, by its clonal expression purifying in intestinal bacteria, and is further applied to external molecular diagnosis lungy.The present invention set up a kind of fast, the diagnosis of tuberculosis method based on elisa technique of low cost, easy handling, the method and the comparatively widely used two kinds of similar test kit TB-DOT(Shanghai Upper Bio-tech Pharma Co., Ltd. of application in Chinese market) and the French VEDA of TB-check-1(LAB S. A.) compare, susceptibility and specificity are all significantly improved.
Summary of the invention
The object of the invention is to overcome the defect of prior art, by Protocols in Molecular Biology and method, prepare three kinds and be applicable to diagnostic detection novel antigen of mycobacterium tuberculosis albumen lungy, three kinds of described novel antigens albumen are applied to ELISA diagnostic detection lungy.
The present invention is achieved in that
Applicant early stage, screening obtained three gene fragments from mycobacterium tuberculosis genome sequence, and they are can be strong reacts with serum tuberculosis patient.Their nucleotide sequence is respectively as sequence table SEQ ID NO:1, and shown in 3,5, the aminoacid sequence of their codings is respectively as sequence table SEQ ID NO:2, shown in 4,6.Wherein from Rv1987 gene (NCBI accession number NP_216503.1, GeneID:885815, gene annotation is possible chitinase) the middle nucleotide sequence obtaining as shown in sequence table SEQ ID NO:1 that screens, sequence length is 0.429kb, from Rv3807c gene (NCBI accession number NP_218324.1, GeneID:886134, gene annotation is possible conservative transmembrane protein) the middle nucleotide sequence obtaining as shown in sequence table SEQ ID NO:2 that screens, sequence length is 0.498kb, from Rv3887c gene (NCBI accession number NP_218404.1, GeneID:886211, gene annotation is possible conservative transmembrane protein) the middle nucleotide sequence obtaining as shown in sequence table SEQ ID NO:1 that screens, sequence length is 1.53kb.Applicant, by gene clone method, obtains the recombination bacillus coli that contains these three antigen proteins.Then, at these three antigen of mycobacterium tuberculosis albumen of expression in escherichia coli purifying.Finally, utilize the antigen protein obtaining to carry out detection lungy, and compare with the detected result of commercially available reagent box for tuberculate diagnosis.
Biological test shows, the antigen protein of above-mentioned three genes encodings of the present invention clone can be used as specific antigen protein and is applied to detection lungy.
In an embodiment of the present invention, applicant provides the detailed preparation method of three kinds of antigen of mycobacterium tuberculosis albumen, and has described the application prospect of these three antigen proteins in diagnosis of tuberculosis.
Advantage of the present invention is that running cost is low, and can detect quick, convenient, accurately tuberculosis.
The more detailed technical scheme of the present invention is referring to " embodiment ".
Brief description of the drawings
Sequence table SEQ ID NO:1 is the nucleotide sequence of the present invention's Rv1987 gene fragment of cloning.
Sequence table SEQ ID NO:2 is the aminoacid sequence of the protein of the present invention's Rv1987 gene fragment coding of cloning.
Sequence table SEQ ID NO:3 is the nucleotide sequence of the present invention's Rv3807c gene fragment of cloning.
Sequence table SEQ ID NO:4 is the aminoacid sequence of the protein of the present invention's Rv3807c gene fragment coding of cloning.
Sequence table SEQ ID NO:5 is the nucleotide sequence of the present invention's Rv3887c gene fragment of cloning.
Sequence table SEQ ID NO:6 is the aminoacid sequence of the protein of the present invention's Rv3887c gene fragment coding of cloning.
Fig. 1: techniqueflow chart of the present invention.
Fig. 2: (what be shown as underscore in bracket is the described antigen sequence numbering in ncbi database to the antigen gene sequences that the present invention uses in residing position in Mycobacterium tuberculosis H37Rv strain gene group, thereafter the numeral after colon is the position of sequence shown in this numbering in Mycobacterium tuberculosis H37Rv strain gene group, and the overstriking italics showing behind this position is the bacterial strain number of described mycobacterium tuberculosis).
