CN1927877B - siRNA for inhibiting human Ezrin gene expression and expression vector thereof - Google Patents

Abstract

The present invention relates to siRNA, and discloses one kind of siRNA to inhibit the expression of human Ezrin gene and its expression vector. The present invention designs and synthesizes two pairs of siRNA's targeting human Ezrin gene, and constitutes their expression vectors inside mammal cell. At the same time, these siRNA's are used in interfering the expression of Ezrin effectively and specifically and establishing low expression cell strain for esophageal carcinoma Ezrin, which lays solid foundation for the further research on the function of Ezrin in esophageal carcinoma and other Ezrin relevant tumors.

Description

The siRNA and the expression vector thereof that suppress human Ezrin gene expression

Technical field

The present invention relates to a kind of siRNA, specifically, relate to a kind of siRNA and expression vector thereof that suppresses human Ezrin gene expression.

Background technology

RNAi is the process by the homology target gene post-transcriptional silencing of double chain RNA mediate, and RNAi can have the double-stranded RNA of identical sequence by artificial introducing and endogenous target gene, induces endogenous target gene mRNA degraded, thereby reaches the purpose that reduces genetic expression.The RNAi technology has remarkable advantages as emerging gene disruption technology, and it has the specificity of height, and jamming effectiveness is high and simple to operate.Therefore and be widely used in hot fields such as gene functional research and anti-virus infection, oncotherapy.

The esophageal carcinoma is a kind of common alimentary system malignant tumour, has a strong impact on human health.Patient with esophageal carcinoma postoperative 5 years survival rates in the whole world only are 20%-30%.To cause a major reason of esophageal carcinoma poor prognosis be that its transitivity is strong, some patient even taken place when making a definite diagnosis that local organization is soaked into and the transfer of lymphoglandula.

Invasion and attack and transfer are molecular biology change procedures multifactor participation, that multistep is finished suddenly.Tumour cell has very strong transfer ability, makes the adhesive attraction that it can overcome between cell and iuntercellular and cell and matrix invade surrounding tissue.The cell that aggressive is strong has all usually that synapse cell is many, intercellular adhesion weakens and communication connects characteristics such as forfeiture.These malignant sign that generally believe tumour cell now are because due to the cytoskeleton reorganization that the relevant connection albumen of actin binding protein and some causes.

In these skeleton associated protein, that we study is Ezrin.The Ezrin gene claims VIL2 again, be positioned karyomit(e) 6q25.2～q26, its expression product Ezrin albumen is one of ERM (ezrin-radixin-moesin) family member, main participate in being connected between the cytoskeleton and after birth in the cell, have the cellular form of keeping with motion, be connected functions such as adhesion molecule and conditioning signal transduction.

More and more evidences shows the development of Ezrin modulate tumor.Shift with non-metastatic tumour clone and tissue sample in the comparing result of genetic expression show, significantly improve from the expression of Ezrin in the metastasis of cancer cell of rodent mammary gland, human pancreas and colon; Simultaneously, Ezrin is strong expression in multiple human tumor, and these tumours comprise osteosarcoma, melanoma, astrocytoma, carcinoma of the pancreas, lung cancer, carcinoma of endometrium etc.; Studies show that further suppressing Ezrin albumen can eliminate murine rhabdosarcoma and osteosarcoma cell, Ezrin is likely the key adjusting molecule of malignant tumour.Adhesion, apoptosis that existing research also points out Ezrin to participate in tumour cell especially move biological procedureses such as invasion and attack, and closely related with the generation development of tumour.

The expression of Ezrin has just obtained preliminary illustrating recently in the esophageal carcinoma, finds to play an important role at immortalization esophageal epithelial cell SHEE Ezrin in the vicious transformation process of esophageal cancer cell SHEEmt in our research in the past.We also disclose the research of esophageal carcinoma clinical tissue sample recently, and change has taken place in the expression pattern of Ezrin in the esophageal carcinoma.Yet, Ezrin in the esophageal carcinoma and other tumour function and the mechanism that express to change well do not illustrated yet so far.If can use the RNAi technology and suppress Ezrin expression of gene in the esophageal cancer cell, thereby inquire into the function of Ezrin in esophageal cancer cell, this will help to illustrate Ezrin from molecular level and express the mechanism that changes in the tumor tissue cell of these epithelial origins, thereby for opening the pathogenesis of the esophageal carcinoma and the clue that treatment provides usefulness.

Summary of the invention

The object of the present invention is to provide a kind of siRNA that suppresses human Ezrin gene expression.

