CN105755118A - Method for quickly detecting vibrio parahaemolyticus by aid of immunomagnetic beads and loop-mediated isothermal amplification processes - Google Patents
Method for quickly detecting vibrio parahaemolyticus by aid of immunomagnetic beads and loop-mediated isothermal amplification processes Download PDFInfo
- Publication number
- CN105755118A CN105755118A CN201610134920.1A CN201610134920A CN105755118A CN 105755118 A CN105755118 A CN 105755118A CN 201610134920 A CN201610134920 A CN 201610134920A CN 105755118 A CN105755118 A CN 105755118A
- Authority
- CN
- China
- Prior art keywords
- antibody
- vibrio parahemolyticus
- isothermal amplification
- mediated isothermal
- toxr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for quickly detecting vibrio parahaemolyticus by the aid of immunomagnetic beads and loop-mediated isothermal amplification processes.The method includes cloning Vp species specific toxR28-534 genes by the aid of the vibrio parahaemolyticus which is used as a template, and carrying out prokaryotic expression and purification; preparing polyclonal antibodies for toxR28-534 proteins; conjugating the polyclonal antibodies and amino magnetic bead micro-spheres with one another; synthesizing biotin-labeled target DNA (deoxyribonucleic acid) and primers required by the LAMP (loop-mediated isothermal amplification) processes, conjugating the antibodies and the target DNA with one another by the aid of streptavidine and preparing antibody-DNA conjugates; mixing to-be-detected liquid and the antibody-conjugated magnetic beads with one another, separating the magnetic beads from thalli by the aid of magnetic frames, re-suspending the magnetic beads, then mixing the magnetic beads with the antibody-DNA conjugates and carrying out amplification detection by the aid of the LAMP processes and magnetic bead-thallus-antibody-DNA conjugates which are used as templates.The method has the advantages that specific protein molecules are amplified and then are detected by the aid of immunomagnetic bead technologies, accordingly, the detection time can be shortened, and field operation can be facilitated.
Description
Technical field
The present invention relates to technical field of microbial detection, the immunomagnetic beads ring being specifically related to a kind of Antibody DNA conjugate is situated between
Lead the method that isothermal duplication method quickly detects vibrio parahemolyticus.
Background technology
Vibrio parahemolyticus (Vibrio parahaemolyticus, Vp) is gram-negative halophilic vibrio, is distributed widely in
Harbour, seawater bank, Haihe River intersection etc., mainly the marine product by polluting causes acute human gastroenteritis and traveller
Acute diarrhea, wound infection and septicemia.In recent years, the crowd of edible marine product was in constantly amplification, more and more
People starts to pursue some seafood sashimis.Country's food origin disease monitoring net data show the disease of China's microbes food poisoning
There is notable change in former distribution, particularly at maritime provinces, and food poisoning generation scale that vibrio parahemolyticus causes and people
It is obvious ascendant trend that group exposes scale, has been in microorganism alimentary intoxication the first.Vibrio parahemolyticus also can be felt simultaneously
The multiple aquatic animal such as dye fish, shrimp, crab class and shell-fish, it is unfavorable to cause aquaculture.At present, USA and EU pair
Inlet water product all Compulsory Features carry out the detection of vibrio parahemolyticus, and testing result is that feminine gender can clearance.
Vibrio parahemolyticus pathogenicity mechanism is more complicated, its virulence factor have haemolytic exotoxin, urease, adhesion factor and
Invasiveness.The cross-film transcriptional regulation protein toxR of vibrio parahemolyticus participates in regulation and control major virulence gene and outer membrane protein
Expressing, by toxR gene code, be the good molecular target of vibrionaceae species identification, toxR gene can be in the level planted
Upper detection vibrio parahemolyticus.
It is fast, especially in annual May-August, it is easier to cause large-area bacillary food that vibrio parahemolyticus grows speed
Thing poisoning, the Fast Detection Technique of Vp is particularly important.At present, the traditional detection of China vibrio parahemolyticus
Means are based on culture of microorganism, and whole process probably needs 5-8 days, and complex operation is time-consuming, can not meet people couple
The fast and convenient requirement of food safety detection.So, higher, the most higher, fast in the urgent need to developing sensitivity
The detection means that speed is easy, monitors food-borne pathogens, to ensure the food security of people.
The most progressive development promoting detection method of technology, has had increasing method for quickly detecting pair
Hemolytic vibrios, as round pcr, enzyme linked immunosorbent assay (enzyme-labeled immunosorbent assay,
ELISA), real-time quantitative fluorescence PCR method (Real-time fluorescent quantitative PCR, FQ-PCR) and ring
Mediated isothermal amplification technology (Loop-mediated isothermal amplification, LAMP).
Round pcr by specific amplification can amplification detection target at short notice, there is highly sensitive feature, but
The requirement of PCR detection operating process is high and false positive easily occurs.ELISA method utilizes the specific binding inspection of Ag-Ab
Surveying pathogenic bacteria, the requirement to equipment is relatively low, but sensitivity is the most relatively low, applies in food security Micro biological Tests
The most extensive.FQ-PCR energy qualitative detection and quantitative analysis target molecule, but expensive in terms of reagent and instrument expense.
Additionally, above detection method is required to operating personnel has skilled operation skill and a certain specialist, therefore,
Expensive instrument and equipment, higher testing cost and strict technology require to limit the field quick detection of these technology and
Basic unit's popularization and application.
Ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP), is Japan in 2000
The nucleic acid isothermal amplification technology that scholar Notomi etc. set up, is that 4 species-specific primers are designed in 6 regions for target gene,
Make LAMP reaction have high specific amplification, utilize a kind of strand displacement archaeal dna polymerase (Bst DNA
Polymerase) it is incubated about 60min in isothermy (about 65 DEG C), genes of interest amplified reaction can be completed, thus
Overcome the shortcoming that PCR reaction needs thermal denaturation repeatedly to obtain single-stranded template, it is to avoid the time-consuming process of heating and cooling repeatedly,
There is feature simple, quick, that high specificity, sensitiveness are high, and LAMP reaction need not PCR instrument and costliness
Reagent, be conducive in some infrastructure and the application of Site Detection.
LAMP technology as an emerging Fast Detection Technique have the shortest, expense is low, high sensitivity, high special
Property etc. feature, it is easy to promote at some infrastructure, be particularly well-suited to the quick detection at scene, have extremely wide should
Use prospect.But, in actual use, it has been found that detection vibrio parahemolyticus yet suffers from LAMP method
Not enough.First, similar with most of detection methods, LAMP method first has to selective enrichment and cultivates.Generally this step needs
Take time-consuming one day, be both unfavorable for the Site Detection of sample, it is also possible to introduce new pollution.Next, although parahemolyticas
The LAMP method detection rapid sensitive of vibrios is easy, but measuring samples is during Zengjing Granule or when extracting DNA
May be polluted by Vp, or measuring samples exists the pollutant the highest with target DNA sequence dna homology, thus
Cause false positive.
Summary of the invention
The present invention is often single copy gene group based on bacterium, if detected with DNA, the on-the-spot Vp obtained can
Can be not enough to detect DNA very little, but, the expression product of bacterial gene, such as protein, is multicopy, permissible
It is several, tens or hundreds of thousands of copies, proposes to be carried out again by immunomagnetic bead technique capture differential protein molecule
Detect after amplification, thus avoid the link of Zengjing Granule, shorten the detection time, it is simple to execute-in-place；Secondly by manually
The target DNA of synthesis carries out the false positive rate detecting to reduce the detection of LAMP method.
The immunomagnetic beads ring mediated isothermal amplification method of the Antibody DNA conjugate that the present invention proposes quickly detects parahemolyticas arc
Bacterium main thought is: first prepare vibrio parahemolyticus distinctive target proteins antigen: cross-film transcriptional regulation protein toxR；
Antibody is prepared for toxR；By specific antibody on the pan coating of immunomagnetic beads, prepare antibody coupling magnetic bead thus
The target proteins of vibrio parahemolyticus in capture measuring samples；Prepare the target DNA conjugate of antibody-Prof. Du Yucang, will
The target DNA conjugate attachment of this antibody-Prof. Du Yucang is up；Optimize LAMP reaction system and carry out specific amplified to reach
To the effect of amplification target, shorten the detection time, improve specific (as shown in Figure 1) of detection.
Immunomagnetic beads ring mediated isothermal amplification method of the present invention quickly detect vibrio parahemolyticus (Vibrio parahaemolyticus,
Vp) method, specifically includes following steps:
S1: with vibrio parahemolyticus as template, clones Vp species specificity toxR28-534Gene, prokaryotic expression and purify across
Film transcriptional regulation protein toxR28-534；
S2: prepared for toxR by immunity White Rabbit28-534The polyclonal antibody of albumen；
S3: by the toxR of preparation28-534Protein polyclone antibody and amino magnetic bead microballoon coupling, prepare the magnetic bead of antibody coupling；
S4: needed for utilizing bioinformatics method Prof. Du Yucang biotin labeled target DNA and the detection of LAMP method
Primer sequence, by polyclonal antibody and the biotin coupling of preparation, then utilizes the anti-of Streptavidin couple biotin
Body and biotin labeled target DNA, prepare Antibody DNA conjugate；
S5: take liquid to be measured, mixes with the magnetic bead of antibody coupling, uses magnetic frame separation magnetic after target antigen fully combines
Pearl-thalline, the magnetic bead of separation is resuspended to be mixed with Antibody DNA conjugate afterwards, makes fully to combine, then with the magnetic bead obtained
-phage-antibody-DNA conjugate is template, uses vibrio parahemolyticus in LAMP method augmentation detection liquid to be measured.
In described step S1, vibrio parahemolyticus is vibrio parahemolyticus reference culture ATCC 17802.
In described step S1, Vp species specificity toxR gene is to remove signal peptide sequence and the ToxR base of cross-film district part
Because of fragment ToxR28-534, its base sequence is as shown in SEQ ID NO:1.
In described step S1 the expression vector of prokaryotic expression be pET-28a (+).
In described step S3 polyclonal antibody with amino magnetic bead microballoon coupling time mix in the ratio of 1: 2.5 (V/V).
In described step S4, target DNA is toxoplasma cdna fragment, and its base sequence is as shown in SEQ ID NO:2.
In described step S4 LAMP method detection needed for primer sequence specific as follows: F3 as shown in SEQ ID NO:7,
B3 is as shown in SEQ ID NO:8, and FIP is as shown in SEQ ID NO:9, and BIP is as shown in SEQ ID NO:10.
In described step S4, polyclonal antibody is mixed by the volume ratio of 100: 1 with biotin, biotinylated antibody, chain
Mould Avidin, biotin labeled target DNA press the mixed in molar ratio of 1: 1: 1.
In described step S5, liquid to be measured is 5: 1 (V/V) with the mixing match of antibody-coupled magnetic beads.