Fig. 3: be the pET-28a(+ that the present invention uses) carrier collection of illustrative plates.
Fig. 4: the pcr amplification result that is antigen of mycobacterium tuberculosis protein coding gene of the present invention.From left to right sample successively: Marker, Rv1987, Rv3807c, Rv3887c.
Fig. 5: the double digestion the result that is antigen of mycobacterium tuberculosis protein coding gene of the present invention.From left to right sample successively: Marker, Rv1987, Rv3807c, Rv3887c.
Fig. 6: the purification result that is antigen of mycobacterium tuberculosis albumen of the present invention.From left to right sample successively: Marker, Rv1987, Rv3807c, Rv3887c, Mutiple-antigen(are hybrid antigen albumen: the ratio that is 1:1:1 in concentration ratio by Rv1987, Rv3807c and Rv3887c is mixed).
Fig. 7: the western-blot result that is antigen of mycobacterium tuberculosis albumen of the present invention.From left to right sample successively: Rv1987, Rv3807c, Rv3887c.
Fig. 8: the comparative result of antigen of mycobacterium tuberculosis albumen of the present invention and the susceptibility of two kinds of test kits that are purchased (TB-DOT and TB-check-1) in diagnosis of tuberculosis.From left to right sample successively: Mutiple-antigen, Rv3807c, Rv3887c, Rv1987, TB-DOT, TB-check-1.
Fig. 9: antigen of mycobacterium tuberculosis albumen of the present invention and the specific comparative result of two kinds of test kits that are purchased (TB-DOT and TB-check-1) in diagnosis of tuberculosis.From left to right sample successively: Mutiple-antigen, Rv3807c, Rv1987, Rv3887c, TB-check-1, TB-DOT.
Figure 10: the comparative result of antigen of mycobacterium tuberculosis albumen of the present invention and the accuracy of two kinds of test kits that are purchased (TB-DOT and TB-check-1) in diagnosis of tuberculosis.From left to right sample successively: Mutiple-antigen, Rv3807c, Rv3887c, Rv1987, TB-DOT, TB-check-1.
Embodiment
Embodiment 1: the pcr amplification of antigen of mycobacterium tuberculosis protein coding gene
Applicant early stage, screening obtained three gene fragments from mycobacterium tuberculosis genome sequence, and they are can be strong reacts with serum tuberculosis patient.Their nucleotide sequence is respectively as sequence table SEQ ID NO:1, and shown in 3,5, the aminoacid sequence of their codings is respectively as sequence table SEQ ID NO:2, shown in 4,6.Wherein from Rv1987 gene (NCBI accession number NP_216503.1, GeneID:885815, gene annotation is possible chitinase) the middle nucleotide sequence obtaining as shown in sequence table SEQ ID NO:1 that screens, sequence length is 0.429kb, from Rv3807c gene (NCBI accession number NP_218324.1, GeneID:886134, gene annotation is possible conservative transmembrane protein) the middle nucleotide sequence obtaining as shown in sequence table SEQ ID NO:2 that screens, sequence length is 0.498kb, from Rv3887c gene (NCBI accession number NP_218404.1, GeneID:886211, gene annotation is possible conservative transmembrane protein) the middle nucleotide sequence obtaining as shown in sequence table SEQ ID NO:1 that screens, sequence length is 1.53kb.
1, the primer design method of antigen of mycobacterium tuberculosis protein coding gene: (public of Mycobacterium tuberculosis H37Rv bacterial strain obtains source to the Mycobacterium tuberculosis H37Rv providing according to NCBI: Chinese medicine bacterium preservation administrative center, bacterium numbering is: 93004.Network address: http://www.cmccb.org.cn/) genomic nucleic acid sequence (NCBI accession number: AL123456.2) obtains the nucleotide sequence of antigen of mycobacterium tuberculosis protein coding gene, according to the restriction enzyme site of encoding gene inside, the restriction enzyme site combination (using the restriction enzyme site combination of SacI and NotI) that Select gene inside does not have, respectively get 20bp design primer from the front and back of encoding gene, concrete primer sequence following (underscore is depicted as restriction enzyme site sequence):
R1987forward:ATAT? GAGCTC?ATGGCCGGACTGAACATTTA，
R1987reverse:GAGCG? GCGGCCGC?CTAGGTGCAAGGATATTGCC；
R3807cforward:GATG? GAGCTC?ATGGTGGCCGTGCAGTCGGC，
R3807creverse:GAGAG? GCGGCCGC?TCATCTCTTCCGGGCCCTTT；
R3887cforward:TTAT? GAGCTC?GTGACTGCGCCGCATAAGGT，
R3887creverse:CGAGC? GCGGCCGC?TTAGTGGCGAAGCCATGCAA。
