CN113321721B

CN113321721B - Extracellular Ezrin protein and application thereof

Info

Publication number: CN113321721B
Application number: CN202110654153.8A
Authority: CN
Inventors: 王理; 喻风雷; 李嵬; 胡琪康; 刘文亮
Original assignee: Second Xiangya Hospital of Central South University
Current assignee: Second Xiangya Hospital of Central South University
Priority date: 2021-06-11
Filing date: 2021-06-11
Publication date: 2022-06-03
Anticipated expiration: 2041-06-11
Also published as: CN113321721A; CN114699507A

Abstract

The invention discloses an extracellular Ezrin protein and application thereof. The invention discovers secreted Ezrin protein in bronchoalveolar exudate and breast milk for the first time. The protein is also found to be highly expressed in various cavity mucous membranes communicated with the outside of the human body, such as gastric mucosa, intestinal mucosa, gallbladder mucosa, placenta chorion, endometrium and the like. Further experiments show that intracellular Ezrin can inhibit the proliferation of tumor cells, and secretory Ezrin does not influence the proliferation capacity of the cells. Secreted Ezrin can significantly inhibit the ability of leukocytes to infiltrate through the basement membrane, which is hardly available in intracellular Ezrin. The result shows that extracellular secretory Ezrin has strong immunosuppressive function, and is expected to become a new way for developing the medicine for treating immune-related diseases.

Description

Extracellular Ezrin protein and application thereof

Technical Field

The invention belongs to the technical field of immunosuppressive research, and particularly relates to extracellular Ezrin protein and application thereof.

Background

The Ezrin protein is considered as a membrane-cytoskeleton connection protein, and the coding gene of the Ezrin protein is positioned in chromosome 6q25.2-26, the full length of the Ezrin protein is 586 amino acids, and the relative molecular weight is 81 KD. Was first purified by Bretscher et al in 1983 within the brush border of chicken small intestine epithelial cells. Ezrin belongs to the intracellular ERM family. The members of the family have high homology and are relatively conservative families. The Ezrin molecular structure mainly comprises 3 parts: 1. a highly conserved amino-terminal FERM region that binds to membrane proteins; 2. an alpha helical domain connecting region; 3. the carboxy terminus is the actin binding region. Ezrin has two states in cells, when the Ezrin exists as a monomer, the amino end and the carboxyl end in the molecule are combined together, so that the Ezrin cannot be combined with actin, and the Ezrin is in an inactivated state; when it is activated (tyrosine, serine/threonine are phosphorylated), the N-terminal and C-terminal binding sites are exposed, the amino terminal is bound with membrane protein, and the carboxyl terminal is bound with actin cytoskeleton, thereby playing an important role of bridging, participating in interaction, signal conduction and growth control between cytoskeleton and cell membrane, and having important regulation functions on cell morphology, differentiation, movement, cell-cell adhesion and cell-matrix adhesion. The Ezrin can be combined with membrane protein, cell adhesion molecules CD44, CD95, CD43, ICAM-1, ICAM-2, ICAM-3 and the like, and can also be combined with intracytoplasmic proteins such as Actin, Tublin, EBP50, E3KARP, MBS, Db1, PKA, RhoGDi and the like, and the combination research shows that the Ezrin is highly expressed in a plurality of malignant tumors (lung cancer, osteosarcoma, breast cancer, endometrial cancer, colon cancer, melanoma, prostatic cancer, nasopharyngeal cancer and the like). The high expression of Ezrin plays a key role in the development of tumors, especially in the metastasis of tumors.

To date, much research on Ezrin has focused on intracellular functional studies, which are thought to be intermediary linker molecules linking cell membrane molecules to the cytoskeleton, thereby mediating and participating in various physiological functions. The ubiquitinated Ezrin is found to be present in bronchoalveolar secretory liquid when the ubiquitination proteomics identification research is carried out on a bronchoalveolar secretory protein sample (alveolar lavage liquid). Because bronchoalveolar secretions are primarily secreted proteins, Ezrin appears in bronchoalveolar secretions, strongly suggesting that Ezrin may be a secreted protein. Western blot also subsequently confirmed that Ezrin is not only abundantly present in bronchoalveolar secretions, but also abundantly expressed in human breast milk. The detection of Ezrin expression in several normal human tissues by using immunohistochemistry shows that Ezrin is high expressed not only in the bronchial mucosa of lung but also in various cavity mucosa communicated with the outside, such as gastric mucosa, intestinal mucosa, gallbladder mucosa, placenta chorion, endometrium, etc. Interestingly, Ezrin has a polar expression profile in mucosal cells, and is mainly expressed centrally at the apical side of various luminal epithelial cells close to the lumen. This result suggests that Ezrin can be secreted by these mucosal epithelial cells, and that secretion is directed extraluminal. In an in vitro cell experiment, the recombinant Ezrin expression vector is transfected into 293FT cells, after 48 hours, the release of Ezrin out of the cells can be detected in culture supernatant, the expression is enhanced along with the increase of time, and the peak is reached at 96 hours. After the Ezrin gene is knocked out by using the CRISPR/Cas9 technology, Ezrin expression cannot be detected in cells and culture supernatant. Meanwhile, after the cell culture supernatant is subjected to exosome separation, all components are detected, and the result proves that Ezrin is not expressed in exosomes but is intensively expressed in non-exosome components. The above results fully indicate that Ezrin can be secreted extracellularly by cells to form secreted Ezrin.

The culture supernatants of various lung cancer cell strains and normal cell strains are detected, and the result shows that the expression level of secretory Ezrin in the supernatant of the lung cancer cell strain is obviously higher than that of the normal cell strain. The non-small cell lung cancer biopsy tissues and the paracancer normal lung tissues matched in 2 cases are subjected to primary culture for 48 hours in a short period, and the secretory level of Ezrin in the culture supernatant of each sample is detected, so that the secretory type Ezrin in the culture supernatant of the cancer tissues is obviously higher than the secretory level of the paracancer normal tissues. The same immunohistochemistry showed that the Ezrin expression level in the cancer cells in the biopsy lung cancer tissues was also significantly increased. These results show that non-small cell lung cancer synthesizes great amount of Ezrin inside cell and secretes Ezrin to outside tumor cell to take part in biological function, and the level of Ezrin secreted from lung cancer cell is obviously raised.

Subsequent studies found that extracellular secretory Ezrin has a strong immunosuppressive function. Therefore, the Ezrin gene in the lung cancer cell line HCC827 is knocked out by using the CRISPR/Cas9 technology, so that no Ezrin is expressed inside and outside the cell. In-vitro proliferation and invasion experiments and nude mouse tumorigenicity experiments all prove that after Ezrin is knocked out, the proliferation capacity and invasion capacity of lung cancer cells can be obviously inhibited. However, treatment of Ezrin-depleted lung cancer cells with purified recombinant secreted Ezrin protein restored extracellular Ezrin levels (without restoration of intracellular Ezrin) and did not reverse the ability to restore lung cancer cell proliferation. This suggests that intracellular Ezrin can inhibit the proliferation of tumor cells, while secreted Ezrin does not affect the proliferative capacity of cells. The lung cancer cells with the Ezrin knocked out and peripheral blood white cells are co-cultured (transwell chamber co-culture is carried out, the upper chamber is white blood cells, the middle chamber is matrigel, and the lower chamber is the lung cancer cells), and the lung cancer cells with the Ezrin knocked out can obviously improve the recruitment capacity of immune cells, and the number of the immune cells infiltrating tumor cells through a basement membrane is obviously increased. The purified recombinant extracellular Ezrin protein and intracellular Ezrin are further used for treating peripheral blood leukocytes respectively, and the extracellular Ezrin protein is found to obviously inhibit the infiltration capacity of the leukocytes for passing through a basement membrane, while the Ezrin expressed in the cells hardly has the capacity and has no influence on the infiltration capacity of the leukocytes. This result strongly suggests that: only extracellular secreted Ezrin has a strong immunosuppressive function. The antibody capable of specifically recognizing and combining with the naturally active secretory Ezrin protein is used for blocking the secretory release of tumor cells or artificially adding the secretory Ezrin protein, so that the infiltration of white blood cells can be obviously promoted. In a mouse in-vivo experiment, the LLC cell tumorigenic mouse is treated by antibody injection (specifically identified and combined with naturally active secretory Ezrin protein, Clone A02), so that the growth of mouse transplanted tumors can be obviously inhibited. It is fully demonstrated that the antibody can effectively recognize naturally active secretory Ezrin protein, and can release the inhibitory action of secretory Ezrin protein on immune cells, thereby exerting the anti-tumor effect.

In summary, the extracellular secretory Ezrin protein is a newly discovered secretory protein for the first time, and has an immunosuppressive function, and the inhibition or neutralization of the secretory Ezrin can play an immune activation function. Therefore, extracellular secretory Ezrin protein has important significance in immune regulation.

Disclosure of Invention

The primary object of the present invention is to provide an extracellular Ezrin protein.

The protein is secreted to the outside of cells by cells, and the amino acid sequence comprises at least one of a sequence shown as SEQ ID No.1 and a sequence with the similarity of more than 82 percent with the sequence shown as SEQ ID No. 1.

Further comprising: as shown in SEQ ID No.1, and at least one of the sequences with the similarity of more than 94 percent with the sequence shown in SEQ ID No. 1.

Further comprises at least one of the sequence shown as SEQ ID No.1 and the sequence with the similarity of more than 96 percent with the sequence shown as SEQ ID No. 1.

Further comprising: as shown in SEQ ID No.1, and at least one of the sequences with the similarity of more than 97 percent with the sequence shown in SEQ ID No. 1.

Most preferably: at least one of the sequences shown in SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6.

The extracellular Ezrin protein can be secreted out of cells, has the function of immunosuppression, and further has the function of inhibiting leucocytes.

The invention proves that secreted Ezrin is abundantly present in bronchoalveolar exudate and breast milk in a body fluid specimen. The constructed eukaryotic expression vector of Ezrin is transfected into 293FT cells, and the release of Ezrin out of the cells can be detected in culture supernatant. After the 293FT cell Ezrin gene is knocked out, Ezrin expression cannot be detected in cells and culture supernatant. Meanwhile, Ezrin can be secreted extracellularly by cells, and the secretion mode does not depend on an exosome pathway.

The present invention analyzes the degree of similarity of Ezrin among different species. The protein sequence of Ezrin is present in many species, and the homology between the protein sequence of rabbit (Orycolagus cuniculus) and the protein sequence of human Ezrin is 94% (551/586), i.e. 551 of 586 amino acids are completely identical; the homology between the protein sequence of African clawed toad (Xenopus tropicalis) and that of human Ezrin is 82% (482/586), i.e. there are 482 amino acid molecules identical; the same sequence homology to Ezrin protein compared to mice (Mus musculus) was 97% (566/586); the Ezrin protein sequence homology was 96% compared to rat (Rattus norvegicus) (565/586); the sequence homology of Ezrin protein compared to bovine (Bos taurus) was 94% (553/586).

Further, leukocyte invasion experiments were carried out on human-derived secreted Ezrin protein Ezrin (H) (SEQ ID No.1), rabbit-derived secreted Ezrin protein Ezrin (O) (SEQ ID No.2), Xenopus-derived secreted Ezrin protein Ezrin (X) (SEQ ID No.3), mouse-derived secreted Ezrin protein Ezrin (M) (SEQ ID No.4), rat-derived secreted Ezrin protein Ezrin (R) (SEQ ID No.5), bovine-derived secreted Ezrin protein Ezrin (B) (SEQ ID No. 6): using a transwell chamber with a 5 micron pore size, 30 microliters of BD Matrigel (1:2 dilution) was added to the upper chamber and 2X 10 was added to the upper chamber⁶Human peripheral blood leukocytes, ezrin (H), ezrin (O), ezrin (X), ezrin (M), ezrin (R) and ezrin (B) were added to the lower chamber, and the number of leukocytes infiltrating into the lower chamber was observed and measured. It was found that secreted Ezrin proteins from rabbit, xenopus, mouse, rat, and cow sources, as well as those from human sources, also significantly inhibit the chemotactic motor ability of leukocytes to cross the basement membrane. This shows that the secretory Ezrin protein with similar sequence from different sources also has the function of immunosuppression on human leucocyte.

The second purpose of the invention is to provide a nucleic acid sequence for expressing the extracellular Ezrin protein.

The third purpose of the invention is to provide the application of the extracellular Ezrin protein in preparing immunosuppressant, further, in preparing leucocyte inhibition preparation, and further, in preparing in vitro leucocyte inhibition preparation.

The immunosuppression is related to various diseases related to immune overactivation, including at least one of severe infection or inflammatory reaction, shock, allergic diseases, xenogenic tissue organ transplantation, rheumatic diseases and various systemic autoimmune diseases.

Further, each systemic autoimmune disease includes: hyperthyroidism, type 1 diabetes, idiopathic platelet purpura, autoimmune hemolytic anemia, polyneuritis, ulcerative colitis, chronic liver disease, glomerulonephritis, rheumatoid arthritis, and various skin diseases including systemic lupus erythematosus, scleroderma.

The fourth purpose of the invention is to provide an immunosuppressant, which comprises the extracellular Ezrin protein.

The fifth purpose of the invention is to provide a leucocyte inhibitor, which comprises the extracellular Ezrin protein.

According to the invention, an Ezrin-knocked HCC 827F 9 cell (incapable of secreting Ezrin to the outside of cells) and an undeleted negative control HCC827 cell (capable of secreting Ezrin to the outside of cells) are respectively co-cultured with peripheral blood leukocyte (transwell chamber co-culture, leukocyte in the upper chamber, matrigel in the middle and lung cancer cell in the lower chamber), and the finding shows that the lung cancer cell after the Ezrin is knocked out can obviously improve the recruitment chemotactic capacity of immune cells, and the number of the immune cells which gather to tumor cells through a basement membrane is obviously increased. Further adding purified recombinant secretory Ezrin protein into the lower chamber, the chemotactic movement ability of leucocyte passing through a basement membrane can be obviously inhibited; while the number of cells infiltrating through matrigel by the leucocytes of the lower ventricular nonsecretory Ezrin group is significantly increased. This result strongly suggests that: the secreted Ezrin has strong immunosuppressive function.

