CN108982847B

CN108982847B - Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis

Info

Publication number: CN108982847B
Application number: CN201810911070.0A
Authority: CN
Inventors: 刁有祥; 唐熠; 王鸿志
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2018-08-10
Filing date: 2018-08-10
Publication date: 2021-04-30
Anticipated expiration: 2038-08-10
Also published as: CN108982847A

Abstract

The invention discloses an indirect ELISA detection kit for detecting a novel duck reovirus antibody, which comprises an ELISA plate coated with a novel duck reovirus sigma C protein recombinant antigen; the preparation method of the novel duck reovirus sigma C protein recombinant antigen comprises the following steps: the preservation number is CCTCC NO: the duck reovirus sigma C protein recombinant antigen is expressed by a prokaryotic expression system through constructing a recombinant expression vector by using a sigma C gene segment obtained by amplification of a primer pair with the whole gene sequence of the duck reovirus of V201843 as a template. The indirect ELISA detection kit can be used for quickly and effectively detecting the new-outbreak novel duck reovirus antibody taking spleen necrosis as a main symptom so as to monitor the epidemic situation of the novel reovirus in duck groups.

Description

Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis

Technical Field

The invention relates to the technical field of biological products, in particular to an indirect ELISA detection method for duck reovirus causing duck spleen necrosis.

Background

Avian reovirus belongs to reoviridae (reoviridae) Orthoreovirus (Orthoreovirus) and can cause various diseases of poultry, and clinical manifestations of the avian reovirus vary according to virus strains, virulence or infected hosts.

In 2017, the ducks in Shandong, Hebei, Henan, Jiangsu, Anhui and other places in China are outbreaked with infectious diseases with spleen necrosis as a main symptom in a large range, and the diseases mainly cause splenomegaly, bleeding and necrosis of the ducks at all age stages, so that the breeding ducks lay eggs and the meat ducks have reduced appetite, emaciation, poor growth and development, and the spleens have a plurality of different necrotic foci, swelling, bleeding and marginal hyperplasia. The feed meat ratio of the ducks is increased, the slaughtering qualification rate of the meat ducks is obviously reduced, and serious economic loss is caused to meat ducks and breeding duck breeding industry.

Researches prove that the pathogen of the duck infectious disease with high incidence rate taking spleen necrosis as a main symptom is a novel duck reovirus, belongs to a new infectious disease, the researches on the biological characteristics, pathogenic mechanisms and the like of the virus are still in the initial stage, effective vaccine immunization and prevention control measures are still lacked at present, and a serological detection method for the novel virus is not reported at present.

Disclosure of Invention

Aiming at the prior art, the invention aims to provide an indirect ELISA detection method for duck reovirus causing duck spleen necrosis. The antibody of the novel duck reovirus with spleen necrosis as a main symptom can be rapidly and effectively detected, so that the epidemic situation of the novel duck reovirus in a duck group can be monitored.

The preservation number of the novel duck reovirus is CCTCC NO: v201843, wherein the preservation unit is China center for type culture Collection, the preservation date is 2018, 7 and 18 months, the preservation address is Wuhan, Wuhan university, and the strain is named as a novel duck reovirus N-DRV-XT18 in a classified manner.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides an indirect ELISA detection kit for detecting a novel duck reovirus antibody, which comprises an ELISA plate coated with a novel duck reovirus sigma C protein recombinant antigen;

the preparation method of the novel duck reovirus sigma C protein recombinant antigen comprises the following steps:

the preservation number is CCTCC NO: v201843, using the whole gene sequence of the novel duck reovirus as a template, amplifying by using a primer pair to obtain a sigma C gene segment, constructing a recombinant expression vector, and expressing a sigma C protein recombinant antigen of the novel duck reovirus through a prokaryotic expression system;

the primer pair comprises:

upstream primer sigma C-F:5^，- ATACGCCTGATACTTTCCCT -3^’；(SEQ ID NO.1)

Downstream primer sigma C-R:5^’- GCGCAATGAGAAGAGCTATTCATC -3^’。 (SEQ ID NO.2)

Further, the recombinant expression vector is transformed into BL21(DE3) competent cells, and IPTG is added for induction expression; and (3) denaturing and renaturing the expression product to obtain the purified novel duck reovirus sigma C protein recombinant antigen.

Preferably, the coating amount of the novel duck reovirus sigma C protein recombinant antigen is 500 ng/hole.

Further, the indirect ELISA detection kit further comprises: enzyme-labeled antibody, sample diluent, washing liquid, negative control serum, positive control serum, substrate developing liquid A, B and stop solution.

Preferably, the enzyme-labeled antibody is an enzyme-labeled goat anti-duck antibody.

The application of the indirect ELISA detection kit in the epidemiological investigation of the novel duck reovirus is also the protection scope of the invention;

the preservation number of the novel duck reovirus is CCTCC NO: v201843.

In a second aspect of the invention, a novel indirect ELISA detection method for duck reovirus antibodies is provided, which comprises the following steps:

(1) coating: the preservation number is CCTCC NO: v201843, diluting the antigen, adding the diluted antigen into an enzyme-labeled plate hole, incubating overnight at 4 ℃ or incubating for 2-4h at 37 ℃, and washing by using PBST containing 0.05% of Tween;

(2) and (3) sealing: diluting 5% skimmed milk powder with PBST (Poly-p-phenylene benzobisoxazole) 200 muL/hole, sealing, incubating at 37 ℃ for 1h, spin-drying, and washing with PBST;

(3) serum action conditions: adding diluted mixed solution of serum to be detected into each hole, incubating for 1h at 37 ℃, spin-drying, and washing with PBST;

(4) adding an enzyme-labeled antibody: the enzyme-labeled goat anti-duck antibody is prepared by using PBST according to the proportion of 1: diluting with 500 μ l, adding 100 μ l into each well, drying at 37 deg.C for 1 hr, and washing with PBST;

(5) substrate color development: developing solution of TMB substrate at 100 μ L/hole, and keeping away from light at 37 deg.C for 15 min;

(6) and (3) terminating the reaction: adding 50 mu L of stop solution into each hole to stop the color reaction; reading data under the condition that the absorbance of a microplate reader is 450 nm;

(7) determination of negative and positive cut-off values: according to the formula: positive-negative cutoff = negative sample OD₄₅₀The average value plus the standard deviation of 3SD to obtain a positive and negative critical value; when OD is reached₄₅₀When the number is more than 0.072, the judgment result is positive.

In the step (1), the novel duck reovirus sigma C recombinant protein is prepared by the following method:

the preservation number is CCTCC NO: the whole gene sequence of the novel duck reovirus V201843 is used as a template, a primer pair is used for amplification to obtain a sigma C gene segment, and a recombinant expression vector is constructed; transforming the recombinant expression vector into BL21(DE3) competent cells, and adding IPTG (isopropyl-beta-thiogalactoside) for induction expression; after the expression product is denatured and renatured, obtaining purified novel duck reovirus sigma C recombinant protein;

the primer pair comprises:

upstream primer sigma C-F:5^，- ATACGCCTGATACTTTCCCT -3^’；(SEQ ID NO.1)

The invention has the beneficial effects that:

aiming at the newly discovered novel duck reovirus capable of causing duck spleen necrosis, the invention establishes an indirect ELISA detection method for detecting the novel duck reovirus antibody, the detection method has the characteristics of simplicity, convenience, rapidness, stability, strong specificity, high sensitivity and the like, can detect the sigma C specific antibody of the novel duck reovirus in a duck group, and detects the antibody level of the reovirus in the duck group by taking the sigma C specific antibody as a basis, thereby monitoring the epidemic situation of the novel duck reovirus in the duck group.

Drawings

FIG. 1: SDS-PAGE analysis chart of the induction expression and protein purification of the recombinant protein sigma C in BL21(DE3) competence; wherein, lane M is a protein standard; lane 1 is empty, lane 2 is uninduced whole bacteria, and lane 3 is pellet after lysis of induced bacteria.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As introduced in the background art, in 2017, ducks in Shandong, Hebei, Henan, Jiangsu, Anhui and other places in China have wide-range infectious diseases with spleen necrosis as a main symptom. The infectious disease is found to be caused by a novel reovirus through research. At present, no medicine and method capable of effectively controlling the novel duck reovirus infection exist. Based on the above, the invention provides an indirect ELISA detection kit capable of detecting novel duck reovirus antibodies, which can be used for quickly and effectively detecting the newly-outbreak novel duck reovirus antibodies with spleen necrosis as a main symptom so as to monitor the epidemic situation of the novel duck reovirus in a duck group, so that infected ducks can be discovered as soon as possible, isolation or killing measures can be taken on the infected ducks, and the loss caused by the infection of the novel duck reovirus can be reduced.

It is known that the host range of avian reovirus is wide, the virus is generally existed in various poultry, and the reovirus has been isolated from chicken, goose, pigeon, ostrich, duck, turkey and other pheasant and other sick or healthy birds since 1954, but the reovirus isolated from different hosts has large variability, and the pathogenicity, gene sequence and main protein coding of the reovirus are different.