The PCR result of corresponding gene is referring to Fig. 4.PCR reaction system and reaction conditions are as table 1 and table 2:
Table 1PCR reaction system
Table 2PCR reaction conditions
PCR product reclaims purifying:
Adopt the UNIQ-10 pillar DNA glue of Shanghai biotechnology company limited to reclaim test kit recovery DNA fragmentation, reclaim the step of the specification sheets of test kit carry out according to the centrifugal DNA gel of UNIQ-10 pillar, concrete operations are as follows:
(1) with 1.0% agarose gel electrophoresis, target DNA fragment and other DNA are divided out, under ultraviolet lamp, be used in the knife blade burning on spirit lamp flame and cut the agar block that contains target DNA fragment, put into 1.5ml sterilizing centrifuge tube;
(2) add 400 μ l Binding Buffer by every 100mg agarose gel, put in 55 DEG C of water-baths 10 minutes, make sepharose thoroughly melt (while adding thermosol, within every 2 minutes, mixing once);
(3) UNIQ-10 post is put into collection tube, the sol solution of thawing is transferred in UNIQ-10 post, room temperature leaves standstill 2 minutes, and 8000 revs/min of room temperatures are centrifugal 1 minute;
(4) outwell the waste liquid in collection tube, in UNIQ-10 post, add 500 μ l Wash Solution, 8000 revs/min of room temperatures are centrifugal 1 minute;
(5) repeating step 4;
(6) take off UNIQ-10 post, outwell the waste liquid in collection tube, UNIQ-10 post is put into same collection tube, 12000 revs/min of room temperatures are centrifugal 1 minute;
(7) UNIQ-10 post is put into the 1.5ml centrifuge tube of a sterilizing, added 20 μ l ddH in the film central authorities of pillar bottom 2o, room temperature was placed after 2 minutes, 12000 revs/min centrifugal 1 minute, the liquid in centrifuge tube is the DNA fragmentation of recovery, be stored in-20 DEG C for subsequent use.
Embodiment 2: the histidine-tagged fusion expression vector that builds antigen of mycobacterium tuberculosis gene
The general LB substratum using in the present embodiment and additional microbiotic kantlex (seeing shown in concrete steps) are filled a prescription referring to J. Pehanorm Brooker, and EF. is Ritchie not, T. Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002.
(1) the antigen of mycobacterium tuberculosis protein coding gene PCR product obtaining by embodiment 1 and pET28a expression vector (Fig. 3 is shown in by carrier collection of illustrative plates) are digested through corresponding restriction enzyme (purchased from precious biotechnology (Dalian) company limited) respectively;
(2) enzyme obtaining by step (1) being cut to product is connected and spends the night at 16 DEG C with carrier;
The system of ligation is in table 3:
The system of table 3 ligation
(3) conversion of connection product: get 100 μ l DH5 α competent cells (purchased from Chao Yan bio tech ltd, Shanghai) and join in 1.5mlEP pipe, add the each 5 μ l of connection product that obtain by step (2) and mix.Put on ice after 30 minutes 42 DEG C of heat shocks 90 seconds, ice bath 1 minute.Add 400 μ l LB substratum, in 37 DEG C of 200 revs/min of shaking culture 45 minutes.Escherichia coli bacteria liquid after recovery in 4000 revs/min centrifugal 3 minutes, discard 400 μ l supernatants, by resuspended remaining 100 μ l and coat the LB agar plate that contains 30 μ g/ml kantlex, be inverted for 37 DEG C and cultivate 16h and occur to bacterium colony;
(4) respectively the transformant obtaining is seeded to 37 DEG C of overnight incubation of LB substratum;
(5) extraction of plasmid: bacterium liquid is proceeded in 1.5ml centrifuge tube, in 4 DEG C 12000 revs/min centrifugal 1 minute, abandon supernatant, handstand centrifuge tube, on thieving paper, flows to end liquid.Add the solution I of 100 μ l ice precoolings, with pipettor repeatedly pressure-vaccum thalline is fully suspended, then add the freshly prepared solution II of 200 μ l, repeatedly put upside down centrifuge tube for several times, ice bath 5min, finally adds the solution III of 150 μ l ice precoolings, gentleness is put upside down centrifuge tube for several times, ice bath 10min.In 4 DEG C with 12000 revs/min centrifugal 6 minutes, draw supernatant to another 1.5ml centrifuge tube, add the anhydrous propyl alcohol of 2 times of volumes, be mixed evenly, room temperature leaves standstill 5min.Centrifugal 6 minutes of 12000 revs/min of room temperatures, abandon supernatant, and precipitation is with after 75% ethanol rinsing, seasoning.20 μ l ddH for precipitation 2o dissolves.Obtain the histidine-tagged recombinant expression vector of antigen of mycobacterium tuberculosis gene;