It was further found that leukocytes were treated with recombinant secreted Ezrin protein (Ezrin-extra) and recombinant intracellular Ezrin protein (Ezrin-intra), respectively. The secretory Ezrin protein (Ezrin-extra) can obviously inhibit the chemotactic movement ability of white blood cells to pass through a basement membrane; the number of cells infiltrating through matrigel by leukocytes is obviously increased in the group without secretory Ezrin and the group with recombinant intracellular Ezrin protein (Ezrin-intra). The two comparisons have statistical difference p < 0.01. This indicates that secreted Ezrin, rather than intracellular Ezrin protein, exerts an immunosuppressive function only when secreted outside the cell, whereas Ezrin protein released from the cell by cell disruption does not have an immunosuppressive activity.

The immune system is an important link in maintaining the balance of the body. However, in some cases, an overactivated immune response can have serious consequences, such as severe inflammatory reactions, shock, allergic reactions, graft rejection and autoimmune reactions. The autoimmune reaction ultimately damages various tissues and organs to cause autoimmune disease of various systems. The secreted Ezrin protein has powerful immunosuppressive effect, so that it has the functions of resisting inflammation, resisting allergy, resisting shock, inhibiting non-specific immunity, etc. and can prevent immune inflammation and pathological immune reaction and inhibit over-activated immune reaction effectively.

The sixth purpose of the present invention is to provide the use of the extracellular Ezrin protein in the preparation of an immune activator, further, in the preparation of a reagent for inactivating the extracellular Ezrin protein in an immune inhibitory function, and further, in the preparation of an antibody binding to the extracellular Ezrin protein.

The disease treated by the immune activator comprises at least one of tumor, lung cancer, esophageal cancer, osteosarcoma, breast cancer, endometrial cancer, gastric cancer, colon cancer, rectal cancer, melanoma, prostate cancer, liver cancer, nasopharyngeal cancer, brain glioma, leukemia, lymphoma, oral cancer, laryngeal cancer, tongue cancer, bladder cancer, kidney cancer, penile cancer, pancreatic cancer, cervical cancer and ovarian cancer.

It is a seventh object of the present invention to provide an immunoactivator comprising an agent for inactivating the immunosuppressive function of said extracellular Ezrin protein, further comprising an antibody that binds to the extracellular Ezrin protein.

An eighth object of the present invention is to provide an agent which can inactivate the immunosuppressive function of said extracellular Ezrin protein.

The ninth purpose of the invention is to provide an antibody capable of binding to the extracellular Ezrin protein.

The Clone A02 monoclonal antibody prepared by the invention can effectively recognize naturally active secretory Ezrin protein, while compared with a commercial monoclonal antibody EP924Y (abcam company) for recognizing intracellular cytoplasmic Ezrin, the antibody can not effectively recognize naturally active secretory Ezrin protein but only can recognize denatured Ezrin protein.

The preparation for treating the immunosuppressive diseases comprises but is not limited to Clone A02 monoclonal antibody, and other active Ezrin antibodies capable of specifically recognizing and binding extracellular secretion can be used, and the invention only takes Clone A02 monoclonal antibody as an example to prove that the antibody can achieve the effect of binding the Ezrin.

In vitro cell experiments show that the Clone A02 antibody can effectively block Ezrin protein secreted and released by tumor cells, and obviously promote infiltration of white blood cells. The EP924Y antibody, on the other hand, does not recognize secreted Ezrin protein and does not promote leukocyte infiltration.

Finally, in vivo experiments of mice also prove that the growth of mouse transplantation tumor can be obviously inhibited by carrying out the injection treatment of Clone A02 antibody on LLC cell tumor-forming mice. And the EP924Y antibody injection treatment mice and the negative control group have no difference.

It is fully demonstrated above that the inhibition of extracellular secreted Ezrin protein functions to actually treat immunosuppressive diseases, and that means for inhibition include, but are not limited to, specific antibodies designed against extracellular secreted Ezrin protein. The experimental result that the monoclonal antibody for recognizing intracellular cytoplasmic Ezrin can not recognize extracellular secretory Ezrin protein further proves that the extracellular secretory Ezrin protein is different from the intracellular Ezrin protein.

The tenth purpose of the invention is to provide a suspension cell strain which expresses the secretory Ezrin protein in a large quantity. Further, the construction method comprises any one of the following methods:

the method comprises the following steps:

1) constructing eukaryotic expression vector plasmid of the Ezrin protein gene;

2) transfecting eukaryotic expression vector plasmids of Ezrin genes into adherent cells;

3) domesticating adherent cells into suspension culture cells;

the second method comprises the following steps:

1) domesticating adherent cells into suspension culture cells;

2) constructing eukaryotic expression vector plasmid of the Ezrin protein gene;

3) eukaryotic expression vector plasmids of Ezrin genes are transfected into suspension culture cells.

The previous recombinant secretory Ezrin protein is based on adherent cells, culture supernatant of the adherent cells is taken for separation and purification, and the expression yield is low. Therefore, the invention constructs a cell strain for stably expressing N-twin-strep II-Ezrin 293 FT; successfully domesticating adherent cells into a suspension culture cell strain; the density of cultured cells can reach 6 x 10⁶The activity of the cells per ml can reach more than 90 percent. Provides guarantee for the convenience of large-scale purification of secreted Ezrin protein in the next step.

Adherent cells refer to cells growing adherently, including 293 cells or CHO cells. Adherent cells of tumor cells may also be domesticated.

At present, with the deep research of the immunosuppressive mechanism of tumors, the immunotherapy of tumors is greatly developed. As a plurality of mechanisms for inhibiting immune response are evolved in the process of occurrence and development of the tumor, an immunosuppressive microenvironment is formed, and the activation and the function exertion of immune cells in the tumor microenvironment are limited, so that immune evasion is formed. The tumor immunotherapy mainly achieves the aim of eliminating tumor cells by activating and enhancing the immune system of a human body. In recent years, immunotherapy has been effective in treating solid tumors such as melanoma and lung cancer. Therefore, the secretory Ezrin is very hopeful to become a new tumor immunotherapy target and has very important scientific theoretical significance and clinical value.

Drawings

FIG. 1: schematic diagram of immunosuppressive mechanism of secreted Ezrin.

FIG. 2: the result of proteomics identification and analysis of human breast milk ubiquitination modification is that A is a secondary mass spectrogram of peptide segment ubiquitination modified by Ezrin 162 site K; b, identifying a ubiquitination site peptide fragment list of the top 5 of abundance by mass spectrum; identifying and counting 20 modified protein subcellular localization classes; d, functional enrichment analysis of the ubiquitination peptide fragment protein domain (domain); and carrying out negative logarithm (-log10) conversion on the p value obtained by applying Fisher's exact test, wherein the larger the converted value is, the more remarkable the enrichment of the functional type is.

FIG. 3: and carrying out GO analysis on 137 ubiquitination modified proteins obtained by the ubiquitination proteomics identification.

FIG. 4: and (3) performing KEGG analysis on 137 ubiquitination modified proteins obtained by the ubiquitination proteomics identification.

FIG. 5: ezrin has 5 newly added ubiquitination sites (143K, 209K, 211K, 344K and 438K) peptide fingerprint.

FIG. 6: the result of ubiquitination modification of Ezrin.

FIG. 7: immunohistochemical detection of Ezrin expression in various normal human body tissues includes detecting normal lung tissue; b, a local enlarged view of bronchial mucosa epithelium; c, alveolar tissue; esophageal mucosa epithelium; e and F are gastric mucosal epithelium, F is a partial enlargement of E; g is liver; h, pancreas; i, gall bladder epithelium; j, small intestine; k, placenta villi; l is endometrium.

FIG. 8: as a result of Ezrin being secreted extracellularly independent of the exosome pathway

Collecting human bronchoalveolar lavage fluid, precipitating secretory proteins by using a TCA method, and detecting the expression of Ezrin by Western blot; b, performing transient transfection on 293FT cells by using a pcDNA-n-Flag-Ezrin (a blank vector is purchased from invitrogen company) expression vector, collecting culture supernatants at 24 hours, 48 hours, 72 hours and 96 hours, performing immunoprecipitation by using Anti-Flag immunomagnetic beads (Bimake B26101), and detecting the expression of Ezrin by Western blot; the lower diagram shows that a piggybac transposition system is used for constructing a c-flag-Ezrin stable expression cell strain (the piggybac transposition system is purchased from SBI company), after cell plates are digested, cells are cultured by using a serum-free opti-MEM culture medium after being attached to the walls, supernatants at different times are respectively collected, secretory proteins are precipitated by a TCA method, and expression of Ezrin is detected by Western blot; c, knocking out 293FT cell Ezrin gene by using CRISPR/Cas9 technology, selecting different monoclonal WB for identification, wherein EZR-2 and EZR-3 respectively represent two different sgRNA sequences; carrying out TCA method precipitation on the supernatant of the positive clones F2, F3 and D4, and detecting the expression of Ezrin by Western blot (upper graph); NC is cell supernatant without knockout of Ezrin gene; collecting 293FT cell supernatant, precipitating exosome components by using an exosome purification reagent (invitrogen4478359), precipitating proteins by using a TCA method in the precipitated supernatant, and detecting CD81 and Ezrin expression by using two components through electrophoresis and Western blot; CD81 is an exosome-labeled protein, supernatant after SP exosome precipitation and SD exosome precipitation.

FIG. 9: results of high expression of secreted Ezrin in non-small cell lung cancer

A, the secretion of Ezrin in the culture supernatant of various lung cancer cell strains and normal bronchial epithelial cell strain BEAS-2B, inoculating 2X 10⁶Culturing the cells in a culture dish with the diameter of 60mm for 48 hours by using a serum-free opti-MEM culture medium, and detecting Western blot by taking 2ml of supernatant protein precipitated by a TCA method; b, carrying out short-term 48-hour primary culture on 2 matched non-small cell lung cancer biopsy tissues (C1 and C2) and paracancer normal lung tissues (N1 and N2), and detecting the secretion level of Ezrin in the culture supernatant of each sample by WB; immunohistochemical detection of Ezrin expression in non-small cell lung cancer biopsy.

FIG. 10: eukaryotic expression purification result of secreted Ezrin

A, performing affinity purification on 50ml of cell culture supernatant of 293FT stably expressed by N-twin-Strep II-Ezrin by using Strep-Tactin XT resin, performing electrophoresis on each component, and detecting the Ezrin by using Western blot; 1 and 2 are 1 ml and 200. mu.l of culture supernatant input after TCA precipitation is used, 3 is 10. mu.l of culture supernatant, 4-7 is 10. mu.l of Wash Buffer, 8-11 is 1-4 times of eluent, and the loading volume is 2. mu.l; and B, taking 8 microliter of eluent to carry out electrophoresis and then dyeing by Coomassie blue.

FIG. 11: the result of Ezrin knockout for obviously inhibiting the growth and invasion of lung cancer cells

A, knocking out Ezrin genes in a lung cancer cell strain HCC827 by using CRISPR/Cas9, and identifying protein expression of different cloned Ezrin by using Western blot; b, using HCC827NC control cells, EZR-1A11 and EZR-3F9 cells, respectively inoculating 2000 cells to a 96-well plate to carry out a cell proliferation CCK8 experiment for 9 days; c, plate cloning experiment; d, nude mouse tumorigenesis experiment; and E, matrigel invasion experiment.

FIG. 12: the result of the inability of secreted Ezrin to promote growth and proliferation of lung cancer cells

A, CCK8 cell proliferation experiment; b, plate cloning experiment shows.

FIG. 13: results of the secreted Ezrin significantly inhibiting the invasive migration capacity of peripheral blood leukocytes, especially T cells

A, an experimental design schematic diagram; b, after each treatment group is cultured for 48 hours, taking an inverted microscope picture in a lower chamber; c, lower chamber cell count statistical chart of each group.

FIG. 14: secreted Ezrin, but not intracellular Ezrin, significantly inhibited the ability of peripheral blood leukocytes to invade and migrate

A: transfecting N-twin-Strep II-Ezrin in 293FT cells to construct a stable expression cell strain, expressing N-twin-Strep II-Ezrin recombinant protein in an eukaryotic way, and performing affinity purification on the N-twin-Strep II-Ezrin in the cells by using Strep-Tactin XT resin (IBA) to successfully purify the Ezrin protein (Ezrin-intra) in the cells; b and C: adding peripheral blood leukocyte into upper chamber of transwell chamber, spreading matrix glue in the middle, adding recombinant secretory Ezrin protein (Ezrin-extra) and recombinant intracellular Ezrin protein (Ezrin-intra) into lower chamber, wherein the recombinant secretory Ezrin protein (Ezrin-extra) can obviously inhibit chemotactic movement ability of leukocyte passing through basement membrane; b is a statistical chart of C.

FIG. 15: establishment and identification of suspension cell strain for large-scale expression of secreted Ezrin

A: stably expressing c-twin-strep II-Ezrin 293FT 2 cell strain, domesticating the cell strain into a suspension culture cell strain, and expressing and purifying secreted Ezrin protein in large quantity; b: taking 1 ml of suspension culture supernatant of an N-twin-strep II-Ezrin 293FT cell strain and a c-twin-strep II-Ezrin 293FT F2 cell strain, precipitating with TCA, performing electrophoresis, and staining with Coomassie brilliant blue; m: MARKER, 1 and 2: n-twin-strep II-Ezrin 293FT supernatant, 3: c-twin-strep II-Ezrin 293FT F2 cell supernatant; c: taking 10 microliters of suspension culture supernatant of an N-twin-strep II-Ezrin 293FT cell strain and a c-twin-strep II-Ezrin 293FT F2 cell strain, directly performing electrophoresis, and detecting a recombinant secretory Ezrin protein containing strep tag by Western-blot; m: MARKER, 1 and 2: n-twin-strep II-Ezrin 293FT supernatant, 3: c-twin-strep II-Ezrin 293FT F2 cell supernatant.

