CN105755118B

CN105755118B - Method for rapidly detecting vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method

Info

Publication number: CN105755118B
Application number: CN201610134920.1A
Authority: CN
Inventors: 刘涛; 陈健; 斯国静; 俞骅; 楼秀芹; 张蔚
Original assignee: HANGZHOU CENTER FOR DISEASE CONTROL AND PREVENTION
Current assignee: HANGZHOU CENTER FOR DISEASE CONTROL AND PREVENTION
Priority date: 2016-03-10
Filing date: 2016-03-10
Publication date: 2020-01-21
Anticipated expiration: 2036-03-10
Also published as: CN105755118A

Abstract

The invention provides a method for rapidly detecting vibrio parahaemolyticus by an immunomagnetic bead loop-mediated isothermal amplification method, which comprises the following steps: cloning Vp species specificity toxR by taking vibrio parahaemolyticus as template_28‑534Gene, prokaryotic expression and purification; preparation for toxR_28‑534Polyclonal antibodies to the protein; coupling the polyclonal antibody with amino magnetic bead microspheres; synthesizing biotin-labeled target DNA and detecting a required primer by an LAMP method, and preparing an antibody-DNA conjugate by using a streptavidin coupled antibody and the target DNA; and (3) mixing the solution to be detected with magnetic beads coupled with antibodies, separating the magnetic beads from the thalli by using a magnetic frame, mixing the magnetic beads with the antibody-DNA conjugate after resuspension, and then carrying out amplification detection by using the LAMP method by using the magnetic beads-thalli-antibody-DNA conjugate as a template. The invention provides a method for capturing specific protein molecules by an immunomagnetic bead technology, and then amplifying and detecting the specific protein molecules, thereby shortening the detection time and facilitating field operation.

Description

Method for rapidly detecting vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method

Technical Field

The invention relates to the technical field of microbial detection, in particular to a method for rapidly detecting vibrio parahaemolyticus by an immunomagnetic bead loop-mediated isothermal amplification method of an antibody-DNA conjugate.

Background

Vibrio parahaemolyticus (Vp) is a gram-negative Vibrio halophilus, widely distributed in ports, sea coasts, sea river junctions, and the like, and causes acute gastroenteritis in humans and acute diarrhea, wound infection and septicemia in travelers mainly through polluted marine products. In recent years, the population for eating seafood is continuously expanding, and more people are pursuing some seafood stabbing. The national food-borne disease monitoring network data shows that the pathogenic distribution of the microbial food poisoning in China is remarkably changed, particularly the food poisoning caused by vibrio parahaemolyticus in coastal provinces and the population exposure scale show a remarkable rising trend, and the microbial food poisoning is the top in the country. The vibrio parahaemolyticus can also infect various aquatic animals such as fish, shrimp, crab and crustacean, and is unfavorable for the breeding industry. At present, the American and European Union have mandatory requirements on the detection of vibrio parahaemolyticus on imported aquatic products, and the detection result is negative and can be passed through.

The pathogenic mechanism of vibrio parahaemolyticus is complex, and the pathogenic factors comprise hemolytic toxin, urease, adhesion factors and invasiveness. The transmembrane transcription regulatory protein toxR of vibrio parahaemolyticus participates in regulating and controlling the expression of main virulence genes and outer membrane proteins, is coded by the toxR gene, is a good molecular target for identification among species of vibriaceae, and can detect the vibrio parahaemolyticus at the species level.

The breeding speed of the vibrio parahaemolyticus is high, particularly in 5-8 months per year, a large-area bacterial food poisoning event is easily caused, and the quick detection technology of Vp is particularly important. At present, the traditional detection means of vibrio parahaemolyticus in China mainly adopts a microbial culture method, the whole process is probably required to be 5-8 days, the operation is complicated and time-consuming, and the requirements of people on the rapidness, simplicity and convenience of food safety detection cannot be met. Therefore, the development of a rapid and simple detection means with higher sensitivity and stronger specificity is urgently needed to monitor the food-borne pathogenic bacteria so as to ensure the food safety of people.

The development of detection methods is promoted by the continuous progress of technology, and more methods are used for rapidly detecting vibrio parahaemolyticus at present, such as PCR technology, enzyme-linked immunosorbent assay (ELISA), Real-time fluorescent quantitative PCR (FQ-PCR) and Loop-mediated isothermal amplification (LAMP).