(6) double digestion of recombinant plasmid qualification: utilize respectively SacI and NotI enzyme to cut recombinant expression plasmid, enzyme should occur after cutting expecting that big or small external source fragment and carrier segment are correct recombinant plasmid.The double digestion result of recombinant plasmid is referring to Fig. 5.
Embodiment 3: antigen of mycobacterium tuberculosis albumen abduction delivering in intestinal bacteria
The general LB substratum using in the present embodiment and additional microbiotic kantlex (seeing shown in concrete steps) are filled a prescription referring to J. Pehanorm Brooker, and EF. is Ritchie not, T. Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002.
(1) recombinant plasmid obtaining by embodiment 2 is transformed respectively to BL21(DE3) bacterial strain (purchased from Chao Yan bio tech ltd, Shanghai): get 100 μ l BL21(DE3) competent cell joins in 1.5mlEP pipe, adds the each 1 μ l of the recombinant plasmid obtaining by embodiment 3 and mix.Put on ice after 30 minutes 42 DEG C of heat shocks 90 seconds, ice bath 1 minute.Add 400 μ l LB substratum, in 37 DEG C of 200 revs/min of shaking culture 45 minutes.Escherichia coli bacteria liquid after recovery in 4000 revs/min centrifugal 3 minutes, discard 400 μ l supernatants, by resuspended remaining 100 μ l and coat the LB agar plate that contains 30 μ g/ml kantlex, be inverted for 37 DEG C and cultivate 16h and occur to bacterium colony;
(2) transform in the LB substratum that the flat board obtaining, picking list bacterium colony access 1ml contains kantlex (30 μ g/ml) from step (1).In 37 DEG C of shaking table overnight incubation;
(3) to step (2) obtain overnight culture in add 1ml to contain kantlex (30 μ g/ml) and IPTG(isopropyl-β-D-thiogalactoside(IPTG), final concentration 1.0mM) LB substratum.Continue to cultivate 12 hours in 37 DEG C of shaking tables;
(4) will by step (3) obtain culture be transferred in 1.5ml centrifuge tube, 12000 revs/min centrifugal 1 minute collect thalline, remove supernatant, by thalline in-20 DEG C of preservations.
Embodiment 4: the sex change purifying of antigen of mycobacterium tuberculosis albumen
The buffer B, C and the E formula ginseng that in the present embodiment, use are shown in Table 4.
Component and the proportioning thereof of buffer B, C and the E using in table 4 embodiment 4
(1) in the thalline of collecting, add 1ml buffer B in embodiment 3, in 37 DEG C of shaking table overnight incubation, make cellular lysate;
(2) by the thalline after step (1) cracking in 4 DEG C, 16000 revs/min centrifugal 1 hour, supernatant is fetched into 1.5ml centrifuge tube;
(3) get 20 μ l nickel affinity chromatography glue pearls (purchased from GE company) to a 1.5ml centrifuge tube, add 1ml phosphoric acid buffer (PBS, formula is referring to above-mentioned " molecule clone technology experiment guide ", 2002, Science Press, pH7.4), softly mix, 2000 revs/min centrifugal 10 seconds, careful sucking-off supernatant, in triplicate;
(4) in the glue pearl of step (3), add 0.5ml 50mM NiSO 4, softly mix, 2000 revs/min centrifugal 10 seconds, careful sucking-off supernatant;
(5) in the glue pearl of step (4), add 1ml PBS, softly mix, 2000 revs/min centrifugal 10 seconds, careful sucking-off supernatant, in triplicate;
(6) in the glue pearl of step (5), add 1ml buffer B, softly mix, 2000 revs/min centrifugal 10 seconds, careful sucking-off supernatant;
(7) glue pearl room temperature in a 1.5ml centrifuge tube that supernatant and the step (6) step (2) being obtained obtains mixes 1 hour, 2000 revs/min centrifugal 10 seconds, carefully sucking-off supernatant;
(8) in the glue pearl of step (7), add 1ml damping fluid C, softly mix, 2000 revs/min centrifugal 10 seconds, careful sucking-off supernatant;
(9) in the glue pearl of step (8), add 50 μ l damping fluid E, softly mix, 2000 revs/min centrifugal 10 seconds, careful sucking-off supernatant;
(10) in the supernatant obtaining by step (9), comprise antigen of mycobacterium tuberculosis albumen;
(11) mensuration of antigen of mycobacterium tuberculosis protein concentration: use Thermo Scientific NANODROP 100 Spectrophotometer to measure the concentration of protein, operate according to the working instructions of this instrument.