FIG. 16: the Clone A02 antibody effectively recognizes the naturally active secreted Ezrin protein.

FIG. 17: the Clone A02 antibody effectively promoted the consequences of immune cell infiltration.

FIG. 18: results of significant inhibition of tumor growth by Clone a02 antibody in a mouse model.

FIG. 19: the secretory Ezrin of different species has the effect of inhibiting the human leukocyte immunity.

The specific implementation mode is as follows:

the following examples are intended to further illustrate the invention without limiting it.

The recombinant plasmids used in the examples of the present invention were as follows:

1. pcDNA-n-flag-Ezrin: in pcDNA3.1(+) plasmid (purchased from Invitrogen), n-flag-Ezrin gene sequence was inserted between EcoRI cleavage site and Not I cleavage site. The N-Flag-Ezrin is added with a Flag tag at the N terminal of the Ezrin sequence to facilitate detection. The vector is a eukaryotic expression vector.

2. PB 510B-c-flag-Ezrin: firstly, inserting a Flag tag sequence between an EcoRI enzyme cutting site and a Not I enzyme cutting site in a PB510B plasmid (purchased from SBI company) to construct a PB510B-c-Flag plasmid; and inserting an Ezrin gene sequence between the Xba I restriction site and the EcoRI restriction site of the PB510B-c-flag plasmid to construct the PB510B-c-flag-Ezrin plasmid. C-Flag-Ezrin is to add Flag tag at the C-terminal of Ezrin sequence to facilitate detection. The PB510B plasmid and the transposase Plasmid (PBT) form a piggybac transposition system (both purchased from SBI company), and can efficiently and actively integrate a recombinant gene into a chromosome to construct a stably expressed cell strain.

3. PB510B-N-twin-strep II-Ezrin: firstly, inserting a twin-Flag tag sequence between an Xba I restriction enzyme cutting site and an EcoRI restriction enzyme cutting site in a PB510B plasmid (purchased from SBI company) to construct a PB510B-N-twin-strep II plasmid; and inserting Ezrin gene sequence between EcoRI enzyme cutting site and Not I enzyme cutting site of PB510B-N-twin-strep II plasmid to construct PB510B-N-twin-strep II-Ezrin plasmid. N-twin-Strep II-Ezrin is formed by adding a twin-Strep II tag at the N terminal of an Ezrin sequence, wherein the twin-Strep II tag is formed by connecting two Strep II tags in series, can be combined with Strep-Tactin XT protein (IBA company product) in a high specificity manner, and is used for affinity purification of target protein. The PB510B plasmid and the transposase Plasmid (PBT) form a piggybac transposition system, and can efficiently and actively integrate recombinant genes into chromosomes to construct a stable expression cell strain.

4. PB510B-C-twin-strep II-Ezrin: firstly, inserting a twin-Flag tag sequence between an EcoRI enzyme cutting site and a Not I enzyme cutting site in a PB510B plasmid (purchased from SBI company) to construct a PB510B-C-twin-strep II plasmid; and inserting an Ezrin gene sequence between the Xba I enzyme cutting site and the EcoRI enzyme cutting site of the PB510B-C-twin-strep II plasmid to construct a PB510B-C-twin-strep II-Ezrin plasmid. The C-twin-Strep II-Ezrin is formed by adding a twin-Strep II tag at the C terminal of an Ezrin sequence, wherein the twin-Strep II tag is formed by connecting two Strep II tags in series, can be specifically combined with Strep-Tactin XT protein (IBA company product) and is used for affinity purification of target protein. The PB510B plasmid and the transposase Plasmid (PBT) form a piggybac transposition system, and can efficiently and actively integrate recombinant genes into chromosomes to construct a stable expression cell strain.

5. PX459-Ezrin-sgRNA 1: in the pSpCas9(BB) -2A-Puro plasmid (also called PX459, purchased from addrene, 48139), the sgRNA1 sequence was inserted into the BbsI cleavage site: 5'-GCAATCCAGCCAAATACAAC-3', SEQ ID No. 7. pSpCas9(BB) -2A-Puro is a CRISPR/Cas9 system plasmid, and can perform shearing knockout on an Ezrin gene under the action of Cas9 protein and sgRNA. Ezrin-sgRNA1 is sequence 1 targeting the Ezrin gene.

6. PX459-Ezrin-sgRNA 2: in the pSpCas9(BB) -2A-Puro plasmid (also called PX459, purchased from addrene, 48139), the sgRNA2 sequence was inserted into the BbsI cleavage site: 5'-GGTAAAGACTATCGGCCTCC-3', SEQ ID No. 8. pSpCas9(BB) -2A-Puro is a CRISPR/Cas9 system plasmid, and can perform shearing knockout on an Ezrin gene under the action of Cas9 protein and sgRNA. Ezrin-sgRNA2 is sequence 2 targeting the Ezrin gene.

7. PX459-Ezrin-sgRNA 3: in pSpCas9(BB) -2A-Puro plasmid (also called PX459, purchased from addrene, 48139), the sgRNA3 sequence was inserted into the BbsI cleavage site: 5'-GTACTTTGGCCTCCACTATG-3', SEQ ID No. 9. pSpCas9(BB) -2A-Puro is a CRISPR/Cas9 system plasmid, and can perform shearing knockout on an Ezrin gene under the action of Cas9 protein and sgRNA. Ezrin-sgRNA3 is sequence 3 targeting the Ezrin gene.

The construction method of the vector comprises the following steps:

construction of pcDNA-n-flag-Ezrin vector

1. Design of primers

An upstream primer:

5’

-ACTGAATTCGCCACCATGGACTACAAGGACGACGATGACAAGATGCCGAAACCAATCAA-3’SEQ ID No.10

a downstream primer: 5'-ACTGCGGCCGCTTACAGGGCCTCGAACTC-3', SEQ ID No. 11;

2. constructing a 50ul PCR reaction system by PCR amplification, and setting related parameters of a PCR instrument, wherein the specific system and parameters are as follows:

94 ℃, 2mins pre-denaturation 94 ℃,15 s denaturation 55 ℃, annealing 68 ℃, 30s, 35Cycles extension

3. And (3) performing 80V constant-voltage electrophoresis on the PCR product, performing gel recovery on the target fragment after the electrophoresis is finished, and performing enzyme digestion on the target fragment for 3 hours to perform gel recovery.

4. Preparation of linearized PB510B plasmid: the PB510B plasmid was digested simultaneously with EcoRI and Not I for 3 h at 37 ℃ and subjected to 80V electrophoresis again at constant pressure, after which gel recovery was carried out to recover the digested linearized PB510B plasmid.

5. The target fragment after digestion and the linearized PB510B plasmid after digestion are connected for 2 days at 4 ℃ by using T4 DNA ligase and Buffer thereof, and then transformation is carried out.

Reagent	Dosage of
		Ezrin fragments	6μl
PB510B vector	2μl
		T4 10XBuffer	1ul
T4 DNA	1ul
		Total of	10ul

6. The recombinant vector was transformed into the super competent bacterium, E.coli.

7. Shaking the bacteria: the single colony of bacteria is picked up by aseptic technique and inoculated in LB liquid culture medium, the temperature is 37 ℃, the rpm is 250, the bacteria is shaken over night, and the colony is picked up and sequenced correctly.

8. Extracting pcDNA-n-flag-Ezrin from the recombinant plasmid in the bacteria according to the instruction of the OMEGA plasmid extraction kit.

Construction of PB510B-c-flag-Ezrin

1. First, design of primers

C-Flag upstream primer: 5'-AATTCGACTACAAGGACGACGATGACAAGTAAGC-3' SEQ ID No.12

C-Flag downstream primer: 5'-GGCCGCTTACTTGTCATCGTCGTCCTTGTAGTCG-3' SEQ ID No.13

Ezrin upstream primer (Xba i): 5'-TGCTCTAGAATGCCGAAACCAATCAATGT-3' SEQ ID No.14

Ezrin downstream primer (ecori): 5'-ACTGAATTCCAGGGCCTCGAACTCGTCGA-3' SEQ ID No.15

2. Firstly constructing a c-flag-PB510B carrier, then inserting an Ezrin segment into the c-flag-PB510B carrier to construct a c-flag annealing segment 10ul system, which comprises the following steps

3. The PCR apparatus was set at 37 ℃ for 30 minutes, then at 95 ℃ for 5 minutes, followed by cooling at room temperature.

4. Taking the above product as mother liquor, adding 199ul ddH into 1ul₂And O is prepared into a 1:200 diluent to form double-stranded target DNA fragments.

5. Ligation of the fragment of interest to the vector

6. The linearized vector PB510B, the desired fragment, T4 DNA ligase and its buffer, prepared as described above, were added to a 0.6ml EP tube according to the instructions of the T4 DNA ligase kit. The specific reaction system is as follows:

reagent	Reagent
		c-flag annealing fragment	2μl
PB510B vector	2μl
		T4 10XBuffer	1ul
T4 DNA	1ul
		ddH₂O	4ul
Total of	10ul

Placing at 4 ℃, fully reacting for 2 days, transforming the recombinant vector into super competent bacteria escherichia coli,

7. shaking the bacteria: the single colony of bacteria is picked up in aseptic technique, inoculated in LB liquid culture medium, at 37 deg.C, 250rpm, shaken over night, and picked colony is sent for correct sequencing.

8. c-flag-PB510B was extracted from the bacteria according to the instructions of the OMEGA plasmid extraction kit.

9. Constructing a 50ul PCR reaction system by PCR amplification of Ezrin fragments, and setting related parameters of a PCR instrument, wherein the specific system and parameters are as follows:

annealing at 94 ℃, 2mins pre-denaturation 94 ℃,15 s denaturation 55 ℃ and 68 ℃, 30s and 35Cycles extension;

10. and carrying out 80V constant voltage electrophoresis on the PCR product, and carrying out gel recovery after the electrophoresis is finished. Then the target fragment is subjected to enzyme digestion for 3 hours and gel recovery is carried out.

11. Preparation of the Linear C-flag-PB510B plasmid: the C-flag-PB510B plasmid was digested simultaneously with Xba I and EcoRI for 3 hours at 37 ℃, and subjected to 80V constant voltage electrophoresis again, and after the electrophoresis was completed, the digested linearized C-flag-PB510B plasmid was recovered by gel. The enzyme digestion system is as follows

12. And (3) connecting the digested target fragment with the digested linearized C-flag-PB510B plasmid at 4 ℃ for 2 days by using T4 DNA ligase and Buffer thereof, and then carrying out transformation.

13. The recombinant vector was transformed into the super competent bacterium, E.coli.

14. Shaking the bacteria: the single colony of bacteria is picked up in aseptic technique, inoculated in LB liquid culture medium, at 37 deg.C, 250rpm, shaken over night, and picked colony is sent for correct sequencing.

15. The extraction of recombinant plasmids from bacteria was performed according to the instructions of the OMEGA plasmid extraction kit.

Construction of PB510B-N-twin-strep II-Ezrin

1. First, design of primers

twin-StrepII tag sequence:

5’

-GCCGAATTCATGGCTAGCGCATGGAGTCATCCTCAATTCGAAAAAGGTGGAGGTTCTGGCGGTGGATCGGGAGGTTCAGCGTGGAGCCACCCCCAGTTCGAGAAG-3’SEQ ID No.16

N-twin-StrepII-upstream primer: 5'-ACTtctagaATGGCTAGCGCATGGAGT-3' SEQ ID No.17

N-twin-StrepII-downstream primer: 5'-ACTGAATTCCTTCTCGAACTGGGGGTG-3' SEQ ID No.18

Ezrin upstream primer (ecori): 5'-ACTGAATTCATGCCGAAACCAATCAATGT-3' SEQ ID No.19

Ezrin downstream primer (Not i): 5'-ACTGCGGCCGCTTACAGGGCCTCGAACTC-3' SEQ ID No.20

2. The PB510B-N-twin-strep II vector is constructed first, and then the Ezrin fragment is inserted into the vector

3. PCR amplifying N-twin-StrepII, constructing 50ul PCR reaction system, setting the relevant parameters of the PCR instrument,

the specific systems and parameters are as follows:

carrying out 80V constant voltage electrophoresis on a PCR product, carrying out gel recovery after the electrophoresis is finished, and carrying out enzyme digestion on a target fragment for 3 hours for gel recovery.

4. Preparation of linearized PB510B plasmid: the PB510B plasmid was digested simultaneously with Xba I and EcoRI for 3 hours at 37 ℃ and subjected to 80V constant pressure electrophoresis again, after which gel recovery was carried out to recover the digested linearized PB510B plasmid. The enzyme digestion system is as follows

Reagent	Dosage of
		10XM	5μl
XbaⅠ	2μl
		EcoRⅠ	2ul
ddH₂O	33ul
		PB510B	8(3ugDNA)
In total	50ul

6. Shaking the bacteria: the single colony of bacteria is picked up in aseptic technique, inoculated in LB liquid culture medium, at 37 deg.C, 250rpm, shaken over night, and picked colony is sent for correct sequencing.

7. Extraction of recombinant plasmids from bacteria was performed according to the instructions of the OMEGA plasmid extraction kit PB 510B-N-twinII.