Another object of the present invention provides the expression vector of above-mentioned inhibition human Ezrin gene expression.

Above-mentioned purpose of the present invention can realize by following measure.

Design suppresses the double-stranded siRNA fragment of Ezrin genetic expression: the design software that provides on the net according to Dharmacon company has designed two groups of siRNA.Its base sequence and site of action are as follows:

E1：(SEQ?ID?NO：1)

5’GATCCCCTCCACTATGTGGATAATAATTCAAGAGATTATTATCCACATA

GTGGATTTTTGGAAA?3’

5’AGCTTTTCCAAAAATCCACTATGTGGATAATAATCTCTTGAATTATTATC

CACATAGTGGAGGG?3’

Act on the 274-292 of human Ezrin mRNA;

E2：(SEQ?ID?NO：2)

5’GATCCCCACTTTGGCCTCCACTATGTTTCAAGAGAACATAGTGGAGGC

CAAAGTTTTTTTGGAAA?3’

5’AGCTTTTCCAAAAAACTTTGGCCTCCACTATGTTCTCTTGAAACATAG

TGGAGGCCAAAGTGGG?3’

Act on the 265-283 of human Ezrin mRNA.

The carrier that can produce the siRNA that suppresses human Ezrin gene expression of the present invention, it has following basic structure: the circular double stranded DNA molecule that is linked in sequence and is formed by promotor, Ezrin coding region, termination codon, dna sequence dna;

Promotor is for starting the sequence that produces siRNA, and it is the element of its downstream next-door neighbour's of startup expression of gene; The preferred polymerase-III H1-RNA of promotor gene promoter.

The Ezrin coding region is made up of 19 Nucleotide for expressing the coding region of the described siRNA of claim 1, can adopt two-way combination or form double-stranded RNA with hair clip shape structure in cell:

Termination codon is 5～6 T;

Dna sequence dna is the dna sequence dna between RNA coding region and promotor of any eucaryon plasmid carrier and/or virus, the replication origin that contains plasmid vector DNA, or contain antibiotics resistance gene, comprise making bacterium obtain to resist the gene of certain antibiotic resistance or make eukaryotic cell obtain the gene of certain antibiotic resistance.The preferred pSUPER.neo carrier of described any eucaryon plasmid carrier and/or virus.Described antibiotics resistance gene preferred antibiotics G418 resistant gene neo.

Above-mentioned carrier pSUPER.neo (Oligoengine) has the following advantages: (1) has the polymerase-IIIHl-RNA gene promoter, can produce little rna transcription that does not contain poly-A tail; (2) can very accurate startup transcribe; (3) termination signal includes T5; (4) stop transcribing in the back of second uridylic, can produce the similar end with synthetic siRNA, promptly 3 ' end contains two unpaired thymus pyrimidines or uridylic.The expression siRNA that this carrier is can be in mammalian cell the inside stable, but also contain the neo gene, can screen the cell of transfection success with G418, set up clone, be suitable for doing long term studies.

According to pSUPER.neo carrier figure, we adopt enzyme cutting method successively when linearized vector.Simultaneously since the restriction enzyme site that inserts its Bgl II of carrier behind the siRNA with destroyed, therefore we handled half an hour with Bgl II again before transforming after the connection, the carrier of recirculation enzyme again is cut into linearity, to reduce plate clone growth background, improve the efficient of the screening of positive plasmid greatly.Positive plasmid can obtain the segment of a 287bp after EcoR I and Hind III enzyme are cut, empty carrier then can cut out the segment of a 227bp, so we have adopted more responsive non-sex change polypropylene electrophoresis to add the way that silver dyes evaluation to carry out the screening of recon.

With the expression vector transfection feed pipe cancerous cell line EC109 that builds.Be to obtain the cell of stable expression plasmid, we at first the higher G418 of working concentration carry out drug screening.The EC109 cell of the cell (being called PSE1 and PSE2) of blank plasmid PSC of transfection and the above siRNA of transfection owing on the plasmid vector neo gene is arranged, has the G418 resistance, is therefore survived; And by contrast, the contrast EC109 cell of the above-mentioned plasmid of untransfected then is killed because of the toxic action of G418.For preventing in the continuous passage culturing process that losing of expression plasmid will place the relatively low growing environment of drug level to cultivate by cell, if plasmid loss, cell still can be killed because of the toxic action of G418.Under these conditions, cell can continue growth, shows that the EC109 cell strain of blank plasmid of stable transfection and interference plasmid is successfully set up.