Embodiment 5: the SDS-PAGE(polyacrylamide gel electrophoresis of antigen of mycobacterium tuberculosis albumen) and western-blot to detect the buffer formulation using in the present embodiment as follows:
2 × SDS sample-loading buffer (10ml): take 0.4g SDS, add 1ml Tris-Cl(pH6.8), 2ml 1% tetrabromophenol sulfonphthalein, 4ml 50% glycerine, 1ml ddH 2o, fully stirring and dissolving;
1MDTT: take 3.09g DTT powder, add the 0.01M NaOAc(pH5.2 of 20ml), after dissolving, use 0.22 μ m membrane filtration degerming, be distributed into aliquot ,-20 DEG C of preservations;
30% acrylamide soln: take 290g acrylamide, 10g N, N '-methylene-bisacrylamide, adds 600ml ddH 2o, fully stirring and dissolving, uses ddH 2o is settled to 1L, with 0.45 μ m membrane filtration, with 4 DEG C of preservations in brown bottle;
2.0M Tris-Cl(pH8.8): take 242.2g Tris-alkali, add 800ml ddH 2o, with dense HCl adjusting pH to 8.8, uses ddH 2o is settled to 1L;
1.0M Tris-Cl(pH6.8): take 121.1g Tris-alkali, add 800ml ddH 2o, with dense HCl adjusting pH to 6.8, uses ddH 2o is settled to 1L;
10%SDS: take 10g sodium lauryl sulphate (SDS), add 80ml ddH 2o, 68 DEG C of heating for dissolving, drip concentrated hydrochloric acid and regulate pH to 7.2, use ddH 2o is settled to 100ml;
10% ammonium persulphate: take 1g ammonium persulphate, add 10ml ddH 2the abundant stirring and dissolving of O, stores and 4 DEG C;
5 × Tris-glycine electrophoretic buffer: take 15.1gTris-alkali, 94g glycine, 5g SDS, uses ddH 2o is settled to 1L;
Staining fluid: take 1g coomassie brilliant blue R_250, add successively 250ml Virahol, 100ml Glacial acetic acid and 650ml ddH 2o;
Destainer: 100ml acetic acid, 50ml ethanol, 850ml ddH 2o;
Transfering buffering liquid: 39mM glycine, 48mM Tris-alkali, 0.037%SDS(electrophoresis level), 20% methyl alcohol.(2.9g glycine, 5.8gTris-alkali, 0.37g SDS, 200mL methyl alcohol, uses ddH 2o constant volume is to 1L);
TBS damping fluid: take 8.8g NaCl, add 20ml 1M Tris-Cl(pH8.0), use ddH 2o is settled to 1L;
TBST damping fluid: adding final concentration in TBS is 0.05% Tween-20;
DAB nitrite ion (purchased from Wuhan Yi De Bioisystech Co., Ltd): to 1ml ddH 2in O, drip respectively each one of A liquid, B liquid, C liquid, mix.
Concrete implementation step:
(1) preparation of SDS-PAGE electrophoresis sample: get the antigen of mycobacterium tuberculosis albumen that 10 μ l obtain by embodiment 4, add 2 × SDS sample-loading buffer, 8 μ l, 1M DTT 2 μ l, after mixing, in 100 DEG C of 10min, 12000 revs/min are centrifugal 1 minute;
(2) preparation of sds page and electrophoresis:
13.5% separation gel preparation system is in table 5:
The component of separation gel and proportioning thereof in table 5 embodiment 5
Each composition is added to rear rapid mixing, add in glue plate, surface coverage one deck Virahol.Room temperature is removed Virahol after placing and solidifying, and uses ddH 2o rinses repeatedly and rinses, and thieving paper blots.
The configuration scheme of concentrated glue is in table 6:
Component and the proportioning thereof of concentrated glue in table 6 embodiment 5
Each composition is added to rear rapid mixing, add separation gel above, fill rear insertion application of sample comb.After gelling to be concentrated is solid, take off comb;
Gel is fixed on electrophoresis apparatus, adds the Tris-glycine electrophoretic buffer of q.s, in well, add respectively each sample;
Voltage 80V, electrophoresis 15 minutes, enters separation gel to tetrabromophenol sulfonphthalein; Voltage 120V, to tetrabromophenol sulfonphthalein swimming plastic emitting bottom surface, stops electrophoresis.
(3) polyacrylamide gel dyeing and decolouring (if carry out western-blot, skipping this step): unload gel, with coomassie brilliant blue R_250 staining fluid dyeing 30 minutes, then decolour with destainer, observations.
(4) western-blot of antigen of mycobacterium tuberculosis albumen detects: transferring film: cut out 6 filter paper and 1 nitrocellulose membrane (NC film), the size of filter paper and film is identical with the gel size of step (2); Nitrocellulose membrane is soaked in transfering buffering liquid 5 minutes; In another shallow pallet, add a small amount of transfering buffering liquid, 6 filter paper are soaked in wherein; On the negative pole face of electrode, put successively 3 metafiltration paper, polyacrylamide gel, nitrocellulose membrane and 3 metafiltration paper; Thoroughly get rid of the bubble of each interlayer; By the negative pole cover of electrode to film glue complex body; Electrotransfer groove is put in ice bath, connects power supply, constant current 250mA, transferase 12 hour;