The mixing match that in described step S5, resuspended magnetic bead mixes with Antibody DNA conjugate is 7.5: 1 (V/V).
Compared with prior art, the present invention has the following advantages and remarkable result:
(1) present invention utilizes the LAMP method of Antibody DNA conjugate to establish the detection side of a kind of vibrio parahemolyticus
Method, the most fast and simple in operation, testing cost is lower, specific, sensitivity is higher, fast for vibrio parahemolyticus
Speed, accurately detection provide new developing direction；
(2) by the research of immunomagnetic ca pture method detection vibrio parahemolyticus, result display immunomagnetic beads is to secondary haemolysis
Property vibrios has certain special capture and enrichment, has feature quick, special, efficient, simple to operate, can answer
Routine testing work for laboratory, and there is certain specific and sensitivity, there is practical significance widely；
(3) Antibody DNA conjugate LAMP method detection vibrio parahemolyticus, required time far fewer than National Standard Method,
And result is without significant difference and stable, reliable with National Standard Method positive rate, substantially reduces the detection time, saves
Human and material resources；
(4) this method have inexpensively, high specificity, sensitiveness advantages of higher, the testing result of sample is illustrated, anti-
The LAMP system detection sample of body-DNA conjugate pollutes vibrio parahemolyticus there is good using value.
Accompanying drawing explanation
Shown in Fig. 1 to be that the immunomagnetic beads ring mediated isothermal amplification method of Antibody DNA conjugate of the present invention quickly detects secondary molten
The schematic diagram of courageous and upright vibrios.
Shown in Fig. 2 is ToxR in the embodiment of the present invention 128-534The PCR primer gel electrophoresis figure of genetic fragment, wherein
M:DNA standard molecular weight marker (DL 2000)；1:ToxR28-534PCR primer.
Shown in Fig. 3 is the PCR qualification figure of recombinant plasmid pET-28a-ToxR in the embodiment of the present invention 1, wherein M:DNA
Standard molecular weight marker (DL 2000)；1-5:pET-28a-ToxR positive colony.
Shown in Fig. 4 is the double digestion qualification figure of recombinant plasmid pET-28a-ToxR in the embodiment of the present invention 1, wherein M:
DNA standard molecular weight marker (DL 2000)；1:pET-28a-ToxR double digestion fragment；2:
λ-EcoT14I digest DNA marker。
Shown in Fig. 5 is ToxR in the embodiment of the present invention 128-534SDS-PAGE, wherein M:Fermentas
Albumen Marker；1: the non-abduction delivering of recombinant bacterium；2: the full bacterium of recombinant bacterium abduction delivering；3: on recombinant bacterium abduction delivering
Clear liquid；4: the recombinant protein ToxR of purifying28-534。
Shown in Fig. 6 is ToxR in the embodiment of the present invention 228-534The Westblotting qualification figure that how anti-albumen is, wherein M:
Fermentas albumen pre-dyed Marker；1:2ug ToxR28-534；2: negative control.
Shown in Fig. 7 is vibrio parahemolyticus LAMP electrophoresis detection result figure in the embodiment of the present invention 5, wherein M:
DL2000,1:108CFU/ml 2:107CFU/ml 3:106CFU/ml 4:105CFU/ml 5:104CFU/ml 6:103
CFU/ml 7: negative control.
Shown in Fig. 8 is vibrio parahemolyticus LAMP detection colour developing result, wherein 1:10 in the embodiment of the present invention 58
CFU/ml 2:107CFU/ml 3:106CFU/ml 4:105CFU/ml 5:104CFU/ml 6:103CFU/ml 7: negative right
According to.
Shown in Fig. 9 is the LAMP electrophoresis detection result figure of specificity experiments in the embodiment of the present invention 6, and wherein 1-5 is respectively
VP, Escherichia coli, staphylococcus aureus, salmonella and Bacillus cereus strain.
Shown in Figure 10 is the LAMP detection colour developing result of specificity experiments in the embodiment of the present invention 6, and wherein 1-5 divides
Wei VP, Escherichia coli, staphylococcus aureus, salmonella and Bacillus cereus strain.
Detailed description of the invention
Below in conjunction with embodiment, the present invention is further described in detail, so that those skilled in the art can be more preferably geographical
Solve the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.
Embodiment 1: the acquisition of vibrio parahemolyticus peculiar target proteins toxR
1. the cultivation of bacterial classification
From inclined-plane, picking one ring vibrio parahemolyticus reference culture ATCC 17802 is (purchased from Guangdong ring triumphant microorganism science and technology
Co., Ltd) it is inoculated in fluid nutrient medium (3% sodium chloride basic peptone water), cultivate 16h for 37 DEG C.Take 10 μ l again
Transfer 3% fresh sodium chloride basic peptone water nutrient solution, cultivate 16h for 37 DEG C.
2. design of primers
ToxR albumen is the cross-film transcription activating protein of vibrio parahemolyticus, according to remove ToxR protein signal peptide sequence and
Genetic fragment ToxR of cross-film district part28-534(base sequence as shown in SEQ ID NO:1, GenBank accession number:
Accession:AB029907.1) the specific upstream and downstream primer of design amplification.Upstream primer sequence (SEQ ID NO:
3) it is 5'-CGCGGATCCATGCTTGCTCAAAGGTTTACC-3', downstream primer sequence (SEQ ID NO:
4) it is 5'-CCGCTCGAGCCATGGATTCACAGCAGAAG-3', dashed part be respectively BamH I and
Xhol I restriction enzyme site.Primer is synthesized by Shanghai bioengineering Co., Ltd.