The PCR technology can amplify a detection target in a short time through specific amplification and has the characteristic of high sensitivity, but the requirement of the PCR detection operation process is high and false positive is easy to occur. The ELISA method utilizes the specific combination of antigen-antibody to detect pathogenic bacteria, has lower requirements on equipment, but has lower sensitivity and is not widely applied to food safety microorganism detection. FQ-PCR enables qualitative detection and quantitative analysis of target molecules, but is expensive in terms of reagent and instrument costs. In addition, the above detection methods all require skilled operation skills and a certain professional level, so that expensive instruments and equipment, high detection cost and strict technical requirements limit the on-site rapid detection and basic popularization of the technologies.

Loop-mediated isothermal amplification (LAMP), which is a nucleic acid isothermal amplification technology established by Notomi and the like of Japanese scholars in 2000, designs 4 specific primers aiming at 6 regions of a target gene, enables LAMP reaction to have extremely high amplification specificity, utilizes a strand displacement DNA polymerase (Bst DNA polymerase) to carry out heat preservation for about 60min under an isothermal condition (about 65 ℃) to complete target gene amplification reaction, overcomes the defect that a single-stranded template needs to be obtained by repeated thermal denaturation in PCR reaction, avoids the time-consuming process of repeated temperature rise and fall, has the characteristics of simplicity, rapidness, strong specificity and high sensitivity, does not need a PCR instrument and expensive reagents in the LAMP reaction, and is beneficial to application in some basic level mechanisms and field detection.

The LAMP technology as a novel rapid detection technology has the characteristics of short time consumption, low cost, high sensitivity, high specificity and the like, is easy to popularize in some basic institutions, is particularly suitable for rapid detection on site, and has extremely wide application prospect. However, in the practical use process, the LAMP method is found to have some defects in the detection of the vibrio parahaemolyticus. First, like most detection methods, the LAMP method first requires selective enrichment culture. This step usually takes a day, and is not conducive to on-site testing of the sample, or may introduce new contamination. Secondly, although the LAMP method for detecting the vibrio parahaemolyticus is rapid, sensitive and simple, the sample to be detected can be polluted by Vp in the enrichment culture process or during DNA extraction, or pollutants with high homology with a target DNA sequence exist in the sample to be detected, so that false positive is caused.

Disclosure of Invention

According to the invention, based on the fact that bacteria are often single-copy genomes, if DNA is used for detection, Vp obtained on site is possibly too little to detect the DNA, but expression products of bacterial genes, such as protein, are multi-copy and can be several, dozens or hundreds of thousands of copies, and specific protein molecules are captured by an immunomagnetic bead technology and then amplified for detection, so that the link of enrichment culture is avoided, the detection time is shortened, and the site operation is facilitated; and secondly, detecting by artificially synthesized target DNA to reduce the false positive rate detected by the LAMP method.

The main idea of the immunomagnetic bead loop-mediated isothermal amplification method for rapidly detecting the vibrio parahaemolyticus of the antibody-DNA conjugate provided by the invention is as follows: firstly, preparing a target protein antigen specific to vibrio parahaemolyticus: transmembrane transcriptional regulator protein toxR; preparing an antibody against toxR; coating the surface of the immunomagnetic beads with a specific antibody, and preparing antibody-coupled magnetic beads so as to capture a target protein of vibrio parahaemolyticus in a sample to be detected; preparing an antibody-artificially synthesized target DNA conjugate, and attaching the antibody-artificially synthesized target DNA conjugate; the LAMP reaction system is optimized for specific amplification so as to achieve the effect of amplifying the target, shorten the detection time and improve the detection specificity (as shown in figure 1).

The invention relates to a method for rapidly detecting vibrio parahaemolyticus (Vp) by an immunomagnetic bead loop-mediated isothermal amplification method, which specifically comprises the following steps:

s1: cloning Vp species specificity toxR by taking vibrio parahaemolyticus as template_28-534Gene, prokaryotic expression and purification of transmembrane transcriptional regulatory protein toxR_28-534；

S2: preparation against toxR by immunization of white rabbits_28-534Polyclonal antibodies to the protein;

s3: to be prepared toxR_28-534Coupling a protein polyclonal antibody with an amino magnetic bead microsphere to prepare an antibody coupled magnetic bead;

s4: artificially synthesizing biotin-labeled target DNA by using a bioinformatics method and detecting a required primer sequence by using an LAMP method, coupling the prepared polyclonal antibody with biotin, and then coupling biotinylated antibody and biotin-labeled target DNA by using streptavidin to prepare an antibody-DNA conjugate;

s5: mixing a liquid to be detected with magnetic beads coupled with antibodies, separating magnetic beads-thalli by using a magnetic frame after target antigens are fully combined, mixing the separated magnetic beads with antibody-DNA conjugates after the separated magnetic beads are resuspended so as to be fully combined, and then, amplifying and detecting vibrio parahaemolyticus in the liquid to be detected by using an LAMP method by using the obtained magnetic beads-thalli-antibody-DNA conjugates as templates.