(5) sealing: NC film is placed in to 5% skim-milk, room temperature sealing 1 hour;
(6) wash film: abandon confining liquid, wash NC film 3 times, each 5 minutes with 1 × TBST;
(7) primary antibodie is hatched: NC film is put into the anti-His-tag antibody of rabbit (dilution volume ratio 1:5000) (purchased from Wuhan Fei Yi Science and Technology Ltd.) with 1 × TBST dilution, incubated at room 1 hour;
(8) wash film: take out NC film, wash film 3 times, each 5 minutes with 1 × TBST;
(9) two anti-hatching: NC film is proceeded to the goat anti-rabbit igg antibody (dilution volume ratio is 1:5000) (purchased from Wuhan Yi De Bioisystech Co., Ltd) with the horseradish peroxidase mark of 1 × TBST dilution, incubated at room 1 hour;
(10) wash film: take out NC film, wash film 3 times, each 5 minutes with 1 × TBST;
(11) wash film: take out NC film, wash film 3 times, each 5 minutes with 1 × TBS;
(12) colour developing: NC film is placed in to the DAB nitrite ion of new configuration, after protein band colour developing, water rinses with termination reaction.
The SDS-PAGE(polyacrylamide gel electrophoresis of antigen of mycobacterium tuberculosis albumen) the results are shown in Figure 6.
The western-blot detected result of antigen of mycobacterium tuberculosis albumen is shown in Fig. 7.
Embodiment 6: the application (indirect ELISA) of antigen of mycobacterium tuberculosis albumen in diagnosis of tuberculosis
The buffer formulation using in the present embodiment is as follows:
Carbonate buffer solution (the Na of coating buffer: 0.05M, pH9.6 2cO 3: 1.59g; NaHCO 3: 2.93g; With distilled water constant volume to 1L);
Washings: containing the PBS solution of 0.05% tween 20 (PBS fill a prescription referring to J. Pehanorm Brooker, and EF. is Ritchie not, and T. Manny A Disi shows, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 years);
Confining liquid: containing the washings of 5% skimmed milk;
Stop buffer: 2M H 2sO 4;
Concrete implementation step:
(1) coated: the antigen of mycobacterium tuberculosis albumen obtaining by embodiment 5 purifying is diluted to 500ng/ml with coating buffer, draws with micropipet the sample having diluted and add in elisa plate, every hole 100 μ l, 4 DEG C are spent the night;
(2) washing: from the elisa plate of 4 DEG C of taking-up steps (1), dry content next day, adds washings, every hole 200 μ l in hole, leave standstill 3 minutes, dry, then add washings, so foam washing three times, after last drying, by elisa plate, towards being placed down in, on filter paper, beating is clean repeatedly;
(3) sealing: add confining liquid in the elisa plate of step (2), every hole 200 μ l, 37 DEG C of incubations 30 minutes;
(4) washing: the method for same step (2);
(5) add primary antibodie reaction: (be so kind as to give at medical treatment center, Wuhan City, Hubei Province to adding human serum in the elisa plate of step (4), 96 parts of clinical positive serums, 24 parts of clinical negative serums) (wherein the formula of diluent is with reference to the formula of washings for diluent, contain the PBS solution of 0.05% tween 20, wherein PBS fills a prescription referring to J. Pehanorm Brooker, EF. Ritchie not, T. Manny A Disi work, Huang Peitang, Wang Jiaxi etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002) dilution volume ratio 1:50), every hole 100 μ l, 37 DEG C of incubations 30 minutes,
(6) washing: the method for same step (2);
(7) add two anti-reactions: to mountain goat anti-human igg antibody (purchased from the Wuhan Yi De Bioisystech Co., Ltd) diluent (dilution volume ratio 1:5000) that adds horseradish peroxidase mark in the elisa plate of step (6), every hole 100 μ l, 37 DEG C of incubations 30 minutes;
(8) washing: the method for same step (2);
(9) colour developing: to adding tmb substrate colour developing (purchased from Wuhan Yi De Bioisystech Co., Ltd) in the elisa plate of step (8), every hole 100 μ l, 37 DEG C of lucifuges 30 minutes;
(10) termination reaction: add stop buffer 100 μ l in the every hole of elisa plate of step (9), color development stopping reaction;