The inventor of the application separates a duck reovirus N-DRV-XT18 from spleen tissues of diseased ducks, the newly separated duck reovirus N-DRV-XT18 is subjected to whole genome sequencing, and respectively carrying out sequence alignment and homology analysis on the 10 gene segments and the avian reovirus reported at present, and finding out that L1, L2, L3, M1, M2, S3 and S4 in the 10 gene segments of the newly-separated strain N-DRV-XT18 are all positioned in a relatively independent branch, and has larger sequence variability compared with the duck-derived reovirus which is uploaded in Genbank at present, which indicates that the newly separated strain N-DRV-XT18 is really different from other avian reoviruses, the duck reovirus found in the invention can be considered to have larger variation with the duck reovirus reported in the prior art, and is 1 new single species of the orthoreovirus genus. Therefore, the novel duck reovirus is preserved in China center for type culture Collection with the preservation number of CCTCC NO: v201843.

The invention firstly uses a serological method to detect the antibody of the novel duck reovirus. The method can quickly and effectively detect the novel duck reovirus antibody with the spleen necrosis as the main symptom, and is a simple indirect ELISA detection method suitable for basic use.

In one embodiment of the invention, the novel duck reovirus indirect ELISA detection method comprises the following steps:

(1) preparation of coating antigen:

the whole gene sequence of the novel duck reovirus is obtained by a second-generation sequencing technology, and the sequences of 10 gene segments of L1, L2, L3, M1, M2, M3, S1, S2, S3 and S4 in the whole genome sequence are respectively shown as SEQ ID NO.3-SEQ ID NO. 12. According to the sigma C protein gene sequence of the obtained novel duck reovirus, two primers are designed:

upstream primer sigma C-F:5^，- ATACGCCTGATACTTTCCCT -3^’

Downstream primer sigma C-R:5^’- GCGCAATGAGAAGAGCTATTCATC -3^’。

Amplifying the cDNA obtained by reverse transcription by using the primer through a common PCR method to obtain a sigma C gene sequence (shown in SEQ ID NO. 13) with the length of 980bp, purifying the amplified cDNA by gel electrophoresis and gel recovery, cloning the purified cDNA into a prokaryotic expression vector PET-28a (+), and constructing a recombinant prokaryotic expression vector PET28 a-sigma C; the recombinant prokaryotic expression vector PET28 a-sigma C is transformed into BL21(DE3) competent cells, the recombinant protein sigma C is efficiently expressed by induction of 1mM IPTG, the protein exists in the form of inclusion bodies, and the inclusion bodies are denatured and renatured, and the purified reovirus sigma C protein is used as an envelope antigen.

(2) And (3) establishing indirect ELISA by taking the purified reosigma C recombinant protein as a coating antigen:

coating: diluting the antigen with PBS (pH =7.2 or so) or 1 Xcarbonate buffer (pH = 9.6) according to the required concentration, coating the antigen into a 96-well enzyme-linked immunosorbent assay (ELISA) plate, wrapping the antigen with a preservative film, incubating the antigen overnight at 4 ℃ or incubating the antigen for a plurality of hours at 37 ℃, and washing the antigen three times by using PBST containing 0.05% Tween (mass concentration) for 4min each time;

sealing: sealing and diluting 5% skimmed milk powder (mass concentration) with PBST (PBST) at 200 μ L/hole, incubating at 37 deg.C for several hours, spin-drying, washing with PBST for 3 times, each time for 4 min;

③ serum action conditions: adding a proper amount of diluted mixed solution of the serum to be detected into each hole, incubating for several hours at 37 ℃, then spin-drying, and washing for 3 times by PBST, wherein each time is 4 min;

fourthly, the action condition of the goat duck resistant enzyme-labeled secondary antibody is as follows: diluting goat anti-duck enzyme-labeled secondary antibody with PBST, drying after reacting at 37 deg.C for 1h with 100 μ L per well, washing 4 times with PBST, each time for 4 min;

fifthly, substrate color development: developing solution of TMB substrate at 100 μ L/hole, and keeping away from light at 37 deg.C for 15 min;

sixthly, terminating the reaction: add 50. mu.L of 2M H to each well₂SO₄Stopping the color development reaction by the stop solution;

and reading is carried out: and reading data by adopting a microplate reader under the condition that the absorbance is 450 nm.

(3) And (4) result judgment standard:

according to the formula: positive-negative cutoff = negative sample OD₄₅₀The average value plus the standard deviation of 3SD to obtain a positive and negative critical value; when OD is reached₄₅₀When the number is more than 0.072, the judgment result is positive.

Because the avian reovirus is RNA virus and has a plurality of segments, different strains have certain differences in the aspects of antigen structure, pathogenicity, cell culture characteristics, host specificity and the like, and are easy to mutate during genetic evolution. Thus, differences exist in the antigenicity, pathogenicity, genetic sequence and coding of the major proteins of different reoviruses. The reovirus antibody is detected by indirect ELISA, the sequence of a target gene is determined, and the antigen protein is designed and synthesized according to the sequence of the target gene for detection. However, the duck reovirus to be detected in the invention, which causes duck spleen necrosis, is a newly separated strain, the genetic composition of the duck reovirus is unknown, and the duck reovirus has larger variation with the existing reported duck reovirus, and the antigen protein can not be designed and synthesized according to the genome sequence of the existing duck reovirus.

For the indirect ELISA detection of the novel duck reovirus, the selection of the coating antigen is very critical, and the specificity of the detection method is directly determined. In the test process, primer pairs are respectively designed according to the main antigenic site region of the novel duck reovirus, a gene segment is obtained by amplification, and a recombinant expression vector is constructed; transforming the recombinant expression vector into BL21(DE3) competent cells, and adding IPTG (isopropyl-beta-thiogalactoside) for induction expression; and (3) obtaining purified recombinant proteins after denaturation and renaturation of the expression products, and constructing an indirect ELISA detection kit by using the obtained recombinant proteins as envelope antigens respectively. The specificity of indirect ELISA detection kits prepared by different coated antigens is investigated by applying clinically confirmed serum samples. The result shows that the accuracy of the indirect ELISA detection kit prepared by using the purified reovirus sigma C protein as the coating antigen to the detection of the serum sample which is confirmed to be diagnosed reaches 100 percent, and the detection sensitivity and specificity are obviously superior to those of the indirect ELISA detection kit prepared by using other recombinant proteins as the coating antigens.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples of the present invention, which were not specifically described, were all those conventional in the art and commercially available. Part of reagents and components used in the invention are as follows:

coating buffer solution: 1 × carbonate buffer (100 mL, pH = 9.6): na (Na)₂CO₃ 0.2756g，NaHCO₃0.6216g, dissolving with distilled water, fixing the volume to 100mL, keeping the pH value at 9.5-9.7, and storing at 4 ℃.

PBS solution: NaCl 4.25g, NaH₂PO₄·2H₂O 0.178g，Na₂HPO₄·12H₂And 1.386g of O, dissolving with distilled water and fixing the volume to 500mL, wherein the pH value is 7.1-7.3.

PBST solution: tween-200.5 mL was added to 1L of PBS, and the mixture was mixed well.

PBST blocking liquid: 5g of drymylk was dissolved in 100mL of PBST dilution and stored at 4 ℃ for a short period and-20 ℃ for a long period.

TMB color development liquid:

substrate color developing solution A: 66.5063g of sodium citrate are weighed out and dissolved in 800mL of distilled water and the pH is adjusted to 4.0 with concentrated HCl, H is added₂O is constant volume to 1L and stored at 4 ℃;

substrate color developing solution B: 0.2956g of Tetramethylbenzidine (TMB) and 0.0633g of tetrabutylammonium borohydride (TBABH) were weighed out and dissolved in 30ml of Dimethylacetamide (DMA), and stored at 4 ℃ in the dark;

when in use, the substrate color developing solution A and the substrate color developing solution B are mixed according to the volume ratio of 39:1, and are prepared at present.

2M H₂SO₄Stopping liquid: adding concentrated H₂SO₄Adding distilled water according to the volume ratio of 1:5, uniformly mixing and cooling to room temperature to obtain 2M H₂SO₄And (4) stopping the solution.

In the examples of the present invention, the specific experimental conditions and methods are not specified, and the conventional conditions such as J. SummBruker et al, science publishers, 2002, molecular cloning guidelines (third edition); master catalog of speekt et al, scientific press, 2001, cell experimental guidelines; or according to conditions recommended by the manufacturer.

Example 1: preparation of coating antigen

1.1 specific primer design and Synthesis: a pair of primers is designed according to the sigma C protein coding region of the whole gene sequence of the novel duck reovirus (with the preservation number of CCTCC NO: V201843), the two sections of the primers are respectively provided with BamHI enzyme cutting sites and SalI enzyme cutting sites, and a gene segment of 980bp in the genome of the novel duck reovirus can be expected to be amplified.