3.ToxR gene fragment amplification
Collecting vibrio parahemolyticus culture supernatant, genome extracts kit (purchased from Bao Sai bio tech ltd, Hangzhou)
Extract vibrio parahemolyticus DNA.With vibrio parahemolyticus DNA as template, with ToxR gene-specific primer,
2 × Super pfu mix high-fidelity PCR amplification enzyme (purchased from Bao Sai bio tech ltd, Hangzhou) carries out PCR amplification,
Response procedures is as follows: 94 DEG C of denaturations 5min；94 DEG C of sex change 30sec, 55 DEG C of annealing 30sec, 68 DEG C extend 30sec,
32 circulations；72 DEG C extend 10min, 4 DEG C of preservations eventually.The ToxR of 1% agarose gel electrophoresis purification Identification28-534Base
Because of PCR primer.Amplification rear electrophoresis testing result is as shown in Figure 2.
4. the structure of recombinant plasmid
The ToxR that glue is reclaimed28-534Genetic fragment and expression vector pET-28a (+) (Novagen) respectively with BamH I and
Xhol I double digestion, after glue reclaims digestion products, T4 ligase overnight connects, and connection product is transformed into E.coli DH5a (Hangzhoupro
Zhou Baosai bio tech ltd grants), kalamycin resistance culture medium screens, picking positive colony, cultivate
Rear a small amount of extracts plasmid, and after PCR and double digestion Preliminary Identification, positive colony is identified in order-checking further.Order-checking is correct
The named pET-28a-ToxR of plasmid.
The recombinant expression carrier pET-28a-ToxR built identifies through PCR and BamH I and XholI double digestion.PCR primer
Being about the amplified band of about 507bp seen from 1% agarose gel electrophoresis result, its size is consistent (Fig. 3) with expection.
Double digestion result shows consistent with the nucleic acid fragment of expection size, it was demonstrated that recombinant expression carrier successfully constructs (Fig. 4).
Positive colony send Nanjing Genscript Biotechnology Co., Ltd. to check order, and sequencing result shows with intended sequence homology and is
99%.
5. the expression of recombinant protein and qualification
PET-28a-ToxR Plastid transformation e. coli bl21 (DE3) competent cell (the Hangzhou treasured match biology that will identify
Science and Technology Ltd. grants), picking list bacterium colony is put in the 3mL LB fluid nutrient medium containing Kan 50 μ g/mL, 37 DEG C 160
R/min shaken overnight is cultivated.Contain the LB culture medium of Kan 50 μ g/mL by 1% (V/V) inoculum concentration switching 10mL after activation,
Cultivate to bacterium solution OD for 37 DEG C600When being 0.8, adding 0.5mM IPTG and carry out abduction delivering in 37 DEG C, SDS-PAGE detects
Whether target protein expresses (Fig. 5).
6. protein purification
Inoculation to 5ml LB culture medium will be transferred in the culture medium containing 1L LB liquid after 37 DEG C of activated overnight,
Treat that OD to about 0.8 adds final concentration of 0.5mM IPTG and overnight induces in 37 DEG C；In 4 DEG C of centrifugal bacterium collecting induction
Body, the thalline PBS of 100ml 10mM pH7.4 suspends, and after ultrasonic disruption, is centrifuged 15min in 12000rpm, receives
Collection supernatant.Under the conditions of 4 DEG C, 40ml crude protein sample is combined 4h with 10ml NTA-Ni, is stirred continuously therebetween, in conjunction with 4h
Rear elute foreign protein with 100ml containing 0mM, 50mM imidazole salts respectively, with being dissolved in the 500mM of 10mM PBS (pH7.4)
Destination protein is eluted from NTA-Ni by imidazole salts buffer solution, the protein sample not sodium chloride-containing of 10mM pH7.4
PB buffer solution dialyse 3 times, PEG8000 is concentrated into debita spissitudo, purified product pass through SDS-PAGE electrophoresis detection.
The target protein ToxR expressed28-534It is about 29KDa, consistent, as shown in Figure 5 with expection molecular weight of albumen.
Prepared by embodiment 2:ToxR polyclonal antibody
1. choose new zealand white rabbit 3 (being purchased from Zhejiang University's animal center), by immunity White Rabbit preparation for
toxR28-534The polyclonal antibody of albumen.The syringe of immunity for the first time draws 1ml Freund's complete adjuvant (CFA) emulsification
200 μ g/ml purify ToxR28-534Albumen 1ml, uses the immunity of subcutaneous many Dot ELISAs.After the most immune 2 weeks, anti-
Former consumption ibid adds Freund's incomplete adjuvant (IFA) and carries out second time immunity.After immunity 2 weeks, antigen consumption ibid adds not exclusively assistant
Agent carries out third time immunity.Three immunity take blood after 1 week, collect serum, detect antibody titer, record numerical value.
2.ToxR polyclonal antibody titration
ToxR28-534Polyclonal antibody titration uses indirect elisa method.With being coated the recombinant protein that liquid dilution purifies
ToxR28-534Antigen, to whole mass concentration 10 μ g/ml, is coated elisa plate (IWAKI, Japan), every hole 100 μ l, 4 DEG C
It is coated overnight, washing, pat dry.Add confining liquid (3%BSA) sealase yoke plate, every hole 250 μ l next day, incubate for 37 DEG C
Educate 2h, washing, pat dry.With PBS, rabbit anteserum doubling dilution from 1:100 is become variable concentrations, until being diluted to
1:204800, every hole adds 100 μ l, hatches 1h for 37 DEG C, washing, pats dry.Every hole adds 1:10000 and dilutes goat-anti
Rabbit-HRP antibody 100 μ l, hatches 1h for 37 DEG C, washing, pats dry.Every hole adds o-phenylenediamine (O-phenydiamino, OPD)
And H2O2Substrate solution 100 μ l, normal temperature lucifuge colour developing 20min, add 2mol/L H2SO450 μ l terminate reaction, use
ELIASA measures OD450Value.Each sample is 3 parallel holes, sets negative control simultaneously.