(11) result reads: utilize microplate reader to read OD 450value.
(12) interpretation of result:
Mean value: clinical negative serum OD 450mean value (the x of value i: the OD of i part serum 450value);
Standard deviation: clinical negative serum OD 450the standard deviation of value;
Threshold value (cut-off value) is calculated: clinical negative serum OD 450the mean value of value adds the standard deviation of 2 times;
Threshold value=mean value+2 × standard deviation
Positive: OD in clinical positive serum 450value is greater than the positive sample of sample of threshold value;
Susceptibility: OD in clinical positive serum 450the sample number that value is greater than threshold value accounts for the ratio of clinical positive serum sum;
Negative: OD in clinical negative serum 450value is less than the negative sample of sample of threshold value;
Specificity: OD in clinical negative serum 450the sample number that value is less than threshold value accounts for the ratio of clinical negative serum sum;
Accuracy:
ELISA detected result (OD 450value) as shown in table 7.
Table 7 diagnosis result table
Illustrate: 1, the symbol "+" in 6th hurdle-, 7 hurdles in table 7, "-" number represents respectively positive or negative.
2, the preparation method of the Mutiple-antigen on table 7 the 5th hurdle (hybrid antigen albumen) is shown in the explanation of Fig. 6 in " brief description of the drawings ".
The statistical study of table 7 result is as shown in table 8.
Table 8 diagnosis result statistical analysis table
Embodiment 7: carry out detection lungy (simultaneous test) with TB-DOT test kit
The mycobacterium tuberculosis antibody diagnostic kit (colloidal gold method) that adopts Shanghai Upper Bio-tech Pharma Co., Ltd., carries out according to the step of the specification sheets of test kit, and concrete operations are as follows:
(1) in the middle of the reacting hole of Sptting plate, add 2 confining liquids, wait for that film sucks;
(2) get the fresh serum specimen of 40 μ l, add in the middle of reacting hole, wait for that film sucks;
(3) in the middle of reacting hole, add 6 washingss, wait for that film sucks;
(4) in the middle of reacting hole, add 2 gold mark liquid, wait for that film sucks;
(5) in the middle of reacting hole, add 6 washingss, wait for that film sucks, visual observation;
(6) result is judged: the positive: Quality Control point shows red, has punctation to occur in the middle of reacting hole; Negative: Quality Control point shows red, the middle redfree spot of reacting hole occurs or is only vestige.
TB-DOT detected result is as shown in table 7.
Statistic analysis result is as shown in table 8.
Embodiment 8: carry out detection lungy (simultaneous test) with TB-check-1 test kit
The tubercule bacillus detection kit TB-check-1 that adopts French VEDA LAB S. A. to produce, a step immunochromatographyassay assay tubercule bacillus, carries out according to the step of the specification sheets of test kit, and concrete operations are as follows:
(1) before test, sample and TB-check-1 plate are put in to room temperature, make it restore to room temperature;
(2) tear packing bag along bag along breach, take out agent plate;
(3) in agent plate, put on patient number;
(4) draw sample (serum) with dropper, (25 μ are l) to sample aperture vertically to add one;
(5) add 150 μ l diluents to sample aperture;
(6) 15 minutes observationss;
(7) result is judged: feminine gender: there is single line bar at C place; Positive: except there is single line bar at C place, also there are clear and legible lines at T place; Invalidate the test: as C place occurs without lines, invalidate the test, separately gets agent plate revision test.
TB-check-1 detected result is as shown in table 7.
Statistic analysis result is as shown in table 8.
The present invention is by the antigen protein (Rv1987 of clonal expression mycobacterium tuberculosis, Rv3807c and Rv3887c), they,, for diagnosis lungy, have been proved to these 3 kinds of antigen proteins use separately or mixing is used (Multiple-antigen) all to have good diagnostic accuracy.Compare with the detection effect of two diagnosis test kits that are purchased, these 3 kinds of antigen proteins all have stronger susceptibility, specificity and accuracy (comparative result is shown in Fig. 8,9,10), be good specific antigen protein, can be used as the candidate antigens that develops quick specific diagnostic tuberculosis kit.