The cell strain that screens at first carries out the analysis of interference effect.The present invention analyzes from transcribing and turn over damp level respectively with RT-PCR and Western blotting.No matter result's demonstration is at transcriptional level or is turning over damp level, all obviously reductions of the cell Ezrin expression after the interference, and also the cell Ezrin expression of gene of the blank plasmid of transfection is uninfluenced, and that the result also shows interference effect simultaneously relatively is PSE1＞PSE2.In addition, the detection that Ezrin expresses in the total protein of cell of constant generations also shows very stable of effects of jamming.

Compared with prior art, the present invention has following beneficial effect: the present invention designs, has synthesized two couples of siRNA of target human Ezrin gene, and has successfully made up their expression vectors in mammalian cell.Simultaneously, use these siRNA can disturb the expression of Ezrin effectively, specifically, set up esophageal carcinoma Ezrin down-regulated express cell strain, for the function of furtheing investigate Ezrin in the esophageal carcinoma and other Ezrin related neoplasms lays a solid foundation.

Description of drawings

Fig. 1 is a siRNA hairpin structure synoptic diagram;

Fig. 2 vector construction synoptic diagram;

Fig. 3 cuts evaluation figure for the enzyme of expression vector PSE in the Ezrin gene siRNA Mammals;

Figure is identified in the order-checking of the positive plasmid of Fig. 4;

Fig. 5 is the detection of Ezrin interference effect;

Fig. 6 is pSUPER.neo carrier figure.

Among Fig. 3, the positive plasmid of 1,2 swimming lanes, the negative contrast of 3 swimming lanes, the 4th swimming lane is 100bp DNAmarker.Among Fig. 5, (A) the Westem blotting of interference effect detects; (B) detection of interference stability; (C) RT-PCR of interference effect detects; β-actin and GAPDH be the last sample contrast of the Westem blotting of conduct and RT-PCR respectively.

Embodiment

The siRNA design of embodiment 1 target Ezrin gene, synthetic and annealing.

The design software that provides on the net according to Dharmacon company has designed two groups of siRNA sequences, as table 1:

Table 1

siRNA?Target?Sequence	Numbering	?Region	?Start
				5′TCCACTATGTGGATAATAA3′(SEQ?ID?NO：3)	PSE1	?ORF	?274

5′ACTTTGGCCTCCACTATGT3′(SEQ?ID?NO：4)

PSE2

?ORF

?265

The principle of design is as follows:

(1) from the AUG initiation codon of mRNA, seek 5 ' AA (N19) TT,

Wherein N is any base, and scantling length is the sequence (as table 1) of 19bp;

(2) G or C more than 3 or three can not appear on the target sequence continuously;

(3) interference sequence is avoided the first and last end at target gene;

(4) select the sequence of GC content between 30%-52%;

(5) target ORF district;

(6) sequence of selecting is carried out homology relatively in public database;

Be cloned into the inverted repeats that dna fragmentation in the siRNA expression vector comprises two weak points, middlely separate, connect the transcription terminator of 5-6 T subsequently as rna plymerase iii by hairpin; Segmental 5 ' end adds the restriction enzyme site of Bgl II, and 3, end then contains the restriction enzyme site (see figure 1) of HindIII.The sequence of putting in order send Jikang Biotechnology Co Ltd, Shanghai synthetic.

(final concentration is 1 μ g/ μ l), fully dissolving in the nuclease free water of synthetic oligonucleotide sequence (2OD) adding 66 μ l.During annealing, in a new centrifuge tube, add following reagent (cumulative volume 50 μ l) successively: each 3 μ l of the positive antisense strand of siRNA, add 44 μ l annealing buffer (10Mm NaCl, 50mM Hepes, pH7.4), fully on the PCR instrument, finish following operation behind the mixing: 94 ℃ of 4min, 80 ℃ of 4min, 75 ℃ of 4min are 70 ℃ of 10min then, 37 ℃ of 20min are cooled to 25 ℃ at last.Product can be directly used in connection or be stored in 4 ℃.