The Vibrio parahaemolyticus in the step S1 is Vibrio parahaemolyticus standard strain ATCC 17802.

The Vp species specific toxR gene in the step S1 is a toxR gene segment toxR with a signal peptide sequence and a transmembrane region removed_28-534The base sequence is shown as SEQ ID NO: 1 is shown.

The expression vector for prokaryotic expression in step S1 was pET-28a (+).

In the step S3, the polyclonal antibody and the amino magnetic bead microspheres are mixed according to the ratio of 1: 2.5(V/V) when coupled.

In the step S4, the target DNA is a Toxoplasma gondii gene fragment, and the base sequence of the target DNA is shown as SEQ ID NO: 2, respectively.

The primer sequences required for LAMP detection in step S4 are specifically as follows: f3 is as set forth in SEQ ID NO: 7, B3 is as shown in SEQ ID NO: 8, FIP is shown as SEQ ID NO: 9, BIP is shown as SEQ ID NO: shown at 10.

In the step S4, the polyclonal antibody and the biotin are mixed according to the volume ratio of 100: 1, and the biotinylated antibody, the streptavidin and the biotin-labeled target DNA are mixed according to the molar ratio of 1: 1.

In the step S5, the mixing ratio of the solution to be detected to the antibody-coupled magnetic beads is 5: 1 (V/V).

In the step S5, the mixing ratio of the re-suspended magnetic beads to the antibody-DNA conjugate is 7.5: 1 (V/V).

Compared with the prior art, the invention has the following advantages and remarkable effects:

(1) the invention establishes a vibrio parahaemolyticus detection method by using the LAMP method of the antibody-DNA conjugate, has quicker, simpler and more convenient operation, lower detection cost, higher specificity and sensitivity, and provides a new development direction for the quick and accurate detection of vibrio parahaemolyticus;

(2) the research on detecting the vibrio parahaemolyticus by the immunomagnetic bead capture method shows that the immunomagnetic beads have certain specific capture and enrichment effects on the vibrio parahaemolyticus, have the characteristics of rapidness, specificity, high efficiency and simple operation, can be applied to the daily detection work in a laboratory, have certain specificity and sensitivity and have wide practical significance;

(3) the LAMP method of the antibody-DNA conjugate is used for detecting the vibrio parahaemolyticus, the required time is far shorter than that of the national standard method, the result has no obvious difference from the positive rate of the national standard method, and the LAMP method is stable and reliable, so that the detection time is greatly shortened, and the manpower and material resources are saved;

(4) the method has the advantages of low cost, strong specificity, high sensitivity and the like, and the detection result of the sample shows that the LAMP system of the antibody-DNA conjugate has good application value for detecting the vibrio parahaemolyticus in the sample.

Drawings

FIG. 1 is a schematic diagram showing the rapid detection of Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification of the antibody-DNA conjugate of the present invention.

FIG. 2 shows a diagram of the ToxR in example 1 of the present invention_28-534Gel electrophoresis of the PCR products of the gene fragments, wherein M is DNA standard molecular weight marker (DL 2000); 1: ToxR_28-534And (3) PCR products.

FIG. 3 is a PCR identification chart of the recombinant plasmid pET-28a-ToxR in example 1 of the present invention, wherein M: DNA standard molecular weight marker (DL 2000); 1-5: pET-28a-ToxR positive clones.

FIG. 4 is a diagram showing the double restriction enzyme identification of the recombinant plasmid pET-28a-ToxR in example 1 of the present invention, wherein M: DNA standard molecular weight marker (DL 2000); 1: pET-28a-ToxR double enzyme digestion fragment; 2: lambda-EcoT 14I digest DNAmarker.

FIG. 5 shows the present inventionToxR in inventive example 1_28-534SDS-PAGE of (1), wherein M: a Fermentas protein Marker; 1: the recombinant bacteria are not induced to express; 2: inducing and expressing the whole strain by the recombinant strain; 3: inducing and expressing the supernatant by the recombinant bacteria; 4: purified recombinant protein toxR_28-534。

FIG. 6 shows a diagram of ToxR in example 2 of the present invention_28-534Westblocking identification picture of protein multi-resistance, wherein M is Fermentas protein prestained Marker; 1:2ug ToxR_28-534(ii) a 2, negative control.

FIG. 7 is a chart showing the LAMP electrophoresis detection result of Vibrio parahaemolyticus in example 5 of the present invention, in which M: DL2000, 1:10⁸CFU/ml 2:10⁷CFU/ml 3:10⁶CFU/ml 4:10⁵CFU/ml 5:10⁴CFU/ml 6:10³CFU/ml 7: and (5) negative control.