Calculate OD450Testing result, the minimum extension rate corresponding to P/N value >=2.1 is exactly the antibody titer of this antibody,
So ToxR28-534The titer of antibody is 1:51200 (table 1).
Table 1 ToxR28-534Antibody titer measures
3.ToxR28-534Polyclonal antibody western blot is analyzed
BCA protein quantification kit (Tian Gen biotech firm) is used to measure each protein sample concentration.The restructuring that first will purify
ToxR28-534Albumen is transferred on PVDF membrane (pvdf membrane) from 12%SDS-PAGE glue, confining liquid
(PBST+5% skim milk) is closed overnight；Subsequently with ToxR28-534Many anti-(1:500 dilution) room temperature reaction 2h, eluent
PBST washes film 3 times；Add the mouse-anti rabbit two anti-(1:3000 dilutes, SIGMA) of the HRP mark using PBST dilution, room
Temperature reaction 1.5h, eluent washes film 3 times；Last pvdf membrane is placed in the nitrite ion containing DAB and develops the color to band clearly,
Film is put into color development stopping reaction (Fig. 6) in distilled water.
Embodiment 3: the preparation of antibody-coupled magnetic beads
1. antibody pre-treatment
Utilize saturated ammonium sulfate method to precipitate 6ml immune serum, be dissolved in 0.01M pH 7.4 PBS, dialyzed overnight, middle
Change liquid 5 times.A280Preliminary Quantitative Western concentration, adjusting concentration with 0.01M PBS is 1mg/ml.
2. the coupling of amino magnetic bead microballoon resists more
Take the 1.5 μm amino-magnetic microballoons (Xin Hai east, Xiamen bio tech ltd) of 200 μ l 5%, add 1ml
Pure water, vibration mixing, magnetic frame separation microballoon, remove supernatant.Repeated washing is once.The microballoon that will have washed, with friendship
Connection buffer solution (10mM PBS, pH 7.4) is diluted to 1ml, adds 20 μ l crosslinking agents (25% glutaraldehyde water solution), room temperature
Shake activation 1h.Magnetic frame separates the microballoon activated, and removes supernatant；Wash with mark buffer solution (15mM PB, pH 7.4)
Wash 2 times, be resuspended in 1ml mark buffer solution；The ToxR of 80 μ l 1mg/ml is added after shaking up28-534Protein antibodies, room
Temperature shake crosslinking 2h.Adding 50 μ l20%BSA after crosslinking, 0.5h is closed in shake.Magnetic frame separation microballoon is also removed
Clearly, mark buffer solution 2 times, add 200 μ l 0.01M PBS, 4 DEG C save backup.
Embodiment 4: the preparation of Antibody DNA conjugate
1. resist and biotin coupling more
Take 1ml 1mg/ml ToxR28-534Resist more, add 10 μ lN-HOSu NHS biotin (BNHS, SIGMA)
Storing liquid, 1h is hatched in room temperature shake.PH 7.4 PBS product, dialysis time 24h, period changes liquid 5 times, fills
Divide and remove unconjugated BNHS.Biotin-conjugated antibodies 4 DEG C saves backup.
2. the how anti-Streptavidin of biotinylation-biotinylated DNA compound coupling
Report according to existing document, choose and can stably carry out the 529bp toxoplasma cdna fragment of LAMP amplification as target
DNA, primer sequence: F (SEQ ID NO:5): 5 '-CTGCAGGGAGGAAGACGAAA-3 '；R(SEQ
ID NO:6): 5 '-CTGCAGACACAGTGCATCTG-3 ', wherein 5 ' end mark biotin, auspicious by Shanghai Ji
Company synthesizes.According to the molecule mol ratio of 1: 1: 1, affine with strepto-again after first many for biotinylation anti-and DNA being mixed
Element mixing, reaction is overnight.Compound 4 DEG C saves backup.
Embodiment 5: the immunomagnetic beads ring mediated isothermal amplification method detection vibrio parahemolyticus of Antibody DNA conjugate
1. the VP bacterium solution of overnight incubation, from 108CFU/ml physiological saline 10 is diluted to about 10 again3CFU/ml is standby.Take
Magnetic bead antibody coupling matter 200ul, adds 108-103The reverse mixing of CFU/ml 1ml bacterium solution, room temperature shake combines 2h, magnetic force
Frame separation magnetic bead-thalline, 1ml 0.01M PBS washs 3 times, 300ul 0.01M PBS Eddy diffusion.
2. taking antibody-Streptavidin-DNA conjugate 40ul, join in 300ul magnetic bead-thalline, room temperature shake combines 1h,
1ml 0.01M PBS washs 3 times, 100ul 0.01M PBS Eddy diffusion magnetic bead-phage-antibody-Streptavidin-DNA
Conjugate.