Upstream primer sigma C-F:5^，- ATACGCCTGATACTTTCCCT -3^’；

Downstream primer sigma C-R:5^’- GCGCAATGAGAAGAGCTATTCATC -3^’。

1.2 construction of prokaryotic expression vector PET28 a-sigma C:

amplifying a sigma C gene fragment by adopting specific upstream and downstream primers through PCR, connecting the purified fragment with a PMD18-T vector, transforming a connecting product into DH5 alpha competent cells, and selecting positive bacterial colony shake bacteria to extract a T-sigma recombinant plasmid. The T-sigma recombinant plasmid and the PET-28a (+) vector were double-digested with restriction enzymes BamHI and SalI (available from Dalibao Bio), respectively, and the two digested products were ligated with T4 DNA ligase (available from Dalibao Bio). The ligation product is transformed into DH5 alpha competent cells, positive clones are identified by a PCR method and enzyme digestion, and the positive clones are sent to Qingdao Stricture biotechnology limited company for sequencing.

The PCR identification result of a single positive clone colony is selected, and the PCR identification result shows that the target band which can be amplified to about 980bp is consistent with the size of the predicted sigma C gene fragment. And (3) selecting a single positive clone colony, performing enrichment culture, extracting plasmids, and performing enzyme digestion identification by using restriction enzymes BamH I and Sal I to obtain a correct enzyme digestion band. The positive clone sequencing result shows that the sigma C gene insertion position, the insertion direction and the reading frame are correct, and the result shows that the recombinant vector PET28 a-sigma C is successfully constructed.

1.3 recombinant protein sigma C induced expression and identification:

transforming the successfully constructed recombinant vector PET28 a-sigma C plasmid into BL21(DE3) competent cells, selecting a single colony for enrichment culture, and inoculating the single colony to a strain containing 100 mu g/ml kan according to the ratio of 1:100 the next day⁺In 2 XYT medium, cultured at 37 ℃ with shaking at 200r/min to OD₆₀₀Taking out 1 mL of bacterial liquid between 0.6-1.0 as a control before induction, adding IPTG into the rest culture till the final concentration is 1mM, continuing to culture at 37 ℃ for 6 h under the condition of 200r/min oscillation, and finishing the induction. 2mL of induced and non-induced bacteria liquid are respectively taken, and after centrifugation, bacterial precipitates are collected and are resuspended by 50 mu LPBS. And adding 50 mu L of 2 xSDS gel sample adding buffer solution into the sample, uniformly mixing, boiling for 5min, shaking to crack bacteria, slightly centrifuging, taking supernatant, performing SDS-PAGE, and identifying whether the protein is expressed or not. Centrifuging induced culture bacteria liquid, removing supernatant, collecting bacteria precipitate, suspending bacteria with PBS, ultrasonically cracking to clear, centrifuging at 4 deg.C for 5min at 10,000 Xg/min, respectively taking supernatant and precipitate suspension, adding 2 XSDS gel sample-adding buffer solution, mixing, boiling for 5min, and SDS-PAGE identifying protein expression mode.

1.4 protein purification:

and (3) carrying out mass induction culture according to the protein induction expression conditions in the step 1.3. And (3) taking the inclusion body to purify the protein according to the instruction of the kit, recovering a protein sample, and performing SDS-PAGE to identify the purity of the protein.

SDS-PAGE analysis showed that the recombinant protein σ C was successfully expressed in BL21(DE3) competent cells, all in the form of inclusion bodies, with a protein molecular weight of 40kDa, consistent with the expected size of recombinant σ C (see fig. 1).

1.5 Western Blotting analysis: protein is induced and expressed according to the method in 1.3, induced and non-induced whole bacteria SDS-PAGE are respectively taken, the operation is carried out according to the conventional Western Blotting method, and finally, an enhanced HRP-DAB substrate chromogenic reagent is adopted for developing. The results show that: in contrast to SDS-PAGE, PET28a- σ C-transformed BL21(DE3) competent cells induced a specific band at the corresponding position to Western Blotting, whereas control non-induced bacteria were absent. The result shows that the recombinant protein sigma C can generate specific antigen-antibody reaction with the antibody in the positive serum.

Example 2: indirect ELISA detection of novel duck reovirus antibody

The purified recombinant protein sigma C in example 1 is taken as a coating antigen to establish an indirect ELISA method, and the ELISA optimal protein coating concentration, serum dilution concentration and ELISA optimal reaction conditions are searched by a square matrix method. The final determination conditions were as follows:

2.1 coating: after the antigen was diluted 1:1000 with 1 Xcarbonate buffer (pH = 9.6), 10. mu.L was coated in a 96-well ELISA plate, coated with a preservative film, incubated at 37 ℃ for 2h, and washed three times with 0.05% Tween-containing PBST, 4min each time. Detecting the sigma C protein coating amount of the wells to be 500 ng/well;

2.2 sealing: sealing, diluting 5% skimmed milk powder with PBST, incubating at 37 deg.C for 1h, spin-drying, washing with PBST for 3 times (4 min each time);

2.3 serum action conditions: adding 10 μ L of mixed solution of blood serum to be detected and 90 μ L of 5% skimmed milk powder diluted by PBST into each well, incubating at 37 deg.C for 1h, spin-drying, washing with PBST for 3 times, and each time for 4 min;

2.4 the action conditions of the enzyme-labeled goat anti-duck antibody are as follows: enzyme-labeled goat anti-duck antibody was prepared using PBST according to the following formula 1: diluting 500, adding 100 μ L of the solution into each well, performing action at 37 deg.C for 1h, spin-drying, washing with PBST for 4 times, each time for 4 min;

2.5 substrate color development: developing solution of TMB substrate at 100 μ L/hole, and keeping away from light at 37 deg.C for 15 min;

2.6 termination of the reaction: add 50. mu.L of 2M H to each well₂SO₄Stopping the color development reaction by the stop solution;

2.7 reading: reading data under the condition that the absorbance of a microplate reader is 450 nm;

3. and (4) result judgment standard:

4. Cross-reactivity: the method established by the invention is used for detecting the positive serum and the negative serum of duck parvovirus, duck tembusu virus, duck adenovirus, duck influenza virus, duck reovirus NDRV-JM85 strain and duck reovirus NDRV-TH11 strain, and the method only reacts positively with the positive serum of novel duck reovirus (CCTCC NO: V201843) so as to prove that the method has good specificity.

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Shandong university of agriculture

<120> indirect ELISA detection method for duck reovirus causing duck spleen necrosis