FIG. 8 shows the LAMP detection color development results of Vibrio parahaemolyticus in example 5 of the present invention, wherein the ratio is 1:10⁸CFU/ml 2:10⁷CFU/ml 3:10⁶CFU/ml 4:10⁵CFU/ml 5:10⁴CFU/ml 6:10³CFU/ml 7: and (5) negative control.

FIG. 9 is a diagram showing the result of LAMP electrophoresis detection in the specificity test in example 6 of the present invention, in which 1 to 5 are VP, Escherichia coli, Staphylococcus aureus, Salmonella, and Bacillus cereus strains, respectively.

FIG. 10 shows the LAMP detection color development results of the specificity experiment in example 6 of the present invention, wherein 1 to 5 are VP, Escherichia coli, Staphylococcus aureus, Salmonella, and Bacillus cereus strains, respectively.

Detailed Description

The present invention is further described in detail below with reference to examples so that those skilled in the art can better understand the present invention and can practice the present invention, but the examples are not intended to limit the present invention.

Example 1: obtaining of specific target protein toxR of vibrio parahaemolyticus

1. Cultivation of bacterial species

A Vibrio parahaemolyticus standard strain ATCC 17802 (purchased from Guangdong Huaqiao microbiological science Co., Ltd.) was picked from the slant and inoculated in a liquid medium (3% sodium chloride alkali peptone water) and cultured at 37 ℃ for 16 hours. Then 10. mu.l of fresh 3% sodium chloride alkali peptone water culture solution was transferred and cultured at 37 ℃ for 16 h.

2. Primer design

The ToxR protein is a transmembrane transcription activator of Vibrio parahaemolyticus, and is based on a gene fragment of ToxR in which a signal peptide sequence and a transmembrane region part of the ToxR protein are removed_28-534(the base sequence is shown as SEQ ID NO: 1, GenBank Accession number: AB029907.1) designing the specific upstream and downstream primers for amplification. The upstream primer sequence (SEQ ID NO: 3) is 5' -CGCGGATCCATGCTTGCTCAAAGGTTTACC-3', the sequence of the downstream primer (SEQ ID NO: 4) is 5' -CCGCTCGAGCCATGGATTCACAGCAGAAG-3', the underlined parts are the BamH I and Xhol I sites, respectively. The primers were synthesized by Shanghai bioengineering, Inc.

Amplification of ToxR Gene fragments

The culture supernatant of the vibrio parahaemolyticus was collected, and the vibrio parahaemolyticus DNA was extracted using a genome extraction kit (purchased from hangzhou baoise biotechnology limited). Using vibrio parahaemolyticus DNA as a template, and using a ToxR gene specific primer and 2 XSuperpfu mix high fidelity PCR amplification enzyme (purchased from Hangzhou Bausch Biotechnology Co., Ltd.) to perform PCR amplification, wherein the reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30sec, annealing at 55 ℃ for 30sec, and extension at 68 ℃ for 30sec, 32 cycles; final extension at 72 deg.C for 10min, and storage at 4 deg.C. Identification of purified toxR by 1% agarose gel electrophoresis_28-534Gene PCR products. The results of the electrophoretic detection after amplification are shown in FIG. 2.

4. Construction of recombinant plasmid

Recovery of the glue by toxR_28-534The gene fragment and an expression vector pET-28a (+) (Novagen) are respectively subjected to double enzyme digestion by BamH I and Xhol I, T4 ligase is subjected to overnight connection after enzyme digestion products are recovered, the ligation products are transformed into E.coli DH5a (provided by Hangzhou Bausch Biotechnology Co., Ltd.), screening is carried out on a kanamycin-resistant culture medium, positive clones are selected, plasmids are extracted in small quantity after culture, and the positive clones are further sequenced and identified after PCR and double enzyme digestion preliminary identification. The plasmid with the correct sequencing was designated as pET-28 a-ToxR.

The constructed recombinant expression vector pET-28a-ToxR is identified by PCR and double enzyme digestion of BamH I and XholI. As a result of 1% agarose gel electrophoresis of the PCR product, an amplified band of about 507bp was observed, and the size was consistent with that expected (FIG. 3). The double digestion result shows that the DNA fragment is consistent with the nucleic acid fragment with the expected size, and the construction of the recombinant expression vector is proved to be successful (FIG. 4). The positive clone was sequenced by Nanjing Kingsrey Biotech, Inc., and the sequencing result showed 99% homology with the expected sequence.