The structure of embodiment 2 expression vector PSE1 and PSE2

1. the linearizing of carrier and recovery: in centrifuge tube, add following reagent (cumulative volume 50 μ l) successively: sterilized water 37.5 μ l, pSUPER.neo carrier 5 μ l, 10 * buffer B, 5 μ l, acetylize BSA (10mg/ml) 0.5 μ l and HindIII (20u/ μ l) 2 μ l.Behind the mixing, 37 ℃ of water-baths continue to add Bgl II (20u/ μ l) 2 μ l in mixture after hatching lh, hatch 1h again 37 ℃ of water-baths.Getting 5 μ l electrophoresis and carry out 1% agarose gel electrophoresis, is contrast with digested plasmid not, identifies whether carrier is linear.Reclaim linear pSUPER.neo carrier segments with reference to Quick PCR purification kit specification sheets.

Cut the PB damping fluid that adds 5 times of volumes in the mixed solution at enzyme, then this mixed solution is transferred to QIAquick spin post, the centrifugal 1min of 12000 * g; The abandoned stream fluid adds 750 μ l PE damping fluids, the centrifugal 1min of 12000 * g, abandoned stream fluid at the QIAquickspin post; QIAquick spin post is put back to former collection tube, the centrifugal again 1min of 12000 * g; Then QIAquick spin post is transferred in the clean 1.5ml centrifuge tube, and adds 30 μ l EB damping fluids, place 1min under the room temperature, the centrifugal 1min of 12000 * g under the room temperature in the post center.Get 2 μ l and reclaim liquid and carry out electrophoresis, determine to reclaim successfully, it is ℃ frozen standby to remain recovery liquid-20.

2. the siRNA after will annealing connects in the into linearizing carrier: the siRNA after the annealing is connected with linear pSUPER.neo carrier.In a new centrifuge tube, add following reagent (operating) successively on ice: 2 * T4 dna ligase damping fluid, 5 μ l, wire pSUPER.neo carrier l μ l, siRNA 3 μ l and T4 dna ligase l μ l, mixing, 25 ℃ of circulator bath 1h.Add 1 μ l Bgl II before transforming and handle half an hour.

3. will connect the conventional conversion of product and advance competent cell---JM109.Extract plasmid behind the clonal expansion that grows and carry out the double digestion evaluation: get 2 μ l plasmid DNA, add 2 μ l, 10 * buffer, 2 μ l acetylize BSA, 8 μ l sterilized waters and 3 μ l EcoR I and 3 μ lHindIII restriction enzymes.37 ℃ of water-bath 4～5h.8% native polyacrylamide gel electrophoresis, and carry out silver and dye evaluation, step is as follows: 10% ethanol is 30min fixedly; 1% nitric acid treatment 8min; Photographic fixing in 10% glacial acetic acid was at last developed the color several minutes then with 0.2% cma staining 30min in twice of ultrapure washing back in the colour developing liquid that the formaldehyde of 3% anhydrous sodium carbonate and 0.1% is formed.According to carrier figure, contain the segment of recon visible 287bp after enzyme is cut of siRNA, the empty carrier contrast then can cut out the segment of 227bp.The positive colony that filters out checks order and obtains expression plasmid (Fig. 2,3,4).

The analysis of embodiment 3 stable transfections and interference effect

Human esophageal carcinoma cell line EC109 cell is advanced in recon transfection after the evaluation, and also the transfection empty carrier is done contrast simultaneously.Be to obtain the cell of stable expression plasmid, we at first the higher G418 (400 μ g/ml) of working concentration carry out drug screening.The EC109 cell of the cell (being called PSE1 and PSE2) of blank plasmid PSC of transfection and the above siRNA of transfection owing on the plasmid vector neo gene is arranged, has the G418 resistance, is therefore survived; And by contrast, the contrast EC109 cell of the above-mentioned plasmid of untransfected then is killed because of the toxic action of G418.For preventing in the continuous passage culturing process that losing of expression plasmid will place the relatively low growing environment of drug level to cultivate (200 μ g/m1) by cell, if plasmid loss, cell still can be killed because of the toxic action of G418.Under these conditions, cell can continue growth, shows that the EC109 cell strain of blank plasmid of stable transfection and interference plasmid is successfully set up.

The method of transfection is: at first, add 97 μ l serum free mediums in glass test tube, directly add 3 μ l FuGENE6 (Roche company) transfection reagents then inward, leave standstill 5min under the room temperature behind the mixing gently.Get 1 μ g plasmid (PSE plasmid and pSUPER.neo empty carrier) and add in the above mixture, gently mixing.After leaving standstill 15min under the room temperature, get above mixture and add in the culture dish, place under 5%CO2, humidity 95% and 37 ℃ of conditions and cultivate.Behind the 24h, the nutrient solution in the culture dish is changed to routine 199 nutrient solutions that contain G418 (400mg/L) screens.After 14 days, anti-medicine clone grows, and is changed to the nutrient solution that contains 200mg/L G418 in the nutrient solution and continues to cultivate the amplification of going down to posterity.