<130> 2018

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

atacgcctga tactttccct 20

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence

<400> 2

gcgcaatgag aagagctatt catc 24

<210> 3

<211> 3959

<212> DNA

<213> L1 Gene of strain N-DAV-XT18

<400> 3

gctttttctc cgaacgccga aatgagttcg cgcaaagtgg ctagacgtcg tcataaggat 60

gctaccgaca ctaaagattc taagtacact gataaagata agtcctcagc cacaactact 120

gaaacgaagt ccgtcgactc cactaacaag agtgtaagcg ctccaaaatc tgatactcca 180

gcagcatcaa caccatcctc tacagatggc gcttctcagg ttgcagtcgc taaacaaacc 240

aatgataatg acgcttcttc taaagattct tcccctaaac caactgtcac tcccgacgga 300

aaggatggaa tgcatggtgc ggttaaatct caagacgcta aagctaccat tgctgttgat 360

gataacaagg acagggacgt ggtcttcggt ggcaagggtt caggtgataa aaatgctatt 420

acaaagactg ggtccgtgga taatgatggt ggtgttaaaa cgataccggc taaggatact 480

actatcgcat ccgctaaagc catgatggaa cagaaacagt tagttgcggg tcttccgaag 540

cagccaaaac ctgccagcca tctatgcact gtttgcatgg ctcaattcgc ttcagctgat 600

gcattgacta tacaccaaac aactcattcg attggatcca acgctgcact gactagcttt 660

tcgatctcta ccgccgttga ggagttcatt caatcttggg cctcggctac ttccactgct 720

aatactaaaa cagcactaac tgtggcggac gttgattctt taatgatgac tgaagggata 780

cgtttaatca cttgggattc cggactctgt acctcctttg agcttgtgcc gatagtgcag 840

tctaacactg tccaagacgt tatctcatac tcttggttca catctagtta caatatcgct 900

actcctttcc ctcaagcgac tgtggtgcgt attgtgttac gtacgaactg ggctgctaga 960

ttggattccc catcttcctc tcgtgaatgc gatcttcggc ttgctcctcc gacagaaagt 1020

aatgcacgtt cttttgctat gctcctcaac actggtgcta ctcctgaagg tacatttaat 1080

cctaacactc tccgtatgaa cgtcttgcag atgtgcctcc agtatgtgtt agctaacctc 1140

catttaaaca ggagtactca atttacgatg gacctgaccg ctgccgctcc caatttatcc 1200

gcttctcaac ttcgaatcgt gcccgaagac aaggatggaa aatggttccc ggtcatgtac 1260

ccttctcgtg taaacatccc cctctttaat aaaacagccg atttcgttaa ccaatgtatt 1320

cgtgacagaa tcggtcgcta cgatcgcgct caaactttcg ctggtgctcc ttctgaatgg 1380

gctgatatgt gggagactgc agactcatta acactctcgg ttcgtgaaat gtggatgtct 1440

cggatctcac aaatgaacat ctctcccgcc gatatcgccg acgcaatctc gcgttgttcg 1500

cagtcgctcc tgacggtagc cgcacctact gctccctccg tagctcgtct cctgccgtgg 1560

cgtgttagtt ctgatgagcg ccaattatta caactgctga tgtatcttaa cgtaggtact 1620

agcgccgatt acatccagcc aattctatct gcgttcgctc gcactctctc gcgtgtttca 1680

cctttgcgta ttaaccccac tctcatcgct aacgcaatgt ctactattgt tgaaagcact 1740

actaacaccc agagtccagc cgctgccatc ttgtcaaagt tgaagccagt cgcatccgac 1800

ttctcagact tccgtctcgc atgtgctgct tggctgtata atggttgtgt ccagacgtac 1860

ttatctgaag actcttaccc cagtagcggc ggatctgtca ctagtattga cactctggtt 1920

gatatgtttg tctgtctctt ggctctcccg cttgtcactg atcctaatgc gccttgtcaa 1980

gctttcatgg tcgtggctaa tgctatggtc ggctatgaga atctgccgat ggatgatcct 2040

aactttaccc aacagagact ggctgccgcg tttaataacc ctaccacctg gccgcagtgc 2100

tttctacacc ctcagaacat cgatcgccgc caatgtccga tcctatcctg gtgggcacaa 2160

cagattcacc gcaactggcc tactccatca cagatcacct atggcgcgcc tgatattatc 2220

ggttcagcca acctattcac tccccctgat gttctgctgc tcccgctcca gcatcgcccc 2280

attcgcatta cgaatccaac tttgaacttc gacaacgagt taacaacctg gcgtaacacg 2340

gtagtagatt tgatcctacg catcattgac agtggcagat accaaccgaa ctggaatcag 2400

tccatccgcg cttcaatgcg aaacgctatg acgaacttta ggattattaa atcgtacact 2460

cccgcttaca tcgctgaatt gttacccgtt gagttggccg ctatcgctcc cacccttcct 2520

ttccagcctt tccaggttcc cttcgctcgt ctagaccgtg atgctattgt cacccatgtc 2580

aacgtgtcgc gtcaggcccc gaacgtgctt gctcagccag cgttaaacat gtccatgacg 2640

tatcaacgca ctggcgtgcc aatatcgttg agcgcccgtc ctcttgcagt tgctcttctg 2700

tccggccaat atcctactga gccacctctg cagacgaatg tgtggtatgt gaatacgctt 2760

acccctctgt attcaaatga tggattattt aataacgtcc agcatgctat ggtggccgct 2820

gaagcttacg ccactcttat cactatgtta gcacagtgta cggacatgca gtatcccgtg 2880

gaccgtccct taaactggtt acgtcaaatc aacctagcgg cgaatgaggc taccatcttt 2940

gggcgctcca tcaattctct cttccagacc gcctttgatc tttccccttc tactgttctc 3000

ctgcaaccgt ttttggagtc cgaccctcgc tctacacaac tcgccatctc ctacgtccgc 3060

tataatggtg atagcgaaac cttcgtgcct accgtccgcc cgtctatgat agctgaggct 3120

actctactcg tcgagcgcgt tctgtcacat gagtataact tatttggact ctgtcgcggt 3180

gacatcattt taggacagca catgacccct tccgcattta acccgttagc ccctcctcct 3240

tccgtcgtct ttagtcgcgg tgaccccgag gtctacgagt tcggccagcg tagtttcgcc 3300

aactttggta tgaatggtga agagatcctc gttatggacg cgaatggcgt acgtcgtccc 3360

ctgcttggta gatgggtgat gcccctacag ctactgatgg tgaacattgg cgtgttccct 3420

aagctcctgc tggaccggat tctgaaaggg cgtttgtaca ttaggctaga ggtcggtgcc 3480

tatccttaca ctgttcagta ctatcagggt cgagagttca ctgatggatt tacgctgttg 3540

gagcagtgga tgtcgaaagt gtcgcccatg ggcataccac ccgttccgtt cctgatgcca 3600

caatctgaag gtcataacat tacttctggc atggtgaccc actacatttg gtccactgag 3660

tataacgatg gctccctttt cgccacaaac acagacttgc ctgttactgt cttcggtcca 3720

gaccgcacta tccctattga gagataccgt gctttggtcg atccgggcgc tctgccagcc 3780

acaaaccaac tcccccacac tatcgatctc tactgttcgt tgagacgcta ctacttggaa 3840

acacctccga ttacagcgac ggtgacaact tatggtgatg gtctcccagc gttgaaccat 3900

tagagcggcg aggctagacg cgagctgatc gcgtcgactc tcgttggagg ttactcatc 3959

<210> 4

<211> 3830

<212> DNA

<213> L2 Gene of strain N-DAV-XT18

<400> 4

gctttttcct caccatgcat gtcaatgggt ttgatgatgc tactctcgca tacgcacgct 60

ccatatcggg tcttacttca atgtcaaatg atttgtttga gagagcttca ttgtctatgc 120

gctcattccc acgttctcat gcttatgaca tattagataa agtagaattt tctgtctctt 180

gtgtcattcc taatgccata tttcatcacc cggaccacgt tgagtacttt tatatcgatg 240

ctgtcaatag ggtcaggcgt aaacatgtca ttgattcgga tgatgtattt gtaccaaact 300

gtaattttca gggtctctta actcctatgg ataagttacc aaactatggt caactatctg 360

aggtcatctc ctcgaatgct cgcgacgggt tagcttcggc acgaatcgcc aatactttct 420

ataacattgc tgtctcacaa gctaggcaag tcaaagcgcc tcttgaatcg tttctccttc 480

ccctattact ttctgaaacc tgccctttat ctgatgaccc atgtggattg gatacttccc 540

cgtctcctcc gatcagtaga aatctggcgt tatgggtact gcgcgagtta agccgcacta 600

tttgtggatc gtcaggcgat cggtcaccat ggttgttgtt agattcaggt gtagcatggt 660

tcctttcacc actgatgtct tcagctatcc ctccccttat ggctgattta acgaatctgg 720

ctatctataa acaggtatgc tccgtctccg atgatatgca ctccctcgcc gttcaaatgg 780

tgttgcaagc agctgcctcg caatcctacg gacattatgt gctgcaaact aaggccgttt 840

ttccgcaaaa cactttgcat aacatgttta gaaccatcac tgacggtctg gtccctatga 900

tagactggct ggagcccagg tctaactacc gcttcatgct gcagggtgcg cgtaaggtga 960

catcagatga tgcgaatcaa tctccagata acacggaggc tgctgagaaa gttggccata 1020

agatgggttg tttagatgtt gttagatcct tacggaagat gtcttctgcc attacagtgc 1080

attcgcatga tgcgatgacg tttgttcggg acgccatgtc ttgtaccagt ggtattttca 1140

ttactcgcca acctactgaa actgtgttga aggaatatac gcaagctccg acgattgaag 1200

ttcccattcc tcaaactgat tggtctccac caattggatc ccttcgctac ttatctgatg 1260

cctgtgctct acccgctgtg tacttggctc gttcttggcg tcgagctgcc tcagcagtcg 1320