5. Expression and characterization of recombinant proteins

The identified pET-28a-ToxR plasmid was transformed into competent cells of Escherichia coli BL21(DE3) (donated by Hangzhou Bausch Biotech Co., Ltd.), and a single colony was picked up and cultured in 3mL of LB liquid medium containing Kan 50. mu.g/mL at 37 ℃ overnight with shaking at 160 r/min. After activation, the cells were inoculated into 10mL LB medium containing Kan 50. mu.g/mL in an inoculum size of 1% (V/V), and cultured at 37 ℃ until the OD of the cells was reached₆₀₀At 0.8, 0.5mM IPTG was added to induce expression at 37 ℃ and SDS-PAGE was performed to determine whether the target protein was expressed (FIG. 5).

6. Protein purification

Inoculating the strain into 5ml LB culture medium, activating overnight at 37 ℃, transferring into a culture medium containing 1L LB liquid, adding IPTG (0.5 mM final concentration) when OD reaches about 0.8, and inducing overnight at 37 ℃; the induced cells were collected by centrifugation at 4 ℃ and suspended in 100ml of 10mM PBS (pH7.4), disrupted by ultrasonication, and centrifuged at 12000rpm for 15min to collect the supernatant. Binding 40ml crude protein sample with 10ml NTA-Ni for 4h under stirring at 4 deg.C, eluting hetero-protein with 100ml 0mM, 50mM imidazolium salt after 4h binding, eluting target protein from NTA-Ni with 500mM imidazolium salt buffer solution dissolved in 10mM PBS (pH7.4), dialyzing protein sample with 10mM PB buffer solution containing no sodium chloride at pH7.4 for 3 times, concentrating PEG8000 to appropriate concentration, and detecting purified product by SDS-PAGE.

Expressed target protein ToxR_28-534Approximately 29KDa, consistent with the expected protein molecular weight, as shown in figure 5.

Example 2: preparation of ToxR polyclonal antibody

1. Selecting 3 New Zealand white rabbits (purchased from Zhejiang university)Animal center), prepared against toxR by immunizing white rabbit_28-534Polyclonal antibodies to the protein. First immunization 1ml Freund's complete adjuvant (CFA) emulsion 200. mu.g/ml purified ToxR was aspirated with syringe_28-5341ml of protein, and adopting subcutaneous multipoint immunization. 2 weeks after the first immunization, the antigen was used in the same manner as in the incomplete adjuvant (IFA) for the second immunization. After 2 weeks of immunization, the antigen was administered for a third immunization with the same amount of incomplete adjuvant. Blood was taken 1 week after three immunizations, serum was collected, antibody titer was measured, and numerical values were recorded.

Determination of the TixR polyclonal antibody titer

ToxR_28-534The polyclonal antibody titer is measured by indirect ELISA method. Dilution of the purified recombinant protein ToxR with the coating solution_28-534Antigen to a final mass concentration of 10. mu.g/ml, enzyme-linked plates (IWAKI, Japan) were coated with 100. mu.l of antigen per well at 4 ℃ overnight, washed and patted dry. Blocking plates were blocked the next day by adding blocking solution (3% BSA), incubated at 250. mu.l/well for 2h at 37 ℃, washed, and patted dry. Rabbit sera were washed from 1: diluting to different concentrations at 100 times ratio until the concentration is 1:204800, adding 100 μ l per well, incubating at 37 deg.C for 1h, washing, and patting dry. Add 1: 100 mu l of goat anti-rabbit-HRP antibody is diluted by 10000, incubated for 1h at 37 ℃, washed and patted dry. Adding O-phenylenediamine (OPD) and H to each hole₂O₂100 mul of substrate solution is developed for 20min at normal temperature in dark place, and 2mol/L H is added₂SO₄The reaction was stopped at 50. mu.l, and OD was measured with a microplate reader₄₅₀The value is obtained. Each sample was 3 parallel wells with negative controls.

Calculate OD₄₅₀The detection result shows that the minimum dilution multiple corresponding to the P/N value being more than or equal to 2.1 is the antibody titer of the antibody, so the toxR_28-534The titer of the antibody was 1:51200 (Table 1).

TABLE 1 ToxR_28-534Antibody titer determination

3.ToxR_28-534Polyclonal antibody Western blot analysis

Egg with BCAThe concentration of each protein sample was determined by a white quantitation kit (Tiangen Bio Inc.). Firstly, purified recombinant toxR is prepared_28-534Transferring the protein from 12% SDS-PAGE gel to polyvinylidene fluoride membrane (PVDF membrane), and sealing with a sealing solution (PBST + 5% skim milk) overnight; subsequently with toxR_28-534Performing reaction on the polyclonal antibody (diluted by 1: 500) at room temperature for 2h, and washing the membrane for 3 times by using eluent PBST; adding HRP-labeled mouse-anti-rabbit secondary antibody (diluted by 1:3000, SIGMA) diluted by PBST, reacting for 1.5h at room temperature, and washing the membrane for 3 times by using eluent; finally, the PVDF membrane is placed in a color development solution containing DAB for color development until the band is clear, and the membrane is placed in distilled water to stop the color development reaction (figure 6).