8. The PB510B-N-twin-StrepII plasmid is subjected to double enzyme digestion for 3 hours by using Ecor I and Not I, constant voltage electrophoresis of 80V is performed again, and after the electrophoresis is finished, glue is performed to recover the linearized plasmid after enzyme digestion.

9. The target fragment after enzyme digestion and the linearized PB510B-N-twin-StrepII particle after enzyme digestion are connected for 2 days at 4 ℃ by using T4 DNA ligase and Buffer thereof, and then transformation is carried out.

10. Shaking the bacteria: the single colony of bacteria is picked up in aseptic technique, inoculated in LB liquid culture medium, at 37 deg.C, 250rpm, shaken over night, and picked colony is sent for correct sequencing.

11. The extraction of recombinant plasmids from bacteria was performed according to the instructions of the OMEGA plasmid extraction kit, PB 510B-N-twin-StrepII-Ezrin.

Construction of PB510B-C-twin-strep II-Ezrin

1. First, design of primers

C-twin-StrepII-ECORI-upstream primer:

5’-ACTGAATTCATGGCTAGCGCATGGAGT-3’SEQ ID No.21

C-twin-StrepII-NotI-downstream primer:

5’-ACTGCGGCCGCtcaCTTCTCGAACTGGGGGTG-3’SEQ ID No.22

ezrin upstream primer (Xba i): 5'-TGCTCTAGAATGCCGAAACCAATCAATGT-3' SEQ ID No.23

Ezrin downstream primer (ecori): 5'-ACTGAATTCCAGGGCCTCGAACTCGTCGA-3' SEQ ID No.24

2. The PB510B-C-twin-strep II vector is constructed first and then the Ezrin fragment is inserted

3. PCR amplification C-twin-StrepII, construction of 50ul PCR reaction system, setting of PCR instrument related parameters, specific system and parameters are as follows:

4. And (3) performing 80V constant-voltage electrophoresis on the PCR product, performing gel recovery after the electrophoresis is finished, and performing enzyme digestion on the target fragment for 3 hours to recover gel.

5. Preparation of linearized PB510B plasmid: the PB510B plasmid was digested simultaneously with Ecor I and Not I for 3 hours at 37 ℃, and subjected to 80V constant pressure electrophoresis again, after which gel recovery was performed to recover the digested linearized PB510B plasmid.

Reagent	Dosage of
		10XBSA Buffer	5μl
10XH Buffer	5μl
		EcoRⅠ	2ul
NotⅠ	2ul
		ddH₂O	28ul
PB510B	8(3ugDNA)
		In total	50ul

6. The target fragment after digestion and the linearized PB510B plasmid after digestion are connected for 2 days at 4 ℃ by using T4 DNA ligase and Buffer thereof, and then transformation is carried out.

7. The recombinant vector was transformed into the super competent bacterium, E.coli.

8. Shaking the bacteria: the single colony of bacteria is picked up in aseptic technique, inoculated in LB liquid culture medium, at 37 deg.C, 250rpm, shaken over night, and picked colony is sent for correct sequencing.

9. C-twin-strep II-PB 510B was extracted from the recombinant plasmid in bacteria according to the instructions of the OMEGA plasmid extraction kit.

10. Preparation of Linear C-twin-strep II-PB 510B plasmid: the C-twin-strep II-PB 510B plasmid was digested simultaneously with Xba I and EcoRI for 3 hours at 37 ℃, and subjected to 80V constant pressure electrophoresis again, and after the electrophoresis was completed, the digested linearized C-flag-PB510B plasmid was recovered by gel. The enzyme digestion system is as follows

11. The target fragment after enzyme digestion and the linearized C-twin-strep II-PB 510B plasmid after enzyme digestion are connected for 2 days at 4 ℃ by using T4 DNA ligase and Buffer thereof, and then transformation is carried out.

12. Shaking the bacteria: the single colony of bacteria is picked up in aseptic technique, inoculated in LB liquid culture medium, at 37 deg.C, 250rpm, shaken over night, and picked colony is sent for correct sequencing.

13. The extraction of the recombinant plasmid from the bacteria was carried out according to the instructions of the OMEGA plasmid extraction kit, PB510B-C-twinII-strep II-Ezrin.

Construction of PX459-Ezrin-sgRNA1 PX459-Ezrin-sgRNA2 PX459-Ezrin-sgRNA3

1. Design of sgRNA

sgrna oligos 1: sense chain: 5'-CACCGgcaatccagccaaatacaac-3' SEQ ID No.25

Antisense chain: 5'-AAACgttgtatttggctggattgcC-3' SEQ ID No.26

sgRNAOligos2：

sense chain: 5'-CACCGggtaaagactatcggcctcc-3' SEQ ID No.27

Antisense chain: 5'-AAACggaggccgatagtctttaccC-3' SEQ ID No.28

sgRNAOligos3：

Sense chain: 5'-CACCGgtactttggcctccactatg-3' SEQ ID No.29

Antisense chain: 5'-AAACcatagtggaggccaaagtacC-3' SEQ ID No.30

2. Preparation of linearized plasmid PX459

(1) Construction of Bbs1 enzyme digestion of px459 plasmid 50ul

The systems are respectively added into a 1.5ml microcentrifuge tube, put into a 37 ℃ water bath box, and subjected to water bath for 2 hours for full reaction and digestion to recover the gel.

3.3 groups of sgRNA-Oligos annealing fragment 10ul systems are respectively constructed, and the specific steps are as follows:

the PCR apparatus was set at 37 ℃ for 30 minutes, then at 95 ℃ for 5 minutes, followed by cooling at room temperature.

4. Taking 1ul of the product as mother liquor, adding 199ul ddH2O into the mother liquor to prepare 1:200 diluent to form a double-stranded target DNA fragment, and connecting the sgRNA target fragment with a vector;

(1) the linearized vector PX459, the target sgRNA fragment, T4 DNA ligase and its buffer prepared above were added to a 0.6ml EP tube according to the T4 DNA ligase kit instructions.

sgRNA fragment	2μl
		Px459 vector	2μl
T4 10XBuffer	1ul
		T4 DNA	1ul
ddH₂O	4ul
		Total of	10ul

The 3 tubes of EP tube are placed at 4 ℃ and fully reacted for 2 days to obtain complete circular recombinant plasmid with sgRNA and Cas9 functions.

5. And (4) sequencing and identifying the recombinant plasmid.

Example 1: discovery and identification of secreted Ezrin

Human breast milk samples are collected in the early stage, ubiquitination modified proteins in the samples are enriched through high-efficiency ubiquitination modified antibodies, and then qualitative research on ubiquitination proteomics is carried out on human breast milk by using a high-resolution liquid chromatography-mass spectrometry combined qualitative proteomics research strategy. A total of 35 ubiquitination sites located on 20 proteins were identified. Some of these proteins have been identified with multiple ubiquitination sites. The 162-bit K of Ezrin is identified by mass spectrum to be ubiquitinated and modified (figure 2A), and the mass spectrum identifies the peptide fragment list of ubiquitination sites of the top 5 of abundance (figure 2B); meanwhile, another member of the ERM family to which Ezrin belongs, namely Radixin 162, has also been identified as K for ubiquitination modification. The ERM family mainly comprises three members of Ezrin, radiaxin and Moesion; family members have high homology (70%) and are relatively conserved families. Since human breast milk is mainly a secretory protein, and Ezrin protein is present in human breast milk, it is strongly suggested that Ezrin protein may be a secretory protein.

Subcellular structure-directed classification statistics were performed on the 20 modified proteins identified, of which only 2 (10%) were considered extracellularly localized secreted proteins and the remaining 90% were not classical secreted proteins (fig. 2C). This suggests that ubiquitination modification may be a novel specific protein secretion pathway.

For all annotations identified as containing modified site proteins, protein domain (domain) functional enrichment analysis was performed to determine whether the modified proteins had significant enrichment trends in certain functional types. The FERM domains of the Ezrin family were found to have a very significant enrichment. This suggests that the FERM domain may have an important role in ubiquitination modification of secreted proteins (fig. 2D).

Example 2: bronchoalveolar exudate ubiquitination proteomics screening and identification

Collecting clinical human bronchoalveolar exudate specimens (alveolar lavage fluid), enriching ubiquitination modified proteins in the specimens through high-efficiency ubiquitination modified antibodies, and then performing ubiquitination proteomics qualitative research on the bronchoalveolar exudate by using a qualitative proteomics research strategy of high-resolution liquid chromatography-mass spectrometry. Bronchoalveolar exudate specimens of 7 patients are collected and mixed into one sample, and qualitative research of ubiquitination proteomics is carried out. 137 ubiquitination-modified proteins are identified in total from the bronchoalveolar exudate specimen, and 234 ubiquitination sites are identified in total. GO analysis is carried out on 137 ubiquitination modified proteins obtained by the present ubiquitination proteomics identification, and the results show that the proteins are closely related to immunity, and multiple pathways related to immunity are enriched in: 1. an anion-activating cell surface receiver signaling path, 2, an anion-activating signal transmission, 3, and an activation of anion-activating response (FIG. 3). KEGG analysis also showed that these proteins are closely related to immunity, involved in leukocyte migration and microbial infection, and enriched into 25 functional pathways, of which 8 are related to immunity and infection: 1. kaposi sarcoma-associated virus infection, 2, Leukocyte transduction mutation, 3, Pathogenic Escherichia coli infection, 4, Epstein-Barr virus infection, 5, Human immunodeficiency virus 1infection, 6, Epithelial cell signalling in Helicobacter pylori infection, 7, Bacterial infection of Epithelial cells, 8, B cell receptor signalling path (FIG. 4). Wherein Ezrin was still identified and 5 newly added ubiquitination sites were identified: 143K, 209K, 211K, 344K, 438K (fig. 5).

Example 3 demonstration of modification of secreted Ezrin by ubiquitination

To confirm whether ubiquitination modification of secreted Ezrin occurred. Transient transfection of 2. mu. gPB510B-N-twin-StrepII-Ezrin plasmid into 1.5X 10⁶293FT (293FT cell is one of human embryonic kidney epithelial cells) is used for rapidly expressing and secreting Ezrin in a short time, total protein in the supernatant of all cells is extracted by a TCA method after 24, 48 and 72 hours of culture respectively, and Ezrin protein in the supernatant is detected by using an Ezrin antibody (Millipore rabbit polyclonal antibody, 07-130); then, Anti-Flag immunomagnetic beads (Bimake B26101) are used for performing immunoprecipitation on the Ezrin recombinant protein, ubiquitin antibodies are used for detecting ubiquitin-modified protein, and as a result, secretory Ezrin protein is rich in supernatant, the Ezrin is ubiquitinated and modified, and the ubiquitin modification degree is increased along with the increase of the expression level of the Ezrin (see figure 6).

Example 4 expression profile of secreted Ezrin in physiological states

The expression of Ezrin in various normal human tissues of human body is detected by immunohistochemistry, and the Ezrin is highly expressed not only in the bronchial mucosa of lung but also in various lumen mucosa communicated with the outside of human body, such as gastric mucosa, intestinal mucosa, gallbladder mucosa, placenta chorion, endometrium, etc. (figure 7). And the expression distribution of Ezrin in mucosal cells has polarity, and the Ezrin is mainly and intensively expressed at the top end of various luminal epithelial cells close to the lumen side. This result suggests that Ezrin can be secreted by these mucosal epithelial cells, and that secretion is directed extraluminal.

FIG. 7A shows normal lung tissue, showing Ezrin expression in bronchial mucosa; b, a local enlarged view of bronchial mucosal epithelium, wherein Ezrin has polarity in the secretion of mucosal cells and is gathered at the top end of the lumen side; c, the expression of the alveolar tissue Ezrin is negative; esophageal mucosal epithelium, weak expression; e and F are gastric mucosal epithelium, F is a partial enlargement of E, Ezrin is expressed in parietal cells and secreted into the lumen, indicated by the arrow; g is liver negative; pancreatic, weak expression; gallbladder epithelium, Ezrin gathers at the top of the luminal side of mucosal cells, indicating secretion to the luminal side; j, small intestine, wherein Ezrin is gathered at the top end of the lumen side of the mucosal cell and is prompted to be secreted to the lumen side; k, placenta villi, Ezrin gathers on the top of the lumen side of the mucosa cell, and the secretion to the lumen side is prompted; endometrium, Ezrin accumulates at the luminal end of mucosal cells, suggesting secretion to the luminal side, as indicated by the arrow.

Samples of human bronchial mucus and breast milk body fluid were further collected, and Western blot detection using specific antibodies (rabbit polyclonal antibody, 07-130, Millipore corporation) confirmed that Ezrin protein was present in large amounts in bronchoalveolar exudate and breast milk (fig. 8A), and the above-mentioned mass spectrometry screening results were verified.