tagataatcc tcacacttgg gatccactat atcaagctat tctccgctcc caatacgtca 1380

catcacgcgg tggttcgggc gctgcgttac gagacgcgtt aaaagctgct gaagtggagc 1440

ttccacagta tcctggtgtc agtattaagg tcgctacaaa gatataccag gcagctcaaa 1500

ctgctgatgt gccattcgat aagctctccc gtgccgtcct tgctcccttg tcgatggggc 1560

tgcgtaatca ggtccagcgt cgtcctcgca ccatcatgcc tatgaacgtc gtgcaacaac 1620

aggtctcagc agctcatact ctatctgccg actatatcaa ctatcacatg aacttatcca 1680

ccacatcggg tagtgccgtt atcgagaagg tcgttccgtt gggcatgtac gcctcctgtc 1740

cgcctgctca ggcagtcaat attgatatta aagcgtgtga cgcgtctatt acgtatcagt 1800

acttcctctc cgtcattgtt ggtgctattc atgaaggtgc tgctggacgt cgtgtatcct 1860

cctcgtttat gggtgttcct cccagcgtat tgtcggtcgt tgattccagt ggagtcacat 1920

cttcaatgcc catttccggt ttccaggtta tgtgtcaatg gttagcgaaa ctctatcagc 1980

gtggttttga gtatcaggtc acggacacat tttcacccgg caatatcttt acgcaccaca 2040

cgacgacttt tccttccgga tctaccgcca cttccaccga gcacactgcc aataatagca 2100

cgatgatgga tggatttcta agatcttggg tcccctcctc tgatgcatca gatattttga 2160

agaagttctg tcgctctatt tccatccagc gaaattatgt ctgtcagggt gacgatggcc 2220

taatgattgt cgatggtctc tcaacgggta agttatcggg cgaggtgatt gctgagtttg 2280

tcaaggagtt gcgagcgtac ggtaagtctt ttggatggaa ctatgacatc gagtttactg 2340

ggaacgctga gtatcttaag ttgtattttc tgaacggttg ccgggtacct aatgtgtcgc 2400

gacaccctat atgtggtaaa gagcgagctt ccggagataa gttagagatg tggccttcta 2460

ccatcgatat ttttaatggc atctttgtca acggtgtgca tgatggtctg ccttggcgtc 2520

gttggcttcg ctactgctgg gccttggcca cgttatattc tggaaagcgt gtgcgtcatg 2580

agaatgttga agtgtcaatc caatatccta tgtggtcatt tatctactgg ggcctgcctc 2640

ctgtcagcgt ctttggttcc gatccgtgga tattctctcc ctacatgccc actggcgatc 2700

acggattcta ttccatgcta actcttgtta gacccctaat taccgccctc tctccttcat 2760

cttcaatgga tggacttttt ggtcagtgcg atcacaacgc tctctttaac tccgagatgg 2820

tgtaccaggg ttactatatg gcgcagtgtc cgcgtcagcc atcgagatcc aaccgtcgtg 2880

atgacccgga gtctgtccaa cgatttgtta gggcgctcga atcgtactta tacatatccc 2940

cggagttgaa agcacgagtc aggcttggtc gtgaccgctg gcagaaatta gttgggtata 3000

ctgaaaaatc tccgccctct ctcgatgacg tcgctcataa atggttccgt agtgcgcagg 3060

aagccgactt acctaccacc tcggaaattc aggccatgga cttagcgtta atcgcggccc 3120

gccgtaaaac ataccaaggc ttctctaagc tacttaacac gtaccttcga gtaacttggg 3180

acctgaccga gccaatcgag catgccgtcg atccccgggt accactctgt gctggcattt 3240

ctccctcgaa tagtgagccc tttttgaagc tgtactcgat cggtcctatg atgcagtcga 3300

ctcggaaata tttcagtaac accttgttca ttcatcgtac cgtatctggc cttgacgtcg 3360

acgttgtaga tcgcgctctt ctacgtctga gagcccttaa tgctcctgat gaggtggtca 3420

ttgctcaact cctcatggtc ggcctgtccg aagcagaagc ggcgactttg gcagctaaga 3480

ttaggactat ggacatcaat gccgttcagt tggctcgagt ggtgaatctg tcaatacccg 3540

actcttggat gacgatggat ttcgatcgtt taatacgtga tattgtgtct actacccctt 3600

taactattcg ttctttgacg actgacctgc cctctggtgt cccatgggtt cgtgccatat 3660

tgcagttcct cggtgctgga gtcgccatga ccgccgttgg tcccgttaga cgcccatacc 3720

ttcactcagt cgctggtggc atgtcgtcat tcattaaaca gtttcgccgg tggatgcggg 3780

ctgagacgag gtagcgtccg tgcccagcat ggctcgagga attattcatc 3830

<210> 5

<211> 3906

<212> DNA

<213> L3 Gene of strain N-DAV-XT18

<400> 5

gcttttcacc catggctcag attagaggcc ttcgattgtc tacgacactc tcagcaccgc 60

cttcacgtcg atcgtacaca cctcagacat atgatgacct catttcagcg ctgaaattaa 120

ctgtcaagcc ctggcgaccg ttgcgatctg gcgctcaaga tgttatcacg gccgtgcaac 180

tgttctttcc actaaatggg tacgttgaac cactgttcat gctcgaaaag gaggtgagct 240

atgaagattt tgaagcatgg ttatcgccaa ttctatctgc cttggctgac cagttcttgc 300

gtcggtatcc catcgcctca taccatggcc gtttagtgaa tcctctgcta gcgaacgcca 360

ttgtagctgc gtttttgtca aatgcgccat atgcgcacgc tattgaacat ctcttcttag 420

tgcgtggagt gatagaagac attgtcgacg ctggtttatc cattcaaaat cacctgtggt 480

tcgatcgtgg cgctctcgtg tcacccgctg gtcagaaatt cattcagctt gacaagtact 540

ctttctcgtc tcgtgaccca tgtctcttcg ctaagcagtc tcgctactat ggcctggttt 600

actatttcct caacatatcg gactgcttgt cctattgcta tcgtcatctc tcaaacttca 660

cacctctgct gcactttgat cgaccatcca acggcgtgca ttgtctagta ccgtcggaat 720

ccacgactcc catagccggg tctttacctg tgtcctccct gagtgccatc ttattagaat 780

cttgcattca gcagtctatt ctgaacactc ggactccgac gggcgcacca tcgacgagac 840

agatagaggc tcttttgccc gtgtcctctc ccttctttga acgtcccacc actttggaat 900

actctttgtt ttctctttct aacgctttag taggtggtta ccagctatta gatctacctt 960

ctggtcaccc tgattgttct accgttgctg ctttgttggc tcgattaacg gatttttcca 1020

aggagatcac agtcattcaa cctattccgt cgcgttttac tttgtacgct gacagtccat 1080

tgaattacag tggtgagaac gccatgtttc taagccgttt gccatgtgaa tctggtaaat 1140

ccgtcggtcc tgtctttact ggtaaacctg ttaataggag tattggttgg atgcctcagt 1200

tcgatcctgc tacgtcatat gatcctgaaa tggcagctga gtccctagcc aaagcgacca 1260

ctctcccatt gcgtgcaaaa ttttcatcat tctggtccgg acccgcactt ttctctgccg 1320

cctcatgtga cagacacaat ggtgtgtatg acctgcgctt tatgccacct tttccatcca 1380

catactttga tgaggatgac gtgttttctc gctctcggtt ttcatcttat cgtgctgtcc 1440

gggaccgttc gcttttgaag gataccgcca atctcatgta tgtctccaat ttgtcgaatt 1500

cacatgacca gcgtcttctt cctgaatcta aaactatggt gtatgtgggc gcttctggta 1560

ctcacactga taatcagcca tcaattatca agcccttgtt agacggcact cttcctggcg 1620

tcttcaagcc cctttcggtt aaacaggttg gttgggaggt taccaacggt actatctgtg 1680

atatcgagtt acccttggct actggaacat tcttcttcgt atacagtgat gtcgatcagg 1740

tacagtcggg cgattccgat ctcgtctcct cttctcgacg tttctgtctt caattagaca 1800

tgctgatgaa gctgacgtat acctctggtt ctgtgatcgt gaagtgcaat ttccctactg 1860

acttagtgtg gcgtcacatt ttctcaacta tctctccata tttcatgtcg atccatctta 1920

tgaagccgct tgtctccaat aacttagaac tgtacattct atttgctgaa aagttatccg 1980

tccctgacgc gcctttcaat ccctccgctg acgtggtgac attctggcgc tctcaacttc 2040

agcgctacag agttctccgg gattcttttt cctccgtccc tcagattgac tcagctctta 2100

cgctggacga cccactaacc gtgtcggtct taaatttcgt agatgtcaca tcactttctt 2160

cgctggatga tcagcgtgca ctggctgcct tctctgttct aacatctttg gggtcacaaa 2220

agttgtctat tcatccatat tttgacagtt accgcacaca gctgaccggc atcgtgacac 2280

ctcattctcg caacctcgtt gatcgcttag cgtacgtgcc gcgcgtgttc ccttctacca 2340

ttgacgtcca acatcgcact atcgctcctt ctgatcctga gatattcggt tttcgttcca 2400

acgcgtggac gcagctctct ttcttctacg atcacgcact cacgttgatg gattttactg 2460

atgttaagca ttggctcgac ctcggcacag gtcctgaagc gcgtccctta tctttcttgc 2520

cttccgacct tccagtgact ctttgtgacg tacgcccctt cgtcctgccc accggatgtt 2580

ggtccacatt taccgatatg ctgaattatg attatttaac aactaatgtg gtgttgtcca 2640

ctggtgcgga tgttgtctcg tgtgttctct ctctgggtgc ggcttgcgct gatgcaaaca 2700

tgtcccttca tgatggtgta cgccagttag tctctcagtg tgttgaagct aatgtccgca 2760

cacttttcct ccaacttaac tgtcctctcc cttccgcggg cgatgtatct cgtgatgttt 2820

tggagttggt ccagtctaac tcaacttatg tcttccattc ccttggacgc gtcgagccct 2880

tccttcctta ctcagctttg cttgaattga ttgaagatat ctgccctggc gttgtggttg 2940

agattaaaac catggatcct tccctagcat ggctaagtta cgcggtgcaa gccaacgctt 3000