Example 3: preparation of antibody-coupled magnetic beads

1. Antibody pretreatment

6ml of immune serum was precipitated by the saturated ammonium sulfate method, dissolved in 0.01M PBS pH7.4, dialyzed overnight, and the medium was changed 5 times. A. the₂₈₀The protein concentration was initially quantified and adjusted to 1mg/ml with 0.01M PBS.

2. Amino magnetic bead microsphere coupled polyclonal antibody

200 μ l of 5% 1.5 μm amino magnetic microsphere (Xiamen Hainan Biotechnology Co., Ltd.) was added with 1ml of pure water, mixed by shaking, and the supernatant was removed by separating the microspheres with a magnetic holder. The washing was repeated once. The washed microspheres were diluted to 1ml with crosslinking buffer (10mM PBS, pH7.4), 20. mu.l of crosslinking agent (25% glutaraldehyde in water) was added, and activated for 1h at room temperature with shaking. Separating the activated microspheres by a magnetic frame, and removing supernatant; washed 2 times with labeling buffer (15mM PB, pH7.4) and resuspended in 1ml labeling buffer; after shaking up, 80. mu.l of 1mg/ml ToxR was added_28-534Protein antibody, room temperature shaking crosslinked for 2 h. After crosslinking, 50. mu.l of 20% BSA was added and blocked by shaking for 0.5 h. The microspheres were separated by magnetic frame and the supernatant was removed, washed 2 times with labeling buffer, added 200. mu.l of 0.01M PBS and stored at 4 ℃ for further use.

Example 4: preparation of antibody-DNA conjugates

1. Polyclonal antibody and biotin coupling

1ml of 1mg/ml of ToxR is taken_28-534Polyclonal antibodies, 10. mu.l of N-hydroxysuccinimide biotin (BNHS, SIGMA) stock was added and incubated at room temperature for 1h with shaking. pH7.4 PBS PermeabilityThe reaction product was separated and dialyzed for 24h, during which time the solution was changed 5 times, and unbound BNHS was removed sufficiently. The biotin conjugated antibody is stored at 4 ℃ for later use.

2. Biotinylated polyclonal anti-streptavidin-biotin labeled DNA complex coupling

According to the existing literature report, selecting 529bp toxoplasma gene fragment capable of stably performing LAMP amplification as target DNA, and primer sequence: f (SEQ ID NO: 5): 5'-CTGCAGGGAGGAAGACGAAA-3', respectively; r (SEQ ID NO: 6): 5'-CTGCAGACACAGTGCATCTG-3', wherein biotin is labeled at the 5' end, and which is synthesized by Girary, Shanghai. According to the molecular molar ratio of 1:1, the biotinylated polyclonal antibody and the DNA are firstly mixed uniformly and then mixed uniformly with streptavidin for reaction overnight. The complex is stored at 4 ℃ for further use.

Example 5: immune magnetic bead loop-mediated isothermal amplification method for detecting vibrio parahaemolyticus by antibody-DNA conjugate

1. Culture of overnight VP bacteria from 10⁸CFU/ml was 10-fold diluted to about 10 with physiological saline³CFU/ml for use. Taking 200ul of magnetic bead antibody conjugate, adding 10 ul⁸-10³The CFU/ml 1ml bacterial solution is reversed and mixed evenly, shaken and combined for 2h at room temperature, the magnetic bead-thallus is separated by a magnetic frame, 1ml of 0.01M PBS is washed for 3 times, and 300ul of 0.01M PBS is resuspended.

2. Adding 40ul of antibody-streptavidin-DNA conjugate into 300ul of magnetic bead-thallus, shaking and combining for 1h at room temperature, washing for 3 times by 1ml of 0.01M PBS, and re-suspending the magnetic bead-thallus-antibody-streptavidin-DNA conjugate by 100ul of 0.01M PBS.