Example 5 in vitro cell experiments demonstrated that Ezrin can be secreted by cells

It was confirmed in body fluid specimens that secreted Ezrin is abundantly present in bronchoalveolar secretions and breast milk. In order to further confirm the existence of secreted Ezrin, a eukaryotic expression vector of Ezrin is constructed, a Flag-tagged Ezrin expression vector (pcDNA-n-Flag-Ezrin plasmid is used for transient transfection, and PB510B-c-Flag-Ezrin is used for stable transfection to establish cell strains) is transfected into 293FT cells, and the release of Ezrin out of the cells can be detected in culture supernatant regardless of transient transfection or stable transfection, and the expression is enhanced along with the increase of time, and reaches a peak value within 96 hours. After 293FT cell Ezrin gene is knocked out by using CRISPR/Cas9 technology, Ezrin expression cannot be detected in cells and culture supernatant. Meanwhile, after the 293FT cell culture supernatant is subjected to exosome separation, each component is detected, and the result proves that Ezrin is not expressed in exosomes but is intensively expressed in non-exosome components. These results indicate that Ezrin can be secreted extracellularly by cells in a manner that is independent of the exosome pathway. The method comprises the following specific steps:

FIG. 8A is a diagram of collecting bronchoalveolar lavage fluid from a human body, precipitating secreted proteins using a TCA method, and detecting Ezrin expression using Western blot; p1, P2, P3 represent three different patients; collecting breast milk samples, centrifuging by using 2000g of silica gel membrane centrifugal column with aperture of 1 mu m to remove fat particles, respectively taking 2 mu l and 5 mu l of samples for electrophoresis, and detecting the expression of Ezrin by Western blot; m is Marker; 8B, performing transient transfection on 293FT cells by using a pcDNA-n-Flag-Ezrin (a blank vector is purchased from invitrogen company) expression vector, collecting culture supernatants at 24 hours, 48 hours, 72 hours and 96 hours, performing immunoprecipitation by using Anti-Flag immunomagnetic beads (Bimake B26101), and detecting the expression of Ezrin by using Western blot; the lower diagram shows that c-flag-Ezrin stable expression cell strains (the piggybac transposition system is purchased from SBI company) are constructed by using a piggybac transposition system, after cell plates are digested, cells are cultured by using a serum-free opti-MEM culture medium after being adhered to the walls, supernatants at different times are respectively collected, protein is precipitated and secreted by a TCA method, and expression of Ezrin is detected by Western blot; 8C, the following figure shows that after 293FT cell Ezrin genes are knocked out by using CRISPR/Cas9 technology (PX459-Ezrin-sgRNA2+ PX459-Ezrin-sgRNA3), different monoclonal WB are selected for identification, and EZR-2 and 3 respectively represent two different sgRNA sequences (the sgRNA2 and the sgRNA 3).

Carrying out TCA method precipitation on the supernatant of the positive clones F2, F3 and D4, and detecting the expression of Ezrin by Western blot (upper graph); NC is cell supernatant without knockout of Ezrin gene; collecting 293FT cell supernatant, precipitating exosome components by using an exosome purification reagent (invitrogen, 4478359), precipitating proteins by using a TCA method in the supernatant after precipitation, carrying out electrophoresis on the two components, and detecting the expression of CD81 and Ezrin by Western blot; CD81 is an exosome marker protein, supernatant after SP exosome precipitation and SD exosome precipitation; ezrin is expressed only rarely in exosomes, but accumulates in large amounts in non-exosome components.

The method for knocking out the Ezrin gene of the cell by using the CRISPR/Cas9 technology comprises the following steps:

1) PX459-Ezrin-sgRNA1, PX459-Ezrin-sgRNA2 and PX459-Ezrin-sgRNA3 plasmids are transfected into target cells respectively.

2) 48 hours after transfection, puromycin screening was used for 24 hours.

3) The selected cells were cultured in a 96-well plate by picking up a single clone.

4) And (4) after the cloned cells grow to a sufficient number, carrying out knockout effect identification, and selecting a cloned cell strain with a good knockout effect.

Example 6 high expression of secreted Ezrin in non-small cell lung cancer

Detecting culture supernatant of various lung cancer cell strains and normal cell strains, inoculating 2 × 10⁶Culturing the cells in a culture dish of 60mm for 48 hours by using a serum-free opti-MEM culture medium, and detecting Western blot by taking 2ml of supernatant protein precipitated by a TCA method; the results show that the secretory Ezrin is highly expressed in H1299, H441, HCC827 and H125, is low in H520, H460 and BEAS-2B (H1299, H441, HCC827, H125, H520 and H460 are human lung cancer cells, BEAS-2B are human normal bronchial epithelial cells), and the expression level of the secretory Ezrin in the supernatant of most lung cancer cell strains is obviously higher than that of the normal cell strain BEAS-2B (FIG. 9A). After primary culture was performed on 2 paired non-small cell lung cancer biopsy tissues (C1 and C2) and paracancer normal lung tissues (N1 and N2) for a short period of 48 hours, the secretory level of Ezrin in the culture supernatant of each sample was measured, and it was found that the secretory Ezrin in the culture supernatant of cancer tissue was significantly higher than that of paracancer normal tissue (fig. 9B). The expression level of Ezrin in cancer cells was measured by IHC on 34 lung cancer biopsy specimens, and the results showed that 28 cases of medium/high expression accounted for 82.4%, 6 cases of low/no expression accounted for 17.4%, with statistical difference p<0.01, Ezrin was highly expressed in lung cancer biopsy specimens (FIG. 9C). These results indicate that non-small cell lung cancer is in the fine cellA large amount of Ezrin is synthesized in cells and secreted out of tumor cells to play a biological function, and the level of Ezrin secreted by lung cancer cells is obviously improved.

Example 7 eukaryotic expression purification of secreted Ezrin

In order to research the biological function of the secreted Ezrin, the purification and preparation of the active secreted Ezrin are essential key links. A piggybac transposition system is used for constructing an N-twin-strep II-Ezrin cell line stably expressing 293 FT. A twin-strep II tag is added at the N end of the Ezrin for downstream affinity purification experiments. The culture supernatant of the stably expressed cells was taken and affinity-purified for N-twin-Strep II-Ezrin using Strep-Tactin XT resin (IBA) to successfully obtain purified recombinant protein of secreted Ezrin (FIG. 10).

The method comprises the following specific steps:

purifying an Ezrin protein by a Strep-Tactin XT agarose gel method: the Strep-Tactin XT agarose gel FF is mainly used for purifying proteins with Strep II tag proteins, has the characteristic of small molecular weight (consisting of eight amino acids WSHPQFEK and having the molecular weight of 1kDa), generally does not influence the structure and the function of expressed fusion proteins, has extremely strong affinity to the Strep II tag, can be combined and dissociated with the Strep II fusion proteins under mild conditions, and is used for detecting and purifying the fusion proteins. the twin-Strep II tag is formed by connecting two Strep II tags in series, and the binding affinity of the tag and the Strep-Tactin XT protein is stronger.

1) 293FT cells expressing PB510B-N-twin-strep II-Ezrin fusion protein were cultured.

2) Inoculating cells, after the cells are fully paved into a 100mm culture dish, replacing 10% FBS 1640 culture medium to supplement 10ml, continuing to culture for 96 hours, and collecting culture solution.

3) The culture broth was centrifuged twice with a gradient to remove cell debris and impurities.

4) The culture broth was added to 150. mu.g avidin (Invitrogen)/10mL, and incubated at 4 ℃ for 15 minutes to remove endogenous biotin.

5) A Strep-Tactin XT Sepharose gravity purification column was equilibrated with 2 Column Volumes (CV) of wash buffer (100mM Tris/HCl, pH8.0,50mM NaCl,1mM EDTA).

6) Adding the culture solution in the step 4) into a balanced Strep-Tactin XT agarose gravity purification column, and enabling the culture solution to slowly pass through the Strep-Tactin XT purification column.

7) The Strep-Tactin XT purification column was washed 6 times with wash buffer, one Column Volume (CV) at a time.

8) After completion of the washing, elution was carried out using 0.6CVs elution buffer (100mM Tris-HCl, pH8.0, 150mM NaCl,1mM EDTA,50mM Biotin) to give elution fraction 1(E1), 1.6CVs elution buffer was added to give elution fraction 2(E2), and 0.8CVs elution buffer was added to give elution fraction 3(E3), respectively.

9) And (3) carrying out Western blot detection on the products of Elution1,2 and 3, and freezing to-80 ℃, thus obtaining the purified secretory Ezrin protein.

Example 8 knockout of Ezrin can significantly inhibit growth and invasion of lung cancer cells

The Ezrin gene in lung cancer cell line HCC827 is knocked out by using CRISPR/Cas9 technology (PX459-Ezrin-sgRNA1 and PX459-Ezrin-sgRNA2), and after screening single clones, protein expression of Ezrin in each clone cell is detected by using Western blot (FIG. 11A). A11 clone of the sgRNA No.1 sequence and F9 clone of the sgRNA No.3 sequence are positive clones, and two clones EZR-1A11 and EZR-3F9 from different target sequences are successfully selected. The expression of Ezrin protein was completely deleted in the EZR-1A11 and EZR-3F9 clones (fig. 11A). Cell proliferation CCK8 experiments were performed for a total of 9 days using HCC827NC control cells, EZR-1a11 and EZR-3F9 cells, seeded 2000 cells into 96-well plates, respectively, with significantly slower cell proliferation than EZR-1a11 and EZR-3F9 cells and NC groups, with p <0.01 (fig. 11B, C). It can be seen that CCK8 experiments and plate cloning experiments carried out by using EZR-1A11 and EZR-3F9 clones indicate that the growth of lung cancer cells can be obviously inhibited in vitro after the Ezrin expression is deleted. Nude mice tumor formation experiment, wherein compared with HCC827NC control group, the tumor volume is significantly reduced by p < 0.01; it was also demonstrated that the deletion of Ezrin significantly inhibited the growth of lung cancer cells in nude mice (fig. 11D). In vitro matrigel invasion assay, in comparison to HCC827NC control, the number of cells that crossed matrigel was significantly reduced with a statistical significance p <0.01, and also demonstrated inhibition of lung cancer cell invasion through matrigel after Ezrin knock-out (fig. 11E).

Example 9 restoration of extracellular Ezrin levels, failure to reverse restoration of proliferative capacity of Lung cancer cells

In HCC827 EZR-3F9 cells completely lacking Ezrin expression, cells were treated with purified secreted Ezrin protein to restore extracellular Ezrin levels (without restoring intracellular Ezrin), fig. 12A: CCK8 cell proliferation assay, HCC827 EZR-3F9 cells with or without secreted Ezrin protein, no statistical difference between treatment and PBS treatment; FIG. 12B HCC827 EZR-3F9 cells treated with or without secreted Ezrin protein, plate cloning experiments showed no significant difference between the Ezrin treated group and the PBS treated group.

It can be seen that both CCK8 cell proliferation experiments and plate cloning experiments indicate that the mere recovery of extracellular Ezrin expression does not reverse the recovery of lung cancer cell proliferation (fig. 12). This suggests that intracellular Ezrin can inhibit the proliferation of tumor cells, whereas secreted Ezrin does not affect the proliferative capacity of tumor cells themselves.

Example 10 secreted Ezrin significantly inhibited the invasive migration of peripheral blood leukocytes

The Ezrin-knocked-out HCC 827F 9 cells and the unblinded negative control HCC827 cells were co-cultured with peripheral blood leukocytes (transwell chamber co-culture, upper chamber leukocytes, middle matrigel-coated, lower chamber lung cancer cells) (upper two panels in FIG. 13A); using a transwell chamber with a 5 micron pore size, 30 microliters of BD Matrigel (1:2 dilution) was added to the upper chamber and 2X 10 was added to the upper chamber⁶Human peripheral blood leukocytes, the lower chamber is divided into a cell inoculation group and an Ezrin treatment group; the cell inoculation groups were inoculated respectively (inoculation amount 1X 10)⁵) HCC827 (Secrete EZR cells in fig. 13A) which secretes Ezrin in large quantities, or HCC 827F 9 (EZR KO cells in fig. 13A) which is an Ezrin knockout cell; it was found that the knockout of Ezrin can significantly improve the recruitment chemotactic capacity of immune cells, and the number of tumor cells aggregated by immune cells through a basement membrane is significantly increased (fig. 13B). The precise count of leukocytes in each lower chamber of each group was determined using a cell counter (Z2 Beckman Coulter): HCC827 group is 870813.3 + -14706.3, and HCC 827F 9 is 1377466.7 + -45202.1, with a statistical difference p in comparison<0.01 (fig. 13C). Further, the lower chamber of the transwell chamber co-culture was treated with purified secreted Ezrin (experimental group added secreted Ezrin protein 20ul every 24h, about 1ug secreted Ezrin, volume 20 ul) without adding any cells (upper chamber is white blood cells, middle-laid matrigel, lower chamber is medium with or without addition of secreted Ezrin only) (two panels in fig. 13A). The purified recombinant secretory Ezrin protein is added into the lower chamber, so that the chemotactic movement capability of leukocytes passing through a basement membrane can be obviously inhibited; while the number of cells infiltrating through matrigel by the leukocytes of the lower ventricular non-secretory Ezrin group was significantly increased (fig. 13B). The leukocyte penetration number of the secretory Ezrin treated group is 56226.7 +/-1971.4, the leukocyte penetration number of the negative control group is 258546.7 +/-2067.5, and the two groups have statistical difference p<0.01 (FIG. 13C). This result strongly suggests that: the secretory Ezrin has strong immunosuppressive function. Example 11 secreted Ezrin, but not intracellular Ezrin, significantly inhibited the ability of peripheral blood leukocytes to invade and migrate

Further, intracellular Ezrin protein (Ezrin-intra) was purified from the cells by eukaryotic expression and affinity purification (fig. 14A). Peripheral blood white cells are added into an upper chamber of a transwell chamber, matrix glue is paved in the middle, recombinant secretory Ezrin protein (Ezrin-extra) and recombinant intracellular Ezrin protein (Ezrin-intra) are respectively added into a lower chamber, and the chemotactic motion ability of the white blood cells passing through a basement membrane can be obviously inhibited through the recombinant secretory Ezrin protein (Ezrin-extra); while the leukocyte infiltration of the lower ventricular group without secreted Ezrin and the group with recombinant intracellular Ezrin protein (Ezrin-intra) increased significantly in the number of cells penetrating the matrigel (FIG. 14B, C). The two comparisons had a statistical difference p <0.01 (fig. 14B, C). This indicates that secreted Ezrin, rather than intracellular Ezrin protein, exerts an immunosuppressive function only when secreted outside the cell, whereas Ezrin protein released from the cell by cell disruption does not have an immunosuppressive activity.