cggtaacatc cgatgacatg gcattagcga tgcggctgtc ccacttctgc ccgttatttg 3060

ttttccgttt cgatcaaaga tctgcccaat ttccggacga cgctcgcgtc ggcgttccgt 3120

tctccgtgat tgtgtctaac tatgatgcta cacactctta tgaggtcact cttgacaacg 3180

ttaccatcgc gaccgtcact gctggttcct taataggctt ctcttctggt gtgactgttt 3240

cagttcaagg tactctactg actctctcta ttaatccgtc tagccctggt gttctctccg 3300

tagttcagac attgccagtt cgcatctctc ttggcagttg cgttatagac gctccggatc 3360

catcgctgtc tcttgtgttc ccttcagtcc tagatacttc tttgtcgggg acgaacttag 3420

agttgtactt gtccgactgg tacgatgttg cactcttcta catcgacgag gtcaactctc 3480

gactgattcc tctatccgat tcaaaatatg aaatctttcg acgtgatcaa gcccctaata 3540

gccgcaccct caactatatc ttcgaccgat cggatgtttt ctttaaaatc gtgttgtgtg 3600

acgtctcatc ctctggtgta ggccgattca tctatcgtga acttcctgag ctgagttctc 3660

cggtatggcc tgacaacatg cgcaccttct tgtcattgcc ttttgatgct cctatggtga 3720

ttatctcccc ggatggtccc gtgaattacg atggtgctgt aatcacccct cctacttcat 3780

ggctgacggt ggatggtagt acctgcgtca ttgatggacg tccatcattt tacgttcctc 3840

ctggtcgata cggtctggtg agagtctaaa cgatcgcggg cctccagtag aagggtgtta 3900

ctcatc 3906

<210> 6

<211> 2264

<212> DNA

<213> M1 Gene of strain N-DAV-XT18

<400> 6

atctagccac accggtgcta ggagttggtt ctcgtattac cgcattggat cgcactattg 60

acgcacttac tttgaaacca cgtaccgaac tgcacgatgt ctacactctt gatccatctt 120

taactctacg ccagattgag ttgatttcat ctggtacttc aatggacgat atcgctcgcg 180

gtttgcttca tcgggattgg cgtcgtcaaa ctgtcattac tctgcttcct tctcgtcgga 240

ctttactcga ctatctactc tctaatcctt cgttgtgtcc tgatggttta gatcgttcca 300

ggctcaaagg gttcaagaag cgtcccaatg acttccgcat cagtgacttc ttttctccgt 360

taatcactga gtccacttct attagcacat actcacgctg gctcaatgcc catcctgtta 420

tattctccat cactcacaag gtagtcggcg ctcgcttacg cctattcggt ccgtctaaat 480

tatatacatt atctcccgac gttcttcgag agctatcgat tttgaagtca actgatcgtg 540

ttcttgtcac acccactgcg cgtgtgtacg tgagttgttt ccctagtgct tctacgagta 600

actgcgtcct ctctgcccgc gaacgttgga acgctcccga tgtccatccc gtcgttaaag 660

ccatacaact ggtctacgat caccagtacc gcgtcaccgc gcgttatctc tccgatccct 720

tagcttcggc tttattgctt gggactcagt cggtacgctc tctgaaggtt ccccccatcg 780

aggctagagc tgctcgttca gttggcgttc gtgtacaggc aatgacccct cctcgtggta 840

tcaacacctc catcatacaa gtcatcgatc tgcgtttgca gtgccgtcac tcacttatcc 900

ctgttgagag accatttcca ttaactctcg taggcttgcc gtcctgcttg cttcagcatt 960

tggagttgac tttatccgat agctggacgc ctattcgaga ctcaactggt atgtttgaga 1020

tgtggttcat ggtactcact cttacgtgcg acaagattgt ggatggacgt ggtaatgctg 1080

tctttctaac ccctggttct actgcctctt cttcaattaa ttatgttcag ctcgtgtcta 1140

cttcttctcc tcggccgcaa tcgctggcat ctaacgcgtc tggtcgtatt gactccgtag 1200

gtttgtgtat gccaaagggt tcattcaaat cgactatgat taagttcctg actggcttag 1260

aaatatgtgg cacgcgcgta atgtactctg atgtcgtcat ggacagcgac gatgttggtg 1320

attcattgga ccctaccttt gagactactc tctttgatga gttgatggcg ttggatcctc 1380

ctttcgactt agataagtta gccagttcaa ctgaccttgt cgatcagtct tacatcgcct 1440

ctcacatgta tcccaccttt ctgaggcttg ttaacgaact gttgactcct cgagcttctg 1500

agctatactc agaacacagt gctgagttta ggtctttgac ttacgcccat gcagactctg 1560

aatttcttaa cgcttgttgg acagcacgat tgatgcgctg ctttattaac tactatgagg 1620

agcagaacat cctgctacgt cctgggagag ttggaggtgt attgtttcaa gttgcgctca 1680

gtcgttgcta taagatgttc gcgacatcca ctccttcagt tccattgtca ttattcctaa 1740

aatcactgtt cgtcccttgg attgaatcgg caccccttct cgccccactg actctcaacg 1800

aatcctcacg cgtactcgct tggtatatac ccgagtcaca atggacggaa aatggatggt 1860

gcatgtgtga taagcatcgt catgtgacct tttcttttat tcgtggtttg cctgctgacc 1920

tgtccgtcct tgatctgttc gactggtcgc gattccgcgc aactatcgga gtagacacaa 1980

ctctcgtgga gctgggtacc tccattcgtg ccgttcgcgt ctccgttttc tggacttccc 2040

aaaaacccac tgtggacgtg tttgataacc gcgctctctt caccccattc aaacactatc 2100

atcttagtct tcactgtcgg tgcgcccttg gtcgaccatt caccgcgaag aacatgaaat 2160

tgtatttgtc cacggtagga aacgagaact gacgggccgt ggggcggtga cacccaggga 2220

gggtatgctg gtaaccctgg gttagtcgtc ttgagatact catc 2264

<210> 7

<211> 2158

<212> DNA

<213> M2 Gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(4)

<223> n is a, c, g, or t

<400> 7

nnnntttgag tgctaacctt tctcacacga tgggtaacgc gacgtctgtg gttcagaact 60

tcaacataca aggtgatggt aaccattttt ctccttctgc cgagactacc tcctccgctg 120

taccgtcgct atcattaaat ccaggtctgc ttaatcctgg cggtaaagca tggaccctta 180

tcaacccaac gctcaatgca tccgatccct cgtcgttacg attgatgaca tccgctgact 240

tgtccacctt gtcccaatcc gcgattggta actccactgg ccttctccca acgtcaggca 300

tgtataccgt ggctaataaa gagacgttga gtgtggtgac gaatcatgca ctgtctcaat 360

ttgagaagct tcaaatggcc tgcgaactgg atcgtgacta tctggatgct cgaggcgtgt 420

caccagaatc cgtggatatc cacaattaca tagtctacgt ggactgcttt gttggtgtgt 480

ccgctcgaca agcggcttct aattttcagc agcacgttcc agtcatcacc aagtcaagaa 540

tgacacagtt catgacgtcc gcgcagaata tgcttcaggt ccttggccca tgggaacatg 600

acgttcgtga gcttctcacg atattgccga cttctaccac tgcaggcaag atcacttgtg 660

acatgaaatc cgtggttaac tttgtcaacg accagctctc tgacacaaat ttatgccgtc 720

tctatcctga atgtgctgct tcgtctgtag ctaaacgtaa tggcgggata cgatggaagc 780

aacctgacac tgacgaggct ccctcccttg caactaacga tatcgccgct tccacgatgg 840

gtgcgcttgc taacaccacc cccctggctg agaagtctaa ttctggtgaa gagtctatgc 900

gtttagtcaa cgacgtaggt gtggatatca tctgttctag agcgccagtc agctcctcag 960

tgtggtcacg tactgttgag ccaaaatcgt ataacatcag gacactccgc gtggaagaag 1020

cgctttggtt gcgggaatgt cagacatcta atggttttga cgttcagtac actctgccag 1080

atcagacaac tcataagcat ttctggcttc aacaaggttc cacagtgatt aacttggagc 1140

agacgggcgg catgatgttt gaggtgaata tctctggtaa agactacaag aagggcactt 1200

ttgatccaga taaccagaag ttggtgctcc tagttatgca atccaaaata ccttttgagt 1260

catggacttc cgcagcacag attactggta tagctcaagt ggctgaagtc actgtacacg 1320

ccgccgacag ctcgacacct ggtcggaaaa tcattggtga gacatcgtta tcgtatctgt 1380

ttgaaagaga gaccgttact acagctaaca ccgaggtgaa cacctacctc ttttgcacgt 1440

ggcaacttga cgatgctcag agtaatggcg acaatgcttg gcaggatgcg tgggatggta 1500

ttaccacttt gaccccactc acttcaggca ccgtgacggt taagggtacg tctgtggact 1560

ctgtcgtgcc gactgactta gtgggctctt atactcctga agctctggct gctgcccttc 1620

caaacgacgc cggacgtatt ctcgccaata aggctattaa gctggctgat gctatcaaga 1680

aagaggatga ttctgtcatt gacgagtctt ctccattcag cacccccatt cagggagtcc 1740

tcgccgtcca acagctagat accgttggga cacgtggtgt gcgtatcatc caacctccct 1800

cctttctgaa acgtgtcgct tcacgtgctc ttcacatgtt cctcggcgac cctcagtcca 1860

tcttgaagca ggcgacaccc gttcttcgag acccggacgt ttggactggc ttcatccaag 1920

gagttcgtga tgggatccgc accaagtctc tttccgctgg agttagatct gtctacaaca 1980

acgtcaccgc aactcaatca gtgcagacct ggaagcaggg atttctgact aagatacaga 2040

cgttgttcag accatagtga ggtgctaagg cctctctgcg cggcgggtcg gtgggcacgt 2100

cgcgttgatg ctgaatgcac ggggaggtga cgctctctgg gttagcacgt tactcatc 2158

<210> 8

<211> 1996

<212> DNA

<213> M3 Gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(4)