3. Taking 1ul of magnetic bead-thallus-antibody-streptavidin-DNA conjugate as a template. The sequence of the Lamp primer is as follows:

F3：ACGAGAGTCGGAGAGGGA(SEQ ID NO：7)；

B3：TGGATTCCTCTCCTACGCCT(SEQ ID NO：8)；

FIP：GGATCGCATTCCGGTGTCTCTTAAGATGTTTCCGGCTTGGC(SEQ ID NO：9)；

BIP：GACGACGCTTTCCTCGTGGTCAAGTCTCCGACTCTGTCT(SEQ ID NO：10)。

the amplification system was as follows: 10 × Thermopol buffer 2 μ l; 4. mu.l of 10mM dNTP; 2.5 μ M F3/B3 primers each1 mul; 20 μ M FIP/BIP primers 1 μ l each; 2 μ l of 5M Betine; 25mM MgCl ₂4 mu l of the solution; bst DNA polymerase 1u l; 1. mu.l of DNA template; RNase-free water was added to 20. mu.l, and the mixture was gently mixed. Incubate at 65 ℃ for 60min, and terminate the reaction at 80 ℃ for 2 min. After the reaction, 5. mu.l of the product was electrophoresed on 2% agarose gel, and the result was observed under a gel imaging system after EB staining. The electrophoresis picture displays the Lamp characteristic ladder-shaped strip, and the result is positive; if there is no band, the result is negative (FIG. 7). After 1ul SYBR Green I was added to 25. mu.l of the product, the reaction solution was observed to turn Green and yellow to be positive (FIG. 8).

Example 6: specificity comparison experiment

Detection of VP, Escherichia coli, Staphylococcus aureus, Salmonella and Bacillus cereus strains by immunomagnetic bead loop-mediated isothermal amplification method of antibody-DNA conjugate of the invention, wherein each strain uses 10⁸The results are shown in FIGS. 9 and 10, in terms of CFU/ml bacteria concentration. As can be seen from the comparative experiment, the vibrio parahaemolyticus has a Lamp characteristic band, SYBR Green I is added into a Lamp reaction product, and the reaction liquid is Green and is VP positive; and 4 contrast bacteria do not have Lamp characteristic ladder-shaped bands, SYBR Green I is added into a Lamp reaction product, and the reaction solution is yellow and reacts to be negative to VP.

Example 7: effect of actual sample detection

80 parts of seawater products are collected in Hangzhou supermarkets and farmer markets, detection is carried out by a national standard method and an immunomagnetic bead loop-mediated isothermal amplification method of the antibody-DNA conjugate, and the positive coincidence rate is counted. The detection method of the national standard method refers to GB/4789.7-2013, and the method comprises the steps of sample preparation, bacterium enrichment, separation, pure culture, preliminary biochemical identification and determination identification.

80 parts of seawater products are collected, detected by an immunomagnetic bead loop-mediated isothermal amplification method of the antibody-DNA conjugate, and compared with a national standard method. The positive of the antibody-DNA conjugate detected by the immunomagnetic bead loop-mediated isothermal amplification method is 27 parts, the positive of the antibody-DNA conjugate detected by the international method is 25 parts, and no statistical difference exists, so that the detection result is consistent and reliable, but the detection time is greatly shortened.

25 positive samples are detected by the national standard method, and the positive rate is 31.25%; 27 positive samples are detected by an immunomagnetic bead loop-mediated isothermal amplification method of the antibody-DNA conjugate, and the positive rate is 33.75%. The national standard method and the immunomagnetic bead loop-mediated isothermal amplification method of the antibody-DNA conjugate have no obvious difference.

TABLE 2 practical sample antibody-DNA conjugate immunomagnetic bead loop-mediated isothermal amplification method and national standard detection results

The above-described embodiments of the present invention are illustrative of the present invention and are not intended to be limiting, and any changes within the meaning and scope equivalent to the claims of the present invention are intended to be included within the scope of the claims.

A sequence table:

SEQ ID NO：1：

ATGCTTGCTCAAAGGTTTACCTTTGATCCAAATAGTAATTCGCTCGCTGACCAACAAAGCGGCAACGAAGTTGTACGATTAGGAAGCAACGAAAGCCGTATACTCCTGATGTTGGCGGAGAGACCAAACGAAGTTTTAACCCGTAACGAGCTTCACGAGTTTGTTTGGCGTGAGCAAGGTTTTGAGGTGGATGACTCAAGCCTGACTCAAGCGATTTCTACTCTGCGTAAGATGTTGAAGGATTCAACCAAATCTCCAGAGTTTGTTAAAACCGTTCCAAAACGAGGCTATCAACTCATTTGTACTGTTGAACGCCTAAGCCCACTTTCTTCAGACTCAAGCTCAATTGAAGTTGAAGAGCCAGCTTCTGATAACAATGACGCCTCTGCTAATGAGGTAGAAACGATCGTAGAGCCGTCTTTGGCGACGCCTTCTGACGCAATCGTTGAACCAGAAGCGCCAGTAGTACCTGAAAAAGCACCTGTGGCTTCTGCTGTGAATCCATGG