3. take magnetic bead-phage-antibody-Streptavidin-DNA conjugate 1ul, as template.Lamp primer sequence is as follows:
F3:ACGAGAGTCGGAGAGGGA (SEQ ID NO:7)；
B3:TGGATTCCTCTCCTACGCCT (SEQ ID NO:8)；
FIP:GGATCGCATTCCGGTGTCTCTTAAGATGTTTCCGGCTTGGC (SEQ ID NO:
9)；
BIP:GACGACGCTTTCCTCGTGGTCAAGTCTCCGACTCTGTCT (SEQ ID NO:
10)。
Amplification system is as follows: 10 × Thermopol buffer 2 μ l；10mM dNTP 4μl；2.5 μMs of each 1 μ l of F3/B3 primer；
20 μMs of each 1 μ l of FIP/BIP primer；5M Betine 2μl；25mM MgCl24μl；Bst archaeal dna polymerase 1 μ l；DNA mould
Plate 1 μ l；Rnase-free water adds to 20 μ l, flicks mixing.It is placed in 65 DEG C and hatches 60min, finally terminate in 80 DEG C of 2min
Reaction.After reaction terminates, take 5 μ l product electrophoresis on 2% Ago-Gel, see under gel imaging system after EB dyeing
Examine result.Electrophoresis picture display Lamp characteristic scalariform band, result is positive；As being cloudy without any band then result
Property (Fig. 7).25 μ l products add 1ul SYBR Green I, observed result, and reactant liquor virescence is positive, yellow reaction
For negative (Fig. 8).
Embodiment 6: specific contrast experiment
Use immunomagnetic beads ring mediated isothermal amplification method detection VP, Escherichia coli, the gold of Antibody DNA conjugate of the present invention
Staphylococcus aureus, salmonella and Bacillus cereus strain, each bacterial strain is all with 108CFU/ml bacteria concentration, result is such as
Fig. 9, shown in 10.From this contrast experiment it can be seen that Lamp signature band occurs in vibrio parahemolyticus, Lamp reacts
Product adds SYBR Green I, reactant liquor be green be that VP is positive；And 4 strain comparison bacterium have no Lamp characteristic scalariform bar
Band, Lamp product adds SYBR Green I, reactant liquor be yellow reaction be that VP is negative.
Embodiment 7: actual sample Detection results
Marine and aquatic product 80 parts is collected in supermarket, Hangzhou and the market of farm produce, even by National Standard Method and antibody-DNA of the present invention respectively
The immunomagnetic beads ring mediated isothermal amplification method of connection thing detects, and adds up positive coincidence rate.National Standard Method detection method reference
GB/4789.7-2013, prepares through sample, increases bacterium, separates, pure culture, preliminary biochemical identification and determine qualification.
Collect marine and aquatic product 80 parts, detected by the immunomagnetic beads ring mediated isothermal amplification method of Antibody DNA conjugate, and
Compare with National Standard Method.The wherein immunomagnetic beads ring mediated isothermal amplification method detection parahemolyticas of Antibody DNA conjugate
The vibrios positive is 27 parts, National Standard Method 25 parts of positives of detection, no difference of science of statistics, and therefore its testing result is consistent, credible,
But substantially reduce the detection time.
National Standard Method detects that positive is 25 parts, and positive rate is 31.25%；The immunomagnetic beads ring of Antibody DNA conjugate
Mediated isothermality amplification method detects positive 27 parts, and positive rate is 33.75%.National Standard Method and Antibody DNA conjugate
Immunomagnetic beads ring mediated isothermal amplification method is without significant difference.
The immunomagnetic beads ring mediated isothermal amplification method of table 2 actual sample Antibody DNA conjugate and GB testing result
The above embodiment of the present invention is the description of the invention and cannot be used for limiting the present invention, wants with the right of the present invention
Ask any change in the implication and scope that book is suitable, be all considered as being included within the scope of the claims.
Sequence table:
SEQ ID NO:1:
ATGCTTGCTCAAAGGTTTACCTTTGATCCAAATAGTAATTCGCTCGCTGACCAACA
AAGCGGCAACGAAGTTGTACGATTAGGAAGCAACGAAAGCCGTATACTCCTGATG
TTGGCGGAGAGACCAAACGAAGTTTTAACCCGTAACGAGCTTCACGAGTTTGTTT
GGCGTGAGCAAGGTTTTGAGGTGGATGACTCAAGCCTGACTCAAGCGATTTCTAC
TCTGCGTAAGATGTTGAAGGATTCAACCAAATCTCCAGAGTTTGTTAAAACCGTTC
CAAAACGAGGCTATCAACTCATTTGTACTGTTGAACGCCTAAGCCCACTTTCTTCA