<223> n is a, c, g, or t

<400> 8

nnnntttgag tcctagcgtg gatcatgtcg tcaaccaagt ggggagacaa accgatgtcg 60

ctctcaatgt ctcatgatgg gtcgtccatc cgttctgctg catcacaatt tttgtcggtt 120

ccattgtccc actccactcc tattccacct caacggaaga ctgtgcttct gaagttcatg 180

ctcggcgaag atctggttac cgttcagggt actctggctc cgtttgatga ctactggttc 240

gataatcaac ccctgctttc ccaggctgtg gaactgttgg catctgagga ccgtctacgt 300

aattttgagc attatgagaa gtttcttctc aagaagggtc atcagctacc ggagattatg 360

aacagactgc gtttattctt cactgatgtg ttgaaggtga aaatggaagc tgacaatcta 420

ccgtcccttg ctcaatattt gatggctgga accatggatg ccgtttctac tggtcaccct 480

cccggcgcct ctgtgccaga cgtctctaaa gtggtagcta agcagcaaac gatctctaaa 540

tcgcccggtc gtttggatga ggaagagtat aacgtaatac gttcacgctt cttaactcac 600

gaggtatttg acctgtcatc cgatctccca ggtgtccaac cctttctgga catgtattat 660

gctaccgttc cacgtgctga tgctactggc tggtgcgctt cacgacgcaa agggttactt 720

gttcacgctc ctggcgaacg tttcgaggat ctaaccatat ttgccactga tacctctcta 780

ccaaatgagc tcatattaac ggcaggtgat gtcactgtag cgcgctttga ccttcttgac 840

gtgtccggga tagcccctca acatcacgct tcagtccaag aagagcgtac tgttggaacg 900

agtcggtatt cagccattac tgcaaacgat caccctttgg tgttcttctc tccctcagcc 960

attcgttggg cgattgatca ttcgtgcact gattcgctca tttctcctcg gaatatcaga 1020

gtgtgcgttg gcatcgaccc gttgattacc cgttggacgc gcgatggtgt gcaagaagct 1080

gctattctga tggatgacaa gctcccgtct gtcggtcgcg ctcgcatggc tctcaggaca 1140

ttgactctcg ctcgtcggtc gccgatgatt tctttcatga ttggagcgtt gaagcactca 1200

ggtggtcaac tcatggaaca ctatcgatgt gacgcagcta atcgatacgg ttcgcccacg 1260

gtgccagcct ctcaccctcc accctgcgct aagtgcccgg agcttagaga acaaatcacg 1320

aggctatctt ctcaacccgt cgccaattca caacctctgg ccggtccagc tgctctgctg 1380

tcgaagatct ctgaattgca acgcctcaac cgggaattgt ctctgaagtt ggcagatgtt 1440

caaccggcac gtgaagacca tctcctagcg tatttgaacg agcatgtgtg cgtgaacgcc 1500

aaggatcatg agaaggacct ccttgcccgt tgcaatgtgt ctggtgactc agtcaatacc 1560

gtcgtcgccc agagagctaa gaatcgtgac aggtttgagg cccgcttgcg tcaggaagcc 1620

aacgctgaat gggagccccg catggctgca ctaaatcaag agctcacaca atcacgcgct 1680

gaacagcagg agatgatgac gcaggcgctg caatacctca acgagcgtga cgaattggct 1740

caagagttgg atgagttgaa acgggagatc actactctga gatctgcgaa cgtgaggttg 1800

aatgctgaga accaccgaat gagtcgagcg accagagtgg gtgattcttt tgtcagtgat 1860

gtcctctcga cgccttccga cgttccacga acttctgcac cttccatgga tgacctggtg 1920

gacgacctgt gagctttgac ctgtgactcg gtttctctct gactccatga ccccacggcg 1980

gactcggtta tccatc 1996

<210> 9

<211> 1568

<212> DNA

<213> S1 Gene of strain N-DAV-XT18

<400> 9

gcttttttct tctctgccca tggctgacgg tgcatgcaat cacgctactt ctatttttgg 60

agccgtatat tgtcaaatat cacagaatat tgcacacgga aatattgatt cttacacctc 120

ttggacttct tatttacctc ctattctagg cggtggtttt ggtcttattg ttcttctcgt 180

gcttgtggtt ttgatcgtgt attgttgtaa gcattcaaaa attctttctg ccgttaaggc 240

gactgattct gccgtgacaa ctttgcttcg tgatgtcact cccgccaacc ccgatcctgt 300

tcaagtcgtt taaagtccac tcgtggcgtc ttttgtccca atccccgttc cacgttcagt 360

tctgcgacgc aggactccaa tcctacgacg tctattcacg tttcccttct gtgtgtgacc 420

tttcgctctg ttattatctt aatacacctt tcgagtttgg aattgctgct atagaggggc 480

gtcccggtga ctattatttg ctgttcgctg gcaagtccag tgactctaac tcacgagtat 540

ctttgtacgc tacgcggcaa gccggtgacg atggatcgca acgaggtgat acgcctgata 600

ctttccctcc tcccctacca gtcaagcgac gtcgatcatt tgacgacaca gatcaaatcc 660

ctccaaagcg ccgtcgactc actgaaagaa tcacaagtgg tagtgttgag acgcctgact 720

acgattacgt cgacggtggc ggatctacaa tcaacaactg aattgttgac ctcacaggtg 780

gcaggactta gttcccgtgt ggcttcagtg actgatgagg tagtccgtgt aaattcagtg 840

attggaacta cgatcactaa tcttgacaat gtccggtccg agctatcctc tctctcctcc 900

caagtctcgt cgcagacgtc cactctaacg aatcttacat caaccgtttc atcccagtct 960

cttgcgattt ctgatctcca gcgacgagtt acggccttag aacgatcggg tggtgcgccg 1020

acacaatttg aagctccctt gcacctacaa aacggagtcg tctcactcca agcatctccc 1080

tctttctgtt ctttgtctcc gatcctctcc ggacctgctg atgctgctgt tttcaaggtt 1140

ggtgagtggc tgggaactgt catatctggt caaagtcagt catctgcaat catgaacgtg 1200

cggattcatt catttgggca gcggaccatg ttgcttatgt cttcgcaaaa tgtattcact 1260

attccgccag gttcgggtgc gtctttgcag ctagatgtga atcgtataac gacccctgcc 1320

attgacgctg ctatggtaac tccttccgct gcttttgctt ctgcttcctt tatggctgac 1380

atagctttca aagactctaa gacaggagaa gtccatgctt tacacactac tggctctttt 1440

cgatcacctt ctttctctat cgtttgggtc ccggttgctt cggaaactcg taattatcaa 1500

ataatggcgt tacgcttcac cgtcgccacg ggctaggctg tggcgcgcaa tgagaagagc 1560

tattcatc 1568

<210> 10

<211> 1324

<212> DNA

<213> S2 Gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(1)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (1323)..(1324)