SEQ ID NO：2：

CTGCAGGGAGGAAGACGAAAGTTGTTTTTTTATTTTTTTTTCTTTTTGTTTTTCTGATTTTTGTTTTTTTTGACTCCGGCCCAGCTGCGTCTGTCGGGATGAGACCGCGGAGCCGAAGTGCGTTTTCTTTTTTTGACTTTTTTTTGTTTTTTCACAGGCAAGCTCGCCTGGGCTTGGTGCCACAGAAGGGACAGAAGTCGAAGGGGACTACAGACGCGATGCCGCTCCTCCAGCCGTCTTGGAGGAGAGAAATCCGGACTGTAGATGAAGGCGAGGGTGAGGATGAGGGGGTGGCGTGGTTGGGAAGCGACGAGAGTCGGAGAGGGAGAAGATGTTTCCGGCTTGGCTGCTTTTCCTGGAGGGTGGAAAAAGAGACACCGGAATGCGATCCAGACGAGACGACGCTTTCCTCGTGGTGATGGCGGAGAGAATTGAAGAGTGGAGAAGAGGGCGAGGGAGACAGAGTCGGAGACTTGGACGAAGGGAGGAGGAGGCGTAGGAGAGGAATCCAGATGCACTGTGTCTGCAG

SEQ ID NO：3：

CGCGGATCCATGCTTGCTCAAAGGTTTACC

SEQ ID NO：4：

CCGCTCGAGCCATGGATTCACAGCAGAAG

SEQ ID NO：5：

CTGCAGGGAGGAAGACGAAA

SEQ ID NO：6：

CTGCAGACACAGTGCATCTG

SEQ ID NO：7：

ACGAGAGTCGGAGAGGGA

SEQ ID NO：8：

TGGATTCCTCTCCTACGCCT

SEQ ID NO：9：

GGATCGCATTCCGGTGTCTCTTAAGATGTTTCCGGCTTGGCSEQ ID NO：10：

GACGACGCTTTCCTCGTGGTCAAGTCTCCGACTCTGTCT

Claims

1. a method for rapidly detecting vibrio parahaemolyticus by an immunomagnetic bead loop-mediated isothermal amplification method, which is used for non-disease diagnosis and treatment purposes, is characterized by comprising the following steps:

s5: mixing a liquid to be detected with magnetic beads coupled with antibodies, separating magnetic beads-thalli by using a magnetic frame after target antigens are fully combined, mixing the separated magnetic beads with antibody-DNA conjugates after the separated magnetic beads are resuspended so as to be fully combined, and then, amplifying and detecting vibrio parahaemolyticus in the liquid to be detected by using an LAMP method by using the obtained magnetic beads-thalli-antibody-DNA conjugates as a template;

the vibrio parahaemolyticus in the step S1 is vibrio parahaemolyticus standard strain ATCC 17802;

2. The method for rapidly detecting Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method according to claim 1, which is used for non-disease diagnosis and treatment purpose, characterized in that: the expression vector for prokaryotic expression in step S1 was pET-28a (+).

3. The method for rapidly detecting Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method according to claim 1, which is used for non-disease diagnosis and treatment purpose, characterized in that: in the step S3, the polyclonal antibody and the amino magnetic bead microspheres are mixed according to the volume ratio of 1: 2.5 when coupled.

4. The method for rapidly detecting Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method according to claim 1, which is used for non-disease diagnosis and treatment purpose, characterized in that: in the step S4, the target DNA is a Toxoplasma gondii gene fragment, and the base sequence of the target DNA is shown as SEQ ID NO: 2, respectively.

5. The method for rapidly detecting Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method according to claim 1, which is used for non-disease diagnosis and treatment purpose, characterized in that: the primer sequences required for LAMP detection in step S4 are specifically as follows: f3 is as set forth in SEQ ID NO: 7, B3 is as shown in SEQ ID NO: 8, FIP is shown as SEQ ID NO: 9, BIP is shown as SEQ ID NO: shown at 10.

6. The method for rapidly detecting Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method according to claim 1, which is used for non-disease diagnosis and treatment purpose, characterized in that: in the step S4, the polyclonal antibody and the biotin are mixed according to the volume ratio of 100: 1, and the biotinylated antibody, the streptavidin and the target DNA marked by the biotin are mixed according to the molar ratio of 1: 1.

7. The method for rapidly detecting Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method according to claim 1, which is used for non-disease diagnosis and treatment purpose, characterized in that: in the step S5, the mixing volume ratio of the solution to be detected to the antibody-coupled magnetic beads is 5: 1.

8. The method for rapidly detecting Vibrio parahaemolyticus by immunomagnetic bead loop-mediated isothermal amplification method according to claim 1, which is used for non-disease diagnosis and treatment purpose, characterized in that: in the step S5, the mixing volume ratio of the re-suspended magnetic beads to the antibody-DNA conjugate is 7.5: 1.