GACTCAAGCTCAATTGAAGTTGAAGAGCCAGCTTCTGATAACAATGACGCCTCTG
CTAATGAGGTAGAAACGATCGTAGAGCCGTCTTTGGCGACGCCTTCTGACGCAATC
GTTGAACCAGAAGCGCCAGTAGTACCTGAAAAAGCACCTGTGGCTTCTGCTGTGA
ATCCATGG
SEQ ID NO:2:
CTGCAGGGAGGAAGACGAAAGTTGTTTTTTTATTTTTTTTTCTTTTTGTTTTTCTGA
TTTTTGTTTTTTTTGACTCCGGCCCAGCTGCGTCTGTCGGGATGAGACCGCGGAGC
CGAAGTGCGTTTTCTTTTTTTGACTTTTTTTTGTTTTTTCACAGGCAAGCTCGCCTG
GGCTTGGTGCCACAGAAGGGACAGAAGTCGAAGGGGACTACAGACGCGATGCCG
CTCCTCCAGCCGTCTTGGAGGAGAGAAATCCGGACTGTAGATGAAGGCGAGGGTG
AGGATGAGGGGGTGGCGTGGTTGGGAAGCGACGAGAGTCGGAGAGGGAGAAGAT
GTTTCCGGCTTGGCTGCTTTTCCTGGAGGGTGGAAAAAGAGACACCGGAATGCGA
TCCAGACGAGACGACGCTTTCCTCGTGGTGATGGCGGAGAGAATTGAAGAGTGGA
GAAGAGGGCGAGGGAGACAGAGTCGGAGACTTGGACGAAGGGAGGAGGAGGCG
TAGGAGAGGAATCCAGATGCACTGTGTCTGCAG
SEQ ID NO:3:
CGCGGATCCATGCTTGCTCAAAGGTTTACC
SEQ ID NO:4:
CCGCTCGAGCCATGGATTCACAGCAGAAG
SEQ ID NO:5:
CTGCAGGGAGGAAGACGAAA
SEQ ID NO:6:
CTGCAGACACAGTGCATCTG
SEQ ID NO:7:
ACGAGAGTCGGAGAGGGA
SEQ ID NO:8:
TGGATTCCTCTCCTACGCCT
SEQ ID NO:9:
GGATCGCATTCCGGTGTCTCTTAAGATGTTTCCGGCTTGGC
SEQ ID NO:10:
GACGACGCTTTCCTCGTGGTCAAGTCTCCGACTCTGTCT
Claims (10)
1. the method that an immunomagnetic beads ring mediated isothermal amplification method quickly detects vibrio parahemolyticus, it is characterised in that include
Following steps:
S1: with vibrio parahemolyticus as template, clones Vp species specificity toxR28-534Gene, prokaryotic expression and purify across
Film transcriptional regulation protein toxR28-534；
S2: prepared for toxR by immunity White Rabbit28-534The polyclonal antibody of albumen；
S3: by the toxR of preparation28-534Protein polyclone antibody and amino magnetic bead microballoon coupling, prepare the magnetic bead of antibody coupling；
S4: needed for utilizing bioinformatics method Prof. Du Yucang biotin labeled target DNA and the detection of LAMP method
Primer sequence, by polyclonal antibody and the biotin coupling of preparation, then utilizes the anti-of Streptavidin couple biotin
Body and biotin labeled target DNA, prepare Antibody DNA conjugate；
S5: take liquid to be measured, mixes with the magnetic bead of antibody coupling, uses magnetic frame separation magnetic after target antigen fully combines
Pearl-thalline, the magnetic bead of separation is resuspended to be mixed with Antibody DNA conjugate afterwards, makes fully to combine, then with the magnetic bead obtained
-phage-antibody-DNA conjugate is template, uses vibrio parahemolyticus in LAMP method augmentation detection liquid to be measured.
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: in described step S1, vibrio parahemolyticus is vibrio parahemolyticus reference culture ATCC 17802.
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: in described step S1, Vp species specificity toxR gene is for removing signal peptide sequence and portion of cross-film district
ToxR genetic fragment ToxR divided28-534, its base sequence is as shown in SEQ ID NO:1.
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: in described step S1 the expression vector of prokaryotic expression be pET-28a (+).
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: described step S3 is pressed when polyclonal antibody and amino magnetic bead microballoon coupling the volume ratio of 1: 2.5
Mixing.
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: in described step S4, target DNA is toxoplasma cdna fragment, its base sequence such as SEQ ID NO:
Shown in 2.
The method that immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects vibrio parahemolyticus,
It is characterized in that: in described step S4, the primer sequence needed for the detection of LAMP method is specific as follows: F3 such as SEQ ID NO:7
Shown in, B3 is as shown in SEQ ID NO:8, and FIP is as shown in SEQ ID NO:9, and BIP is as shown in SEQ ID NO:10.
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: in described step S4, polyclonal antibody is mixed by the volume ratio of 100: 1 with biotin, biotin
Change antibody, Streptavidin, biotin labeled target DNA press the mixed in molar ratio of 1: 1: 1.
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: in described step S5, liquid to be measured is 5: 1 with the mixed volume proportioning of antibody-coupled magnetic beads.