The cell strain that screening is set up is used for the analysis of interference effect.The present invention respectively with the method for RT-PCR and Western blotting from transcribing the analysis of carrying out interference effect with translation skill.Extracting total protein of cell Western blotting analyzes, results suggest (Fig. 5 A) PSE1 and PSE2 all have in various degree interference effect to Ezrin on protein level, and Ezrin expresses indifference between the PSC of transfection empty carrier and the EC109 cell that do not deal with, wherein PSE1 contrasts and has weakened 87%, and PSE2 then is 75%.Extract cell total rna, carry out RT-PCR with the specific primer of human Ezrin, the expression that the result is presented at Ezrin among rna level PSE1 and the PSE2 all weakens than two contrasts, and PSE1＞PSE2 (Fig. 5 C), and this result with Westernblotting is consistent.Go down to posterity through successive, gather in the crops respectively the 7th, 8,9 generation total protein of cell carry out Western blotting and detect, to determine interferential stability (Fig. 5 B).The result shows that each Dai Jun has obvious interference effect and degree more stable.

All experiments show that all siRNA expression vector provided by the present invention can effectively be expressed siRNA and can be disturbed the expression of Ezrin special, efficiently in mammalian cell, for the function of research Ezrin gene in the esophageal carcinoma provides good instrument.

Suppress the siRNA and the expression vector sequence table thereof of human Ezrin gene expression

SEQUENCE?LISTING

＜110〉Medical College of Shantou University

＜120〉siRNA and the expression vector thereof of inhibition human Ezrin gene expression

<130>

<160>4

<170>Patent?In?version?3.2

<210>1

<211>

<212>DNA

＜213〉artificial sequence

<400>1

E1：

5’GATCCCCTCCACTATGTGGATAATAATTCAAGAGATTATTATCCACATAGTGGATTTTTGGAAA?3’

5’AGCTTTTCCAAAAATCCACTATGTGGATAATAATCTCTTGAATTATTATCCACATAGTGGAGGG?3’

<210>2

<211>

<212>DNA

＜213〉artificial sequence

<400>2

E2：

5’GATCCCCACTTTGGCCTCCACTATGTTTCAAGAGAACATAGTGGAGGCCAAAGTTTTTTGGAAA?3’

5’AGCTTTTCCAAAAAACTTTGGCCTCCACTATGTTCTCTTGAAACATAGTGGAGGCCAAAGTGGG?3’

<210>3

<211>

<212>DNA

＜213〉artificial sequence

<400>3

5′TCCACTATGTGGATAATAA3′

<210>4

<211>

<212>DNA

＜213〉artificial sequence

<400>4

5′ACTTTGGCCTCCACTATGT3′

Claims (5)

1. siRNA who suppresses human Ezrin gene expression, its base sequence is: 5 ' TCCACTATGTGGATAATAA3 ' acts on the 274-292 of human Ezrin mRNA.

2. carrier that can produce the siRNA that suppresses human Ezrin gene expression is characterized in that it has following basic structure: the circular double stranded DNA molecule that is linked in sequence and forms by promotor, Ezrin coding region, termination codon, dna sequence dna,

Promotor is for starting the sequence that produces siRNA, and it is the element of its downstream next-door neighbour's of startup expression of gene;

The Ezrin coding region is for expressing the coding region of the described siRNA of claim 1, and it is a double-stranded RNA, and base sequence is E1:

5’GATCCCCTCCACTATGTGGATAATAATTCAAGAGATTATTATCCACATAGTGGATTTTTGGAAA?3’

5’AGCTTTTCCAAAAATCCACTATGTGGATAATAATCTCTTGAATTATTATCCACATAGTGGAGGG?3’；

Termination codon is 5～6 T;

Dna sequence dna is the dna sequence dna between termination codon and promotor of any eucaryon plasmid carrier and/or virus, contains the replication origin of plasmid vector DNA and makes the host bacterium or certain antibiotic resistant gene of eukaryotic cell acquisition antagonism.

3. carrier according to claim 2 is characterized in that described promotor is a polymerase-III H1-RNA gene promoter.

4. carrier according to claim 2 is characterized in that described any eucaryon plasmid carrier and/or virus are the pSUPER.neo carrier.

5. carrier according to claim 2 is characterized in that described antibiotics resistance gene is microbiotic G418 resistant gene neo.

Images