Example 12 establishment of suspension cell line expressing secreted Ezrin

Because a large amount of secreted Ezrin protein is needed in subsequent experiments, and the preparation of monoclonal antibodies for blocking Ezrin also needs to aim at the natural conformation epitope of the secreted Ezrin protein, a large amount of recombinant secreted Ezrin protein needs to be expressed and purified. The previous recombinant secretory Ezrin protein is based on the adherent 293FT cell, and the culture supernatant of the adherent 293FT cell is separated and purified, so that the expression yield is low. In order to solve the problem, a cell line for stably expressing N-twin-strep II-Ezrin 293FT and a c-twin-strep II are constructed

An Ezrin 293FT F2 cell line (F2 cell line is 293FT cell with completely knocked-out endogenous Ezrin, interference of endogenous Ezrin is eliminated), and then the two adherent cells are successfully acclimated into a cell line cultured in suspension (figure 15A), and the cultured cell density can reach 6 x 10⁶The activity of the cells per ml can reach more than 90 percent. Further Coomassie brilliant blue staining (FIG. 15B) and western-blot (FIG. 15C) detection confirm that the eukaryotic expression secretory Ezrin protein of the suspension culture cells greatly increases the expression amount, and a very strong signal can be detected in 10 microliters of culture supernatant (1 milliliter of culture supernatant is needed by an adherence culture method) (FIG. 15C). Provides guarantee for the convenience of large-scale purification of secreted Ezrin protein in the next step.

The method comprises the following specific steps:

1) the Ezrin expression vector (PB510B-N-twin-strep II-Ezrin or PB510B-C-twin-strep II-Ezrin) was constructed as described above

2) Plasmid transfection

(1) Cells were digested by culturing 293FT cells or 293FT F2 cell line (construction of F2 cell line see related steps in example 5) to log phase, at a cell number of approximately 70-90% of the dish area.

(2) And setting relevant parameters of a cell counter, and measuring the cell concentration.

(3) According to the following

3000 reagent specification requires, measure 1.8X 10⁶The total amount of each cell, based on the cell density, was calculated as the volume of cell suspension and seeded into a 35mm cell culture dish.

(4) Dilution of

3000 reagent:

1 piece of 1.5ml centrifuge tube is added

Culture medium 125ul

3000 3.75ul

(5) Preparing DNA premix, adding recombinant plasmid, and adding P3000^TMReagent:

(6) two 1.5ml centrifuge tubes were mixed well and incubated at room temperature for 5 minutes.

(7) The mixture was added to a 35mm cell culture dish of the 293FT cell or 293FT F2 cell line described above, and supplemented with 10% FBS DMEM complete medium to 2 ml. Labeling, placing in a 37 ℃ cell culture box, and adding 2ml of complete medium containing puromycin the next day for screening. The working concentration of puromycin is 5 ug/ml. Screening was carried out for 7 days.

3) Domestication of adherent cells into suspension cells

(1) Culturing 293FT cells or 293FT F2 cells until logarithmic phase, wherein the cell number is about 70-90% of the area of the culture dish, and replacing the culture Medium by SMM 293-TII Expression Medium (from Yinqiao).

(2) The culture Medium is used for adherent culture for 2-3 generations, cells are digested, centrifuged and replaced by a special suspension culture Medium SMM 293-TII Expression Medium with 2% FBS. Cell density was adjusted to 1X 10⁶A total of 20 ml of cell-containing culture medium was placed in a 250ml shake flask. The flask was placed at 37 ℃ in 5% CO₂Culturing in a constant temperature shaking table with the rotation speed of 150-.

(3) Fluid changes or passages are made every 4-5 days depending on the cell state, and each passage reduces the serum concentration to the previous half. I.e., 2% in the beginning, and gradually decreased to 1%, 0.5%, 0.25%, 0.125%, 0. Half of the original medium was retained for each passage. When the serum is reduced to 0.125%, the next liquid change is directly changed into a serum-free SMM 293-TII Expression Medium. So far, the adherent cells are domesticated into suspension cells.

EXAMPLE 13 preparation of monoclonal antibodies and immunotherapy

A293 FT suspension cell strain expressing secretory Ezrin recombinant protein (carrying a twin-Strep II tag) is used for massively expressing secretory Ezrin with the twin-Strep II tag, culture supernatant is collected, and Strep-TactinXT resin is used for affinity purification, so that sufficient secretory Ezrin protein is obtained.

The secretory Ezrin protein is used as an antigen to immunize Balb/c healthy female mice, spleen is taken, cell suspension is prepared, mouse B cells and myeloma cells are mixed, and 50% PEG is used for promoting cell fusion to form hybridoma cells. Through screening and identification, a high-specificity hybridoma cell strain Clone A02 is selected, and a monoclonal antibody is prepared.

Coupling Clone A02 antibody and EP924Y antibody (abcam) to magnetic beads containing protein A, respectively incubating with naturally active secretory Ezrin protein, and performing immunoprecipitation; after 12 hours, the beads were washed, electrophoresed, and subjected to Western blot detection (FIG. 16); the Input is 5 microliters of culture supernatant containing secretory Ezrin protein, and SDS loading buffer is added for denaturation; IP is the experimental lane of co-immunoprecipitation using antibody.

It can be seen that the Clone A02 antibody can effectively recognize naturally active secreted Ezrin protein, while compared with the commercial monoclonal antibody EP924Y (abcam) for recognizing intracellular cytoplasmic Ezrin, the antibody cannot effectively recognize naturally active secreted Ezrin protein, but only can recognize denatured Ezrin protein.

In vitro cell experiments were subsequently performed using a 5 micron pore size transwell chamber, 30 microliters of BD Matrigel (1:2 dilution) was added to the upper chamber and 2X 10⁶Human peripheral blood leukocytes, the lower chamber was divided into HCC827 cell inoculation group and secretory Ezrin treatment group, and Clone A02 antibody and EP924Y antibody (abcam) were added to the lower chamberNeutralizing; the Clone A02 antibody can effectively block Ezrin protein secreted and released by tumor cells, and obviously promote infiltration of white blood cells; the EP924Y antibody, on the other hand, does not recognize secreted Ezrin protein and does not promote leukocyte infiltration. (FIG. 17)

LLC cells (mouse lung cancer cells) (2X 10)⁶) Injecting into C57 mice subcutaneously on back, injecting into tail vein of tumor-forming mice 7 days later with PBS, Clone A02 antibody and EP924Y antibody at an injection dose of 100 μ g/mouse once a week; the Clone A02 antibody injection treatment group can obviously inhibit the growth of mouse transplantation tumor; and compared with a negative control group, the EP924Y antibody injection-treated mice have no difference.

(FIG. 18)

The above fully shows that the Clone A02 antibody can effectively recognize the naturally active secretory Ezrin protein, relieve the inhibition of the secretory Ezrin protein on immune cells, and play the role of anti-tumor.

Example 14

Functional analysis of human leukocyte immunosuppression effect of different species of secreted Ezrin

To investigate whether the homologous similar sequences of secreted Ezrin also have immunosuppressive effects, the degree of similarity of Ezrin in different species was analyzed. The protein sequence of Ezrin is present in many species, and the homology between the protein sequence of rabbit (Orycolagus cuniculus) and the protein sequence of human Ezrin is 94% (551/586), i.e. 551 of 586 amino acids are completely identical; the homology between the protein sequence of African clawed toad (Xenopus tropicalis) and that of human Ezrin is 82% (482/586), i.e. there are 482 amino acid molecules identical; the same sequence homology to Ezrin protein compared to mice (Mus musculus) was 97% (566/586); the Ezrin protein sequence homology was 96% compared to rat (Rattus norvegicus) (565/586); the sequence homology of Ezrin protein compared to bovine (Bos taurus) was 94% (553/586).

2. The Ezrin gene sequences of rabbits, xenopus laevis, mice, rats and cattle are synthesized, inserted into eukaryotic expression vectors and transfected into 293FT F2 cells (293FT F2 cells are Ezrin gene knockout cells, 293FT F2 does not express human Ezrin protein), and 293FT F2 cell strains which stably express the Ezrin proteins of different species are constructed.

3. Domesticating and suspending two 293FT F2 cell strains, collecting culture supernatant, and purifying secreted Ezrin protein derived from rabbit, Xenopus laevis, mouse, rat and cattle.

4. Leukocyte invasion experiments were performed on human-derived secreted Ezrin protein Ezrin (H), rabbit-derived secreted Ezrin protein Ezrin (O), Xenopus-derived secreted Ezrin protein Ezrin (X), mouse-derived secreted Ezrin protein Ezrin (M), rat-derived secreted Ezrin protein Ezrin (R), bovine-derived secreted Ezrin protein Ezrin (B): using a transwell chamber with a 5 micron pore size, 30 microliters of BD Matrigel (1:2 dilution) was added to the upper chamber and 2X 10 was added to the upper chamber⁶Human peripheral blood leukocytes, ezrin (H), ezrin (O), ezrin (X), ezrin (M), ezrin (R) and ezrin (B) were added to the lower chamber, and the number of leukocytes infiltrating into the lower chamber was observed and measured. It was found that secreted Ezrin proteins from rabbit, xenopus, mouse, rat, and cow sources, as well as those from human sources, also significantly inhibit the chemotactic motor ability of leukocytes to cross the basement membrane. This shows that the secretory Ezrin protein with similar sequence from different sources also has the function of immunosuppression on human leucocyte. The results are shown in FIG. 19.

Sequence listing

<110> Xiangya II Hospital of Zhongnan university

<120> extracellular Ezrin protein and application thereof

<160> 30

<170> SIPOSequenceListing 1.0

<210> 1

<211> 586

<212> PRT

<213> Intelligent (Homo sapiens)

<400> 1

Met Pro Lys Pro Ile Asn Val Arg Val Thr Thr Met Asp Ala Glu Leu

1 5 10 15

Glu Phe Ala Ile Gln Pro Asn Thr Thr Gly Lys Gln Leu Phe Asp Gln

20 25 30

Val Val Lys Thr Ile Gly Leu Arg Glu Val Trp Tyr Phe Gly Leu His

35 40 45

Tyr Val Asp Asn Lys Gly Phe Pro Thr Trp Leu Lys Leu Asp Lys Lys

50 55 60

Val Ser Ala Gln Glu Val Arg Lys Glu Asn Pro Leu Gln Phe Lys Phe

65 70 75 80

Arg Ala Lys Phe Tyr Pro Glu Asp Val Ala Glu Glu Leu Ile Gln Asp

85 90 95

Ile Thr Gln Lys Leu Phe Phe Leu Gln Val Lys Glu Gly Ile Leu Ser

100 105 110

Asp Glu Ile Tyr Cys Pro Pro Glu Thr Ala Val Leu Leu Gly Ser Tyr

115 120 125

Ala Val Gln Ala Lys Phe Gly Asp Tyr Asn Lys Glu Val His Lys Ser

130 135 140

Gly Tyr Leu Ser Ser Glu Arg Leu Ile Pro Gln Arg Val Met Asp Gln

145 150 155 160

His Lys Leu Thr Arg Asp Gln Trp Glu Asp Arg Ile Gln Val Trp His

165 170 175

Ala Glu His Arg Gly Met Leu Lys Asp Asn Ala Met Leu Glu Tyr Leu

180 185 190

Lys Ile Ala Gln Asp Leu Glu Met Tyr Gly Ile Asn Tyr Phe Glu Ile

195 200 205

Lys Asn Lys Lys Gly Thr Asp Leu Trp Leu Gly Val Asp Ala Leu Gly

210 215 220

Leu Asn Ile Tyr Glu Lys Asp Asp Lys Leu Thr Pro Lys Ile Gly Phe

225 230 235 240

Pro Trp Ser Glu Ile Arg Asn Ile Ser Phe Asn Asp Lys Lys Phe Val

245 250 255

Ile Lys Pro Ile Asp Lys Lys Ala Pro Asp Phe Val Phe Tyr Ala Pro

260 265 270

Arg Leu Arg Ile Asn Lys Arg Ile Leu Gln Leu Cys Met Gly Asn His

275 280 285

Glu Leu Tyr Met Arg Arg Arg Lys Pro Asp Thr Ile Glu Val Gln Gln

290 295 300

Met Lys Ala Gln Ala Arg Glu Glu Lys His Gln Lys Gln Leu Glu Arg

305 310 315 320

Gln Gln Leu Glu Thr Glu Lys Lys Arg Arg Glu Thr Val Glu Arg Glu

325 330 335

Lys Glu Gln Met Met Arg Glu Lys Glu Glu Leu Met Leu Arg Leu Gln

340 345 350

Asp Tyr Glu Glu Lys Thr Lys Lys Ala Glu Arg Glu Leu Ser Glu Gln

355 360 365

Ile Gln Arg Ala Leu Gln Leu Glu Glu Glu Arg Lys Arg Ala Gln Glu

370 375 380

Glu Ala Glu Arg Leu Glu Ala Asp Arg Met Ala Ala Leu Arg Ala Lys

385 390 395 400

Glu Glu Leu Glu Arg Gln Ala Val Asp Gln Ile Lys Ser Gln Glu Gln

405 410 415

Leu Ala Ala Glu Leu Ala Glu Tyr Thr Ala Lys Ile Ala Leu Leu Glu

420 425 430

Glu Ala Arg Arg Arg Lys Glu Asp Glu Val Glu Glu Trp Gln His Arg

435 440 445

Ala Lys Glu Ala Gln Asp Asp Leu Val Lys Thr Lys Glu Glu Leu His

450 455 460

Leu Val Met Thr Ala Pro Pro Pro Pro Pro Pro Pro Val Tyr Glu Pro

465 470 475 480

Val Ser Tyr His Val Gln Glu Ser Leu Gln Asp Glu Gly Ala Glu Pro

485 490 495

Thr Gly Tyr Ser Ala Glu Leu Ser Ser Glu Gly Ile Arg Asp Asp Arg

500 505 510

Asn Glu Glu Lys Arg Ile Thr Glu Ala Glu Lys Asn Glu Arg Val Gln

515 520 525

Arg Gln Leu Leu Thr Leu Ser Ser Glu Leu Ser Gln Ala Arg Asp Glu

530 535 540

Asn Lys Arg Thr His Asn Asp Ile Ile His Asn Glu Asn Met Arg Gln

545 550 555 560

Gly Arg Asp Lys Tyr Lys Thr Leu Arg Gln Ile Arg Gln Gly Asn Thr

565 570 575

Lys Gln Arg Ile Asp Glu Phe Glu Ala Leu

580 585

<210> 2

<211> 586

<212> PRT

<213> Rabbit (Oryctolagus cuniculus)