Immunomagnetic beads ring mediated isothermal amplification method the most according to claim 1 quickly detects the side of vibrio parahemolyticus
Method, it is characterised in that: the mixed volume proportioning that in described step S5, resuspended magnetic bead mixes with Antibody DNA conjugate is
7.5∶1。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610134920.1A CN105755118B (en) | 2016-03-10 | 2016-03-10 | Method for rapidly detecting vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610134920.1A CN105755118B (en) | 2016-03-10 | 2016-03-10 | Method for rapidly detecting vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105755118A true CN105755118A (en) | 2016-07-13 |
| CN105755118B CN105755118B (en) | 2020-01-21 |
Family
ID=56332919
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610134920.1A Expired - Fee Related CN105755118B (en) | 2016-03-10 | 2016-03-10 | Method for rapidly detecting vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105755118B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755411A (en) * | 2016-12-23 | 2017-05-31 | 广西大学 | The real-time fluorescence quantitative PCR quick detection primer and its kit of marine product vibrio parahemolyticus toxR genes |
| CN110229918A (en) * | 2019-06-18 | 2019-09-13 | 暨南大学 | A kind of method and its kit of quick detection Staphylococcus aureus in food |
| US10481158B2 (en) | 2015-06-01 | 2019-11-19 | California Institute Of Technology | Compositions and methods for screening T cells with antigens for specific populations |
| CN112280878A (en) * | 2020-11-17 | 2021-01-29 | 南京农业大学 | Specific target spot, primer, detection method and application for detecting vibrio parahaemolyticus |
| CN116640830A (en) * | 2023-05-04 | 2023-08-25 | 河北国高生物科技有限公司 | immuno-PCR working solution and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586452A (en) * | 2012-03-12 | 2012-07-18 | 上海海洋大学 | Vibrio parahemolyticus detection kit and detection method thereof |
| CN105242037A (en) * | 2015-09-09 | 2016-01-13 | 上海市疾病预防控制中心 | Preparation method and application of immunomagnetic beads for enriching TDH pathogenic vibrio parahaemolyticus |
-
2016
- 2016-03-10 CN CN201610134920.1A patent/CN105755118B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102586452A (en) * | 2012-03-12 | 2012-07-18 | 上海海洋大学 | Vibrio parahemolyticus detection kit and detection method thereof |
| CN105242037A (en) * | 2015-09-09 | 2016-01-13 | 上海市疾病预防控制中心 | Preparation method and application of immunomagnetic beads for enriching TDH pathogenic vibrio parahaemolyticus |
Non-Patent Citations (2)
| Title |
|---|
| QING-MINGKONG ET AL.: "Loop-mediated isothermal amplification(LAMP):Early detection of Toxoplasmagondii infectionin Mice", 《PARASITES&VECTORS》 * |
| 丁金凤等: "《基因分析和生物芯片技术》", 31 December 2004 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10481158B2 (en) | 2015-06-01 | 2019-11-19 | California Institute Of Technology | Compositions and methods for screening T cells with antigens for specific populations |
| CN106755411A (en) * | 2016-12-23 | 2017-05-31 | 广西大学 | The real-time fluorescence quantitative PCR quick detection primer and its kit of marine product vibrio parahemolyticus toxR genes |
| CN110229918A (en) * | 2019-06-18 | 2019-09-13 | 暨南大学 | A kind of method and its kit of quick detection Staphylococcus aureus in food |
| CN112280878A (en) * | 2020-11-17 | 2021-01-29 | 南京农业大学 | Specific target spot, primer, detection method and application for detecting vibrio parahaemolyticus |
| CN112280878B (en) * | 2020-11-17 | 2023-01-31 | 南京农业大学 | Specific target spot, primer, detection method and application for detecting vibrio parahaemolyticus |
| CN116640830A (en) * | 2023-05-04 | 2023-08-25 | 河北国高生物科技有限公司 | immuno-PCR working solution and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105755118B (en) | 2020-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sohrabi et al. | State of the art: Lateral flow assays toward the point‐of‐care foodborne pathogenic bacteria detection in food samples | |
| CN105755118A (en) | Method for quickly detecting vibrio parahaemolyticus by aid of immunomagnetic beads and loop-mediated isothermal amplification processes | |
| Wu et al. | A sensitive aptasensor for the detection of Vibrio parahaemolyticus | |
| CN105445473B (en) | A kind of Brucella abortus ELISA detection kit | |
| Zhai et al. | Development of a real-time nucleic acid sequence–based amplification assay for the rapid detection of Salmonella spp. from food | |
| TW201300421A (en) | Reagents and methods for PRRSV detection | |
| Zhou et al. | Portable dual-aptamer microfluidic chip biosensor for Bacillus cereus based on aptamer tailoring and dumbbell-shaped probes | |
| CN105755124A (en) | Method for detecting salmonella with fluorescence method on basis of enzymatic remediation isothermal cycle amplification | |
| Mazzega et al. | In vitro isolation of nanobodies for selective Alexandrium minutum recognition: a model for convenient development of dedicated immuno-reagents to study and diagnostic toxic unicellular algae | |
| Jirapattharasate et al. | Development and evaluation of recombinant GRA8 protein for the serodiagnosis of Toxoplasma gondii infection in goats | |
| CN110016078B (en) | Blocking ELISA detection method based on PEDV N protein specific nano antibody and application thereof | |
| Gessler et al. | Sensitive detection of botulinum neurotoxin types C and D with an immunoaffinity chromatographic column test | |
| CN111560341B (en) | Generic inert vector escherichia coli and potential application thereof | |
| Liao et al. | Enhanced sandwich immunoassay based on bivalent nanobody as an efficient immobilization approach for foodborne pathogens detection | |
| CN114152748A (en) | Double-antibody sandwich ELISA diagnostic kit for detecting African swine fever virus and method thereof | |
| CN101367870A (en) | Bovine rotavirus recombinant VP6 protein antigen and method of preparing the same | |
| Bannantine et al. | Monoclonal antibodies bind a SNP-sensitive epitope that is present uniquely in Mycobacterium avium subspecies paratuberculosis | |
| Zhang et al. | Analysis of agglutinants elicited by antiserum of channel catfish immunized with extracellular proteins of virulent Aeromonas hydrophila | |
| CN108982847B (en) | Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis | |
| CN107664694B (en) | A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody | |
| CN104678097A (en) | Mycobacterium tuberculosis combined antigen for diagnosing pulmonary tuberculosis | |
| CN112175958B (en) | Optimized aptamer sequence for specifically recognizing Listeria monocytogenes and application thereof | |
| CN101805723A (en) | Anti-glutamate dehydrogenase protein monoclonal antibody, preparation method thereof and use thereof | |
| CN107488718A (en) | Detect C60Nanoparticles generate the method and device influenceed to Microcystin | |
| CN107085103A (en) | A kind of antibodies toward salmonella latex agglutination detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200121 |