Claims (1)

1. the application of the antigen protein of aminoacid sequence as described in sequence table SEQ ID NO:4 in the ELISA test kit of preparing diagnosis of tuberculosis detection.
CN201210521551.3A 2010-07-15 2010-07-15 Antigen protein for mycobacterium tuberculosis and application Expired - Fee Related CN102993283B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210521551.3A CN102993283B (en) 2010-07-15 2010-07-15 Antigen protein for mycobacterium tuberculosis and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210521551.3A CN102993283B (en) 2010-07-15 2010-07-15 Antigen protein for mycobacterium tuberculosis and application

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN 201010231572 Division CN102260328B (en) 2010-07-15 2010-07-15 Antigen proteins of Mycobacterium tuberculosis and application thereof

Publications (2)

Publication Number Publication Date
CN102993283A CN102993283A (en) 2013-03-27
CN102993283B true CN102993283B (en) 2014-11-12

Family

ID=47922447

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210521551.3A Expired - Fee Related CN102993283B (en) 2010-07-15 2010-07-15 Antigen protein for mycobacterium tuberculosis and application

Country Status (1)

Country Link
CN (1) CN102993283B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103382473B (en) * 2013-07-24 2015-04-01 重庆医科大学 Nucleotide mts 90 and use thereof in tuberculosis diagnosis
CN106053800A (en) * 2016-05-30 2016-10-26 南华大学 Tuberculosis serological diagnostic kit

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1388378A (en) * 2002-06-17 2003-01-01 四川大学 Tubercle mycobaterium detecting reagent
CN101661044A (en) * 2008-08-27 2010-03-03 复旦大学附属华山医院 Diagnostic reagent of tuberculosis and kit

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1388378A (en) * 2002-06-17 2003-01-01 四川大学 Tubercle mycobaterium detecting reagent
CN101661044A (en) * 2008-08-27 2010-03-03 复旦大学附属华山医院 Diagnostic reagent of tuberculosis and kit

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Camus,J.C.等.POSSIBLE CONSERVED TRANSMEMBRANE PROTEIN [Mycobacterium tuberculosis H37Rv].《GenBank序列号NP_218324.1》.2007,氨基酸序列. *
POSSIBLE CONSERVED TRANSMEMBRANE PROTEIN [Mycobacterium tuberculosis H37Rv];Camus,J.C.等;《GenBank序列号NP_218324.1》;20070524;氨基酸序列 *

Also Published As

Publication number Publication date
CN102993283A (en) 2013-03-27

Similar Documents

Publication Publication Date Title
CN102636641B (en) Detection kit of helicobacter pylori emulsion method and preparation process thereof
CN109254155B (en) Colloidal gold immunochromatographic test paper for detecting African swine fever virus antigen, and preparation method and application thereof
CN102183646B (en) Preparation method of rTpN15-17-47-ELISA for detecting syphilis serum antibody
CN107573417A (en) Mycoplasma pneumoniae chimeric antigen, the antigen detecting agent and both preparation methods
CN110041411B (en) Stable atypical swine fever virus subunit protein, vaccine, preparation method and application thereof
CN103059109B (en) Mycoplasma pneumonia antigen, preparation method and immunodetection kit
CN107663235A (en) The related PLA2R recombinant proteins of idiopathic membranous nephropathy and its application
CN108314710B (en) Mycoplasma pneumoniae recombinant antigen and application thereof
CN105542014A (en) TP recombinant antigen and preparing method and application thereof
CN101538578B (en) Recombinant bovine tuberculosis specific antigen protein with three fused genes and preparation method thereof
CN108627648A (en) A kind of ELISA antibody assay kits of 3 type of novel pig circular ring virus and its application
CN107304231B (en) Mycobacterium tuberculosis fusion protein and application thereof
CN105755118A (en) Method for quickly detecting vibrio parahaemolyticus by aid of immunomagnetic beads and loop-mediated isothermal amplification processes
CN107759674A (en) A kind of Mycoplasma bovis immune-related albumen, the detection kit containing the albumen and its purposes in Mycoplasma bovis antibody test
CN102993283B (en) Antigen protein for mycobacterium tuberculosis and application
CN111848750B (en) Method and kit for rapidly enriching and detecting 2019-nCoV
CN112111015B (en) PLA2R, C1q and THSD7A fusion protein and construction method and application thereof
CN101509007B (en) Synthesis of LfcinB15-Mag12 encoding gene and expression method in colon bacillus
CN111560341B (en) Generic inert vector escherichia coli and potential application thereof
CN109975552A (en) A kind of recombination cystatin C albumen and its application in detection kit
CN104678097B (en) A kind of mycobacterium tuberculosis combined antigen for diagnosis of pulmonary tuberculosis
CN101550186B (en) Sheep recombination prion protein and monoclonal antibody thereof and application
CN102260328B (en) Antigen proteins of Mycobacterium tuberculosis and application thereof
CN102977197B (en) Antigenic protein of mycobacterium tuberculosis
CN103275194A (en) Antigen of pig transmissible gastroenteritis virus or pig respiratory tract coronavirus antibody in pig serum and enzyme-linked immunosorbent assay (ELISA) detection method thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20141112

Termination date: 20150715

EXPY Termination of patent right or utility model