<400> 2

Met Pro Lys Pro Ile Asn Val Arg Val Thr Thr Met Asp Ala Glu Leu

1 5 10 15

Glu Phe Ala Val Gln Pro Asn Thr Thr Gly Lys Gln Leu Phe Asp Gln

20 25 30

Val Val Lys Thr Ile Gly Leu Arg Glu Val Trp Tyr Phe Gly Leu Gln

35 40 45

Tyr Val Asp Asn Lys Gly Phe Pro Thr Trp Leu Lys Leu Asp Lys Lys

50 55 60

Val Ser Ala Gln Glu Val Arg Lys Glu Asn Pro Val Gln Phe Lys Phe

65 70 75 80

Arg Ala Lys Phe Tyr Pro Glu Asp Val Ser Glu Glu Leu Ile Gln Asp

85 90 95

Ile Thr Gln Lys Leu Phe Phe Leu Gln Val Lys Glu Gly Ile Leu Ser

100 105 110

Asp Glu Ile Tyr Cys Pro Pro Glu Thr Ala Val Leu Leu Gly Ser Tyr

115 120 125

Ala Val Gln Ala Lys Phe Gly Asp Tyr Ser Lys Glu Ala His Lys Ala

130 135 140

Gly Tyr Leu Ser Ser Glu Arg Leu Ile Pro Gln Arg Val Met Asp Gln

145 150 155 160

His Lys Leu Ser Arg Asp Gln Trp Glu Asp Arg Ile Gln Val Trp His

165 170 175

Ala Glu His Arg Gly Met Leu Lys Asp Ser Ala Met Leu Glu Tyr Leu

180 185 190

Lys Ile Ala Gln Asp Leu Glu Met Tyr Gly Ile Asn Tyr Phe Glu Ile

195 200 205

Lys Asn Lys Lys Gly Thr Asp Leu Trp Leu Gly Val Asp Ala Leu Gly

210 215 220

Leu Asn Ile Tyr Glu Lys Asn Asp Lys Leu Thr Pro Lys Ile Gly Phe

225 230 235 240

Pro Trp Ser Glu Ile Arg Asn Ile Ser Phe Asn Asp Lys Lys Phe Val

245 250 255

Ile Lys Pro Ile Asp Lys Lys Ala Pro Asp Phe Val Phe Tyr Ala Pro

260 265 270

Arg Leu Arg Ile Asn Lys Arg Ile Leu Gln Leu Cys Met Gly Asn His

275 280 285

Glu Leu Tyr Met Arg Arg Arg Lys Pro Asp Thr Ile Glu Val Gln Gln

290 295 300

Met Lys Ala Gln Ala Arg Glu Glu Lys His Gln Lys Gln Leu Glu Arg

305 310 315 320

Gln Gln Leu Glu Ser Glu Lys Lys Arg Arg Glu Ala Val Glu Gln Glu

325 330 335

Lys Glu Gln Met Leu Arg Glu Lys Glu Glu Leu Met Met Arg Leu Gln

340 345 350

Asp Tyr Glu Gln Lys Thr Lys Lys Ala Glu Lys Glu Leu Ser Asp Gln

355 360 365

Ile Gln Arg Ala Leu Gln Leu Glu Asp Glu Arg Lys Arg Ala Gln Glu

370 375 380

Glu Ser Glu Arg Leu Glu Ala Asp Arg Val Ala Ala Leu Arg Ala Lys

385 390 395 400

Glu Glu Leu Glu Arg Gln Ala Ala Asp Gln Ile Lys Ser Gln Glu Gln

405 410 415

Leu Ala Ala Glu Leu Ala Glu Tyr Thr Ala Lys Ile Ala Leu Leu Glu

420 425 430

Glu Ala Arg Arg Arg Lys Glu Ser Glu Val Glu Glu Trp Gln His Arg

435 440 445

Ala Arg Glu Ala Gln Asp Asp Leu Val Lys Thr Lys Glu Glu Leu His

450 455 460

Leu Val Met Thr Ala Pro Pro Pro Pro Pro Pro Pro Met Tyr Glu Pro

465 470 475 480

Val Ser Tyr His Val Gln Glu His Leu His Glu Glu Gly Ala Glu Ser

485 490 495

Leu Gly Tyr Ser Ala Glu Leu Ser Ser Glu Gly Ile Leu Asp Asp Arg

500 505 510

His Glu Glu Lys Arg Ile Thr Glu Ala Glu Lys Asn Glu Arg Val Gln

515 520 525

Arg Gln Leu Leu Thr Leu Ser Asn Glu Leu Ser Gln Ala Arg Asp Glu

530 535 540

Asn Lys Arg Thr His Asn Asp Ile Ile His Asn Glu Asn Leu Arg Gln

545 550 555 560

Gly Arg Asp Lys Tyr Lys Thr Leu Arg Gln Ile Arg Gln Gly Asn Thr

565 570 575

Lys Gln Arg Ile Asp Glu Phe Glu Ala Met

580 585

<210> 3

<211> 582

<212> PRT

<213> Xenopus laevis (Xenopus tropicalis)

<400> 3

Met Pro Lys Pro Val Asn Val Arg Val Thr Thr Met Asp Ala Glu Leu

1 5 10 15

Glu Phe Ala Ile Gln Pro Ser Thr Thr Gly Lys Gln Leu Phe Asp Gln

20 25 30

Val Ile Lys Thr Val Gly Leu Arg Glu Val Trp Tyr Phe Gly Leu Gln

35 40 45

Cys Ile Asp Asn Lys Gly Tyr Leu Thr Trp Leu Lys Leu Asp Lys Lys

50 55 60

Val Ser Ala Gln Glu Val Lys Lys Glu Asn Pro Leu Gln Phe Lys Phe

65 70 75 80

Arg Ala Lys Phe Tyr Pro Glu Asp Val Ser Glu Glu Leu Ile Gln Glu

85 90 95

Ile Thr Gln Lys Leu Phe Phe Leu Gln Val Lys Glu Ala Ile Leu Ser

100 105 110

Asp Glu Val Tyr Cys Pro Pro Glu Thr Ala Val Leu Leu Ala Ser Tyr

115 120 125

Ala Val Gln Ala Lys Phe Gly Asp Tyr Ser Lys Glu Thr Ile Lys Ser

130 135 140

Gly Tyr Leu Thr Ser Glu Arg Leu Leu Pro Gln Arg Val Leu Asp Gln

145 150 155 160

His Asn Leu Ser Arg Asp Gln Trp Glu Glu Arg Ile Glu Val Trp His

165 170 175

Ser Glu His Arg Gly Met Leu Lys Glu Asp Ala Met Leu Glu Tyr Leu

180 185 190

Lys Ile Ala Gln Asp Leu Glu Met Tyr Gly Ile Asn Tyr Phe Glu Ile

195 200 205

Lys Asn Lys Lys Gly Ser Asp Leu Trp Leu Gly Val Asp Ala Leu Gly

210 215 220

Leu Asn Ile Tyr Glu His Asn Asp Lys Leu Thr Pro Lys Ile Gly Phe

225 230 235 240

Pro Trp Ser Glu Ile Arg Asn Ile Ser Phe Asn Asp Lys Lys Phe Val

245 250 255

Ile Lys Pro Ile Asp Lys Lys Ala Pro Asp Phe Val Phe Tyr Ala Pro

260 265 270

Arg Leu Arg Ile Asn Lys Arg Ile Leu Gln Leu Cys Met Gly Asn His

275 280 285

Glu Leu Tyr Met Arg Arg Arg Lys Pro Asp Thr Ile Glu Val Gln Gln

290 295 300

Met Lys Ala Gln Ala Lys Glu Glu Lys Leu Gln Lys Gln Leu Glu Arg

305 310 315 320

Gln Gln Leu Glu Gln Glu Lys Lys Lys Arg Glu Ala Ile Glu Arg Glu

325 330 335

Arg Glu Gln Met Ile Lys Glu Lys Glu Glu Leu Met Phe Arg Leu His

340 345 350

Glu Tyr Glu Glu Gln Ser Lys Arg Ala Glu Arg Glu Leu Ser Glu Gln

355 360 365

Ile Gln Arg Ala Lys Glu Leu Glu Glu Glu Arg Arg Arg Ala Gln Tyr

370 375 380

Glu Ala Glu Arg Leu Glu Ala Glu Arg Ile Ser Ala Leu Arg Ala Lys

385 390 395 400

Glu Glu Leu Glu Arg Gln Ala Ile Ala Gln Thr Lys Ser Gln Glu Gln

405 410 415

Leu Ala Ser Glu Leu Ser Glu Tyr Thr Ala Arg Ile Ser Leu Leu Glu

420 425 430

Glu Ala Arg Arg Val Lys Glu Asp Glu Ala Ser Glu Trp Gln Met Arg

435 440 445

Ala Gln Glu Ala Gln Thr Asp Leu Leu Arg Thr Arg Glu Glu Leu His

450 455 460

Met Val Met Thr Thr Pro Pro Pro Pro Pro Pro Pro Val Tyr Glu Pro

465 470 475 480

Tyr Arg Val His Glu Pro Asp Asp Gly Leu Glu His Thr Ser Tyr Ser

485 490 495

Ala Glu Leu Ser Ser Val Asp Phe Leu Glu Asp Asn Lys Met Gln Thr

500 505 510

Arg Met Thr Glu Ala Glu Lys Asn Glu Arg Val Gln Arg Gln Leu Met

515 520 525

Ala Leu Thr Ser Glu Leu Ser Gln Ala Arg Asp Glu Thr Lys Lys Thr

530 535 540

His Asn Asp Ile Leu His Thr Glu Asn Val Lys Ser Gly Arg Asp Lys

545 550 555 560

Tyr Lys Thr Leu Arg Gln Ile Arg Gln Gly Asn Thr Lys Gln Arg Ile

565 570 575

Asp Glu Phe Glu Ala Met

580

<210> 4

<211> 586

<212> PRT

<213> mouse (Mus musculus)

<400> 4

Met Pro Lys Pro Ile Asn Val Arg Val Thr Thr Met Asp Ala Glu Leu

1 5 10 15

Glu Phe Ala Ile Gln Pro Asn Thr Thr Gly Lys Gln Leu Phe Asp Gln

20 25 30

Val Val Lys Thr Ile Gly Leu Arg Glu Val Trp Tyr Phe Gly Leu Gln

35 40 45

Tyr Val Asp Asn Lys Gly Phe Pro Thr Trp Leu Lys Leu Asp Lys Lys

50 55 60

Val Ser Ala Gln Glu Val Arg Lys Glu Asn Pro Val Gln Phe Lys Phe

65 70 75 80

Arg Ala Lys Phe Tyr Pro Glu Asp Val Ala Glu Glu Leu Ile Gln Asp

85 90 95

Ile Thr Gln Lys Leu Phe Phe Leu Gln Val Lys Asp Gly Ile Leu Ser

100 105 110

Asp Glu Ile Tyr Cys Pro Pro Glu Thr Ala Val Leu Leu Gly Ser Tyr

115 120 125

Ala Val Gln Ala Lys Phe Gly Asp Tyr Asn Lys Glu Met His Lys Ser

130 135 140

Gly Tyr Leu Ser Ser Glu Arg Leu Ile Pro Gln Arg Val Met Asp Gln

145 150 155 160

His Lys Leu Ser Arg Asp Gln Trp Glu Asp Arg Ile Gln Val Trp His

165 170 175

Ala Glu His Arg Gly Met Leu Lys Asp Ser Ala Met Leu Glu Tyr Leu

180 185 190

Lys Ile Ala Gln Asp Leu Glu Met Tyr Gly Ile Asn Tyr Phe Glu Ile

195 200 205

Lys Asn Lys Lys Gly Thr Asp Leu Trp Leu Gly Val Asp Ala Leu Gly

210 215 220

Leu Asn Ile Tyr Glu Lys Asp Asp Lys Leu Thr Pro Lys Ile Gly Phe

225 230 235 240

Pro Trp Ser Glu Ile Arg Asn Ile Ser Phe Asn Asp Lys Lys Phe Val

245 250 255

Ile Lys Pro Ile Asp Lys Lys Ala Pro Asp Phe Val Phe Tyr Ala Pro

260 265 270

Arg Leu Arg Ile Asn Lys Arg Ile Leu Gln Leu Cys Met Gly Asn His

275 280 285

Glu Leu Tyr Met Arg Arg Arg Lys Pro Asp Thr Ile Glu Val Gln Gln

290 295 300

Met Lys Ala Gln Ala Arg Glu Glu Lys His Gln Lys Gln Leu Glu Arg

305 310 315 320

Gln Gln Leu Glu Thr Glu Lys Lys Arg Arg Glu Thr Val Glu Arg Glu

325 330 335

Lys Glu Gln Met Leu Arg Glu Lys Glu Glu Leu Met Leu Arg Leu Gln

340 345 350

Asp Tyr Glu Gln Lys Thr Lys Arg Ala Glu Lys Glu Leu Ser Glu Gln

355 360 365

Ile Glu Lys Ala Leu Gln Leu Glu Glu Glu Arg Arg Arg Ala Gln Glu

370 375 380

Glu Ala Glu Arg Leu Glu Ala Asp Arg Met Ala Ala Leu Arg Ala Lys

385 390 395 400

Glu Glu Leu Glu Arg Gln Ala Gln Asp Gln Ile Lys Ser Gln Glu Gln

405 410 415

Leu Ala Ala Glu Leu Ala Glu Tyr Thr Ala Lys Ile Ala Leu Leu Glu

420 425 430

Glu Ala Arg Arg Arg Lys Glu Asp Glu Val Glu Glu Trp Gln His Arg

435 440 445

Ala Lys Glu Ala Gln Asp Asp Leu Val Lys Thr Lys Glu Glu Leu His

450 455 460

Leu Val Met Thr Ala Pro Pro Pro Pro Pro Pro Pro Val Tyr Glu Pro

465 470 475 480

Val Asn Tyr His Val Gln Glu Gly Leu Gln Asp Glu Gly Ala Glu Pro

485 490 495

Met Gly Tyr Ser Ala Glu Leu Ser Ser Glu Gly Ile Leu Asp Asp Arg

500 505 510

Asn Glu Glu Lys Arg Ile Thr Glu Ala Glu Lys Asn Glu Arg Val Gln

515 520 525

Arg Gln Leu Leu Thr Leu Ser Asn Glu Leu Ser Gln Ala Arg Asp Glu

530 535 540

Asn Lys Arg Thr His Asn Asp Ile Ile His Asn Glu Asn Met Arg Gln

545 550 555 560

Gly Arg Asp Lys Tyr Lys Thr Leu Arg Gln Ile Arg Gln Gly Asn Thr

565 570 575

Lys Gln Arg Ile Asp Glu Phe Glu Ala Met

580 585

<210> 5

<211> 586

<212> PRT

<213> Rattus norvegicus

<400> 5

Met Pro Lys Pro Ile Asn Val Arg Val Thr Thr Met Asp Ala Glu Leu

1 5 10 15

Glu Phe Ala Ile Gln Pro Asn Thr Thr Gly Lys Gln Leu Phe Asp Gln

20 25 30

Val Val Lys Thr Ile Gly Leu Arg Glu Val Trp Tyr Phe Gly Leu Gln

35 40 45

Tyr Val Asp Asn Lys Gly Phe Pro Thr Trp Leu Lys Leu Asp Lys Lys

50 55 60

Val Ser Ala Gln Glu Val Arg Lys Glu Asn Pro Val Gln Phe Lys Phe

65 70 75 80

Arg Ala Lys Phe Tyr Pro Glu Asp Val Ala Asp Glu Leu Ile Gln Asp

85 90 95

Ile Thr Gln Lys Leu Phe Phe Leu Gln Val Lys Glu Gly Ile Leu Ser

100 105 110

Asp Glu Ile Tyr Cys Pro Pro Glu Thr Ala Val Leu Leu Gly Ser Tyr

115 120 125

Ala Val Gln Ala Lys Phe Gly Asp Tyr Asn Lys Glu Met His Lys Ser

130 135 140

Gly Tyr Leu Ser Ser Glu Arg Leu Ile Pro Gln Arg Val Met Asp Gln

145 150 155 160

His Lys Leu Ser Arg Asp Gln Trp Glu Asp Arg Ile Gln Val Trp His

165 170 175

Ala Glu His Arg Gly Met Leu Lys Asp Ser Ala Met Leu Glu Tyr Leu

180 185 190

Lys Ile Ala Gln Asp Leu Glu Met Tyr Gly Ile Asn Tyr Phe Glu Ile

195 200 205

Lys Asn Lys Lys Gly Thr Asp Leu Trp Leu Gly Val Asp Ala Leu Gly

210 215 220

Leu Asn Ile Tyr Glu Lys Asp Asp Lys Leu Thr Pro Lys Ile Gly Phe

225 230 235 240

Pro Trp Ser Glu Ile Arg Asn Ile Ser Phe Asn Asp Lys Lys Phe Val

245 250 255

Ile Lys Pro Ile Asp Lys Lys Ala Pro Asp Phe Val Phe Tyr Ala Pro

260 265 270

Arg Leu Arg Ile Asn Lys Arg Ile Leu Gln Leu Cys Met Gly Asn His

275 280 285

Glu Leu Tyr Met Arg Arg Arg Lys Pro Asp Thr Ile Glu Val Gln Gln

290 295 300

Met Lys Ala Gln Ala Arg Glu Glu Lys His Gln Lys Gln Leu Glu Arg

305 310 315 320

Gln Gln Leu Glu Thr Glu Lys Lys Arg Arg Glu Thr Val Glu Arg Glu

325 330 335

Lys Glu Gln Met Leu Arg Glu Lys Glu Glu Leu Met Leu Arg Leu Gln

340 345 350

Asp Phe Glu Gln Lys Thr Lys Arg Ala Glu Lys Glu Leu Ser Glu Gln

355 360 365

Ile Glu Lys Ala Leu Gln Leu Glu Glu Glu Arg Arg Arg Ala Gln Glu

370 375 380

Glu Ala Glu Arg Leu Glu Ala Asp Arg Met Ala Ala Leu Arg Ala Lys

385 390 395 400

Glu Glu Leu Glu Arg Gln Ala Gln Asp Gln Ile Lys Ser Gln Glu Gln

405 410 415

Leu Ala Ala Glu Leu Ala Glu Tyr Thr Ala Lys Ile Ala Leu Leu Glu

420 425 430

Glu Ala Arg Arg Arg Lys Glu Asp Glu Val Glu Glu Trp Gln His Arg

435 440 445

Ala Lys Glu Ala Gln Asp Asp Leu Val Lys Thr Lys Glu Glu Leu His

450 455 460

Leu Val Met Thr Ala Pro Pro Pro Pro Pro Pro Pro Val Tyr Glu Pro

465 470 475 480

Val Asn Tyr His Val Gln Glu Gly Leu Gln Asp Glu Gly Ala Glu Pro

485 490 495

Met Gly Tyr Ser Ala Glu Leu Ser Ser Glu Gly Ile Leu Asp Asp Arg

500 505 510

Asn Glu Glu Lys Arg Ile Thr Glu Ala Glu Lys Asn Glu Arg Val Gln

515 520 525

Arg Gln Leu Leu Thr Leu Ser Asn Glu Leu Ser Gln Ala Arg Asp Glu

530 535 540

Asn Lys Arg Thr His Asn Asp Ile Ile His Asn Glu Asn Met Arg Gln

545 550 555 560

Gly Arg Asp Lys Tyr Lys Thr Leu Arg Gln Ile Arg Gln Gly Asn Thr

565 570 575

Lys Gln Arg Ile Asp Glu Phe Glu Ala Met

580 585

<210> 6

<211> 581

<212> PRT

<213> cattle (Bos taurus)

<400> 6

Met Pro Lys Pro Ile Asn Val Arg Val Thr Thr Met Asp Ala Glu Leu

1 5 10 15

Glu Phe Ala Ile Gln Pro Asn Thr Thr Gly Lys Gln Leu Phe Asp Gln

20 25 30

Val Val Lys Thr Ile Gly Leu Arg Glu Val Trp Tyr Phe Gly Leu Gln

35 40 45

Tyr Val Asp Asn Lys Gly Phe Pro Thr Trp Leu Lys Leu Asp Lys Lys

50 55 60

Val Ser Ala Gln Glu Val Arg Lys Glu Ser Pro Leu Gln Phe Lys Phe

65 70 75 80

Arg Ala Lys Phe Tyr Pro Glu Asp Val Ala Glu Glu Leu Ile Gln Asp

85 90 95

Ile Thr Gln Lys Leu Phe Phe Leu Gln Val Lys Glu Gly Ile Leu Ser

100 105 110

Asp Glu Ile Tyr Cys Pro Pro Glu Thr Ala Val Leu Leu Gly Ser Tyr

115 120 125

Ala Val Gln Ala Lys Phe Gly Asp Tyr Asn Lys Glu Leu His Lys Ala

130 135 140

Gly Tyr Leu Gly Ser Glu Arg Leu Ile Pro Gln Arg Val Met Asp Gln

145 150 155 160

His Lys Leu Thr Arg Asp Gln Trp Glu Asp Arg Ile Gln Val Trp His

165 170 175

Ala Glu His Arg Gly Met Leu Lys Asp Ser Ala Met Leu Glu Tyr Leu

180 185 190

Lys Ile Ala Gln Asp Leu Glu Met Tyr Gly Ile Asn Tyr Phe Glu Ile

195 200 205

Lys Asn Lys Lys Gly Thr Asp Leu Trp Leu Gly Val Asp Ala Leu Gly

210 215 220

Leu Asn Ile Tyr Glu Lys Asp Asp Lys Leu Thr Pro Lys Ile Gly Phe

225 230 235 240

Pro Trp Ser Glu Ile Arg Asn Ile Ser Phe Asn Asp Lys Lys Phe Val

245 250 255

Ile Lys Pro Ile Asp Lys Lys Ala Pro Asp Phe Val Phe Tyr Ala Pro

260 265 270

Arg Leu Arg Ile Asn Lys Arg Ile Leu Gln Leu Cys Met Gly Asn His

275 280 285

Glu Leu Tyr Met Arg Arg Arg Lys Pro Asp Thr Ile Glu Val Gln Gln

290 295 300

Met Lys Ala Gln Ala Arg Glu Glu Lys His Gln Lys Gln Leu Glu Arg

305 310 315 320

Gln Gln Leu Glu Thr Glu Lys Lys Arg Arg Glu Thr Val Glu Arg Glu

325 330 335

Lys Glu Gln Met Met Arg Glu Lys Glu Glu Leu Met Leu Arg Leu Gln

340 345 350

Asp Tyr Glu Glu Lys Thr Arg Lys Ala Glu Lys Glu Leu Ser Asp Gln

355 360 365

Ile Gln Arg Ala Leu Lys Leu Glu Glu Glu Arg Lys Arg Ala Gln Glu

370 375 380

Glu Ala Gly Arg Leu Glu Ala Asp Arg Leu Ala Ala Leu Arg Ala Lys

385 390 395 400

Glu Glu Leu Glu Arg Gln Ala Ala Asp Gln Ile Lys Ser Gln Glu Gln

405 410 415

Leu Ala Thr Glu Leu Ala Glu Tyr Thr Ala Lys Ile Ala Leu Leu Glu

420 425 430

Glu Ala Arg Arg Arg Lys Glu Asn Glu Val Glu Glu Trp Gln Leu Arg

435 440 445

Ala Lys Glu Ala Gln Asp Asp Leu Val Lys Thr Arg Glu Glu Leu His

450 455 460

Leu Val Met Thr Ala Pro Pro Pro Pro Pro Val Tyr Glu Pro Val Asn

465 470 475 480

Tyr His Val His Glu Gly Pro Gln Glu Glu Gly Thr Glu Leu Ser Ala

485 490 495

Glu Leu Ser Ser Glu Gly Ile Leu Asp Asp Arg Asn Glu Glu Lys Arg

500 505 510

Ile Thr Glu Ala Glu Lys Asn Glu Arg Val Gln Arg Gln Leu Met Thr

515 520 525

Leu Thr Ser Glu Leu Ser Gln Ala Arg Asp Glu Asn Lys Arg Thr His

530 535 540

Asn Asp Ile Ile His Asn Glu Asn Met Arg Gln Gly Arg Asp Lys Tyr

545 550 555 560

Lys Thr Leu Arg Gln Ile Arg Gln Gly Asn Thr Lys Gln Arg Ile Asp

565 570 575

Glu Phe Glu Ala Met

580

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcaatccagc caaatacaac 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggtaaagact atcggcctcc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtactttggc ctccactatg 20

<210> 10

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

actgaattcg ccaccatgga ctacaaggac gacgatgaca agatgccgaa accaatcaa 59

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

actgcggccg cttacagggc ctcgaactc 29

<210> 12

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aattcgacta caaggacgac gatgacaagt aagc 34

<210> 13

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggccgcttac ttgtcatcgt cgtccttgta gtcg 34

<210> 14

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

tgctctagaa tgccgaaacc aatcaatgt 29

<210> 15

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

actgaattcc agggcctcga actcgtcga 29

<210> 16

<211> 105

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gccgaattca tggctagcgc atggagtcat cctcaattcg aaaaaggtgg aggttctggc 60

ggtggatcgg gaggttcagc gtggagccac ccccagttcg agaag 105

<210> 17

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

acttctagaa tggctagcgc atggagt 27

<210> 18

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

actgaattcc ttctcgaact gggggtg 27

<210> 19

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

actgaattca tgccgaaacc aatcaatgt 29

<210> 20

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

actgcggccg cttacagggc ctcgaactc 29

<210> 21

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

actgaattca tggctagcgc atggagt 27

<210> 22

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

actgcggccg ctcacttctc gaactggggg tg 32

<210> 23

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

tgctctagaa tgccgaaacc aatcaatgt 29

<210> 24

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

actgaattcc agggcctcga actcgtcga 29

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

caccggcaat ccagccaaat acaac 25

<210> 26

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

aaacgttgta tttggctgga ttgcc 25

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

caccgggtaa agactatcgg cctcc 25

<210> 28

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

aaacggaggc cgatagtctt taccc 25

<210> 29

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

caccggtact ttggcctcca ctatg 25

<210> 30

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 30

aaaccatagt ggaggccaaa gtacc 25

Claims

1. An application of extracellular Ezrin protein in preparing a preparation for inhibiting leukocyte infiltration migration, wherein the extracellular Ezrin protein is secreted to the outside of cells by eukaryotic cells, and the amino acid sequence of the extracellular Ezrin protein is shown in SEQ ID No. 1.