<223> n is a, c, g, or t

<400> 10

nctttttctt ccacgatggc gcgtgccgtg tacgactttt tatctacgcc tttcggtaac 60

cgtggtctag caactaaccg tactcaactg tcgtcactac tgtcaagttc aaattcgcca 120

tggcaacgct ttttgtccgc cttaactcca ctgaccgctc caggcattgt ttcaacccct 180

gaggcaccct acccgggttc atcgttatac caggagtcca tgcttcacag cgctactatc 240

cctgggattc taggtaatag agacgcgtgg cgcaatttca acgtattcgg cttttcatgg 300

acagatgaag gtttgtcagg acttgtcgct gctcaggacc ctcctccagc tccaccgtac 360

caaccagctt cgggacagtg gtctgatctg cttcagtatc ctcgatgggc taatcgtcaa 420

cgtgagttgc agtctaaata tcccattctg ttgagatcta ctttgctttc agctatgcgc 480

gctggaccgg tgttgtacgt tgagacttgg cccaacatga tttctggtcg acttgctgac 540

tggttcatgt cgcagtatgg aaacaacttc gttgacatgt gtgcacgatt aactcagtcc 600

tgcatgaaca tgccagttga gccggatggt aattatgacc agcagatgcg agcattaatt 660

agtctgtggc tcctctcgta tattggcgtt gtgaatcaat ctaacactat taacggcttc 720

tactttgctt ccaagacgcg tgggcaggct atggataact ggacgctgtt ctatgctacc 780

aacaccaatc gggtgcagat tactcagcgc cactttgcct acgtttgcgc tcgctccccc 840

gactggaatg tcgataagtc ctggatcagc gctgccaatt tgactgccat tatcatggct 900

tgccgccagc cgccagcctt tgccaaccag ggggtaatca accaggccca gaatcgaccc 960

ggattctcga tgaatggtgg aacgcctgtg cacgagctga acctgctgac taccgctcaa 1020

gcttgtatcc agcagtgggt cgtagctggt ttgatctcag cagctaaggg tcagtccatg 1080

acgcaggagg cgaatgactt ctcgaacctc atccaagccg atcttgggcg gatcaaagcg 1140

caagatgacg cgttgtacaa ccaacaacct ggttacgctc gtcgcattaa gccgtttgcc 1200

aacggagatt ggacgcctgg aatgactgcg caagcattag ctctactagc cacttttacc 1260

gtctaggcgt agggtcgtac gctgcctgag tccagccctc cggcagcacg tggacgtact 1320

cann 1324

<210> 11

<211> 1202

<212> DNA

<213> S3 Gene of strain N-DAV-XT18

<400> 11

gctttttgag tccttagcgt gcaagccgca atggaggtgc gtgtgccaaa ctttcactcc 60

tttatcgaag gtattactac tagttacttg tgttctcctg cgtgctggaa ttcgaagacg 120

ttatgggata ttgaagaatt tcacacacct gacgttatca gggtcggcaa cgcttattgt 180

tgcactcagt gctgtggtgt tctgtactat ggtgcccctc cctctgatgg aaactgtttt 240

ccacatcaca agtgtcatca acagcaatat cgtactgaga ctccgctcat gagatatatt 300

aaggtgggtc gcactacaga gcaactgctt gatcaatatg ccattgctct gcatgtcatt 360

gcagattact atgatgaggc gagtaagcaa cctcatgata ttgctgaagc tgagtcaatc 420

gcaccatttg atatcgtaac caggactgaa tctattcgca gtgaccgtgc cgttgacccg 480

gaattctgga cttatccgtt agagaggcga ggatacgacg cgcgacatga gattgctaga 540

gcgggttgga agatgatcga tgcttcatcg cgaagtcaca ctcttcctga atgtctggtg 600

tcaaatatgc tacatactag gcatgtcttc agccaaatgt tgaccacgac aaccatctat 660

gatgtcgctg tcacgggtaa ggccgttaaa ttcagtccga tggtagcaac catgccaact 720

cgaggagatg gtgctgtggc tctgtcaaga ggtaacttgg atcatgatgt cgaggactgt 780

tggatggatg gttttgcatt ctcccccctc atcggcggtg ttggcatcac tggtcaattt 840

gagcgtggtt cctgccataa ttttgggcac cccatgattg ggagcggtaa gaaagcttct 900

cactaccgca atttgttcat ggaatcctgg cgtggatggt caaagtcgtg ctttacatgt 960

gctgcaggga tggagcccgc ggagtgcgaa tctaggctgc gaggccacgc cagaactatg 1020

ttcggacgtt ctcttccgga tatctgtgac ttcgaggaga ctacccacgt tggccagtcg 1080

tccgcgccat taaagaaggc cacgaaattg tccttcctgg agtgtaggtg gtaagcacct 1140

ctgggtcaaa atgcacatag gctcccacct atgtgacggt tagcgggact cacctattca 1200

tc 1202

<210> 12

<211> 1191

<212> DNA

<213> S4 Gene of strain N-DAV-XT18

<220>

<221> misc_feature

<222> (1)..(4)

<223> n is a, c, g, or t

<400> 12

nnnntttgag tccttgttca gccatggaca acaccgtgcg tgttggagtt tcccgcaaca 60

catccgtcgc cgctggtcag actgttttca agaacttcta cttactccga tgcaacattt 120

cagctgacgg tcgaaatgcc acgaaagcgg tccagtctca cttcccatac ttgtctcgcg 180

ctgtccgttg cttgtccccg cttgctgctc actgtgctga tagaactctt cgtcgtgata 240

acgtcaagaa cattttgacg cgtgatctgc cctttccatc cgatctcatt aactacgctc 300

accacgtgaa ctcgtcctcc ctcaccactt cccaaggcgt tgaagccgct cgtctcgtgt 360

cccaggttta cggggagcaa gttcctttcg accacgttta tccatctggt tcagcaacct 420

actgtcccgg tgccgtcgcc aacgctatct ctcggcttat ggcaggtttt gtgcctcagg 480

aaggtgacga tttcatgccg actggtccaa tcgattatct cgcagctgat cttgtggcgt 540

acaagtttgt tttaccgtat atgttagata tggtggatgg acgtccccaa attgtgctac 600

cctctcacac cgttgaggaa atgttgactg acactggcct gctgaatgct attgatgcct 660

catttggcat tgagtctaaa agtgatcaac gcatgacgcg tgatgctgct gagatgagct 720

ctcgttcgct caatgagtta gagaaccatg aacatcgcgg gcgcatgccg tggaagatta 780

tgcttgctat gatggccgcg caactgaagc ttgaactgga cgcattagca gacgaacgca 840

ctgagtctca ggctaacgct catgttacat ccttcggctc acgtctattc aatcagatgt 900

cagcctttgt gcctatcgat cgtgagttga tggagcttgc tctcctaatc aaagaacaag 960

gctttgccat gaatcctggt caggttgcgg ccaaatggtc gtctattagg aggtccagtg 1020

cagtacgttc cctggcgagt gcgcgtcttg agattcgaaa tgggaactgg atgatccgcg 1080

aaggcgacca gacgctgctg tctgtctctc cagctaggat ggcgtagacg ggacccatgg 1140

tgtgggtgag gggggccacg acctctgcca cgacttggac tcttattcat c 1191

<210> 13

<211> 980

<212> DNA

<213> sigma C Gene

<400> 13

tacgcctgat actttccctt ggatcgcaac gaggtgatac gcctgatact ttccctcctc 60

ccctaccagt caagcgacgt cgatcatttg acgacacaga tcaaatccct ccaaagcgcc 120

gtcgactcac tgaaagaatc acaagtggta gtgttgagac gcctgactac gattacgtcg 180

acggtggcgg atctacaatc aacaactgaa ttgttgacct cacaggtggc aggacttagt 240

tcccgtgtgg cttcagtgac tgatgaggta gtccgtgtaa attcagtgat tggaactacg 300

atcactaatc ttgacaatgt ccggtccgag ctatcctctc tctcctccca agtctcgtcg 360

cagacgtcca ctctaacgaa tcttacatca accgtttcat cccagtctct tgcgatttct 420

gatctccagc gacgagttac ggccttagaa cgatcgggtg gtgcgccgac acaatttgaa 480

gctcccttgc acctacaaaa cggagtcgtc tcactccaag catctccctc tttctgttct 540

ttgtctccga tcctctccgg acctgctgat gctgctgttt tcaaggttgg tgagtggctg 600

ggaactgtca tatctatgaa cgtgcggatt cattcatttg ggcagcggac catgttgctt 660

atgtcttcgc aaaatgtatt cactattccg ccaggttcgg gtgcgtcttt gcagctagat 720

gtgaatcgta taacgacccc tgccattgac gctgctatgg taactccttc cgctgctttt 780

gcttctgctt cctttatggc tgacatagct ttcaaagact ctaagacagg agaagtccat 840

gctttacaca ctactggctc ttttcgatca ccttctttct ctatcgtttg ggtcccggtt 900

gcttcggaaa ctcgtaatta tcaaataatg gcgttacgct tcaccgtcgc cacggggcgc 960

aatgagaaga gctattcatc 980

Claims

1. An indirect ELISA detection kit for detecting a novel duck reovirus antibody is characterized by comprising an ELISA plate coated with a novel duck reovirus sigma C protein recombinant antigen; the preservation number of the novel duck reovirus is CCTCC NO: v201843.

2. The indirect ELISA detection kit of claim 1, wherein the novel recombinant antigen of sigma C protein of duck reovirus is prepared by the following method:

the sequences of the primer pairs are respectively shown as SEQ ID NO.1 and SEQ ID NO. 2.

3. The indirect ELISA detection kit of claim 2, wherein the recombinant expression vector is transformed into BL21(DE3) competent cells, and IPTG is added for induction expression; and (3) denaturing and renaturing the expression product to obtain the purified novel duck reovirus sigma C protein recombinant antigen.

4. The indirect ELISA detection kit of claim 1, wherein the novel recombinant antigen of duck reovirus σ C protein is coated in an amount of 500 ng/well.

5. The indirect ELISA detection kit of any one of claims 1 to 4, wherein said indirect ELISA detection kit further comprises: enzyme-labeled antibody, sample diluent, washing liquid, negative control serum, positive control serum, substrate developing liquid A, B and stop solution.

6. The indirect ELISA detection kit of claim 5 wherein the enzyme-labeled antibody is an enzyme-labeled goat anti-duck antibody.

7. Use of the indirect ELISA detection kit of any one of claims 1-6 in epidemiological investigations of novel duck reoviruses;

the preservation number of the novel duck reovirus is CCTCC NO: v201843.

8. A novel indirect ELISA detection method for duck reovirus antibody is characterized by comprising the following steps:

(5) substrate color development: TMB color development liquid of 100 mu L/hole is protected from light for 15min at the temperature of 37 ℃;

(7) determination of negative and positive cut-off values: according to the formula: negative-positive cut-off value (negative sample OD)₄₅₀The average value plus the standard deviation of 3SD to obtain a positive and negative critical value; when OD is reached₄₅₀When the number is more than 0.072, the judgment result is positive.

9. The indirect ELISA detection method of claim 8, wherein in step (1), the novel duck reovirus σ C recombinant protein is prepared by the following method: