CN101270358A - MiRNA sequence and uses thereof - Google Patents

Abstract

The invention provides a miRNA sequence of liver relating to hepatoma cells, the sequence of the precursor thereof, an antisense oligonucleotide sequence, and uses thereof in the preparation of medicines for treating liver cancer.

Description

A kind of miRNA sequence and uses thereof

Technical field

The invention belongs to biomedical professional domain, relate to human miRNAs, miRNA precursor, miRNA Antisensedigonucleotsequence sequence and expression vector thereof, and the purposes in preparation treatment liver cancer diseases medicine.

Background technology

MiRNA (microRNA, microRNA) is the RNA molecule that a class has 19～25nt, is to process generation by its precursor molecule under the effect of enzyme, and its precursor sequence is generally 70～120nt, extensively is present in the organism.Because the miRNA sequence has certain conservative property in different biologies, the function that generally believes miRNA at present is some primary processes that participate in life, as the cell proliferation in the growth course, necrocytosis, stress reaction and metabolism of fat etc., more and more evidences shows that miRNA plays the vital role of regulate gene expression in cell.The nearest canceration of discovering miRNA and cell has extremely close relation, play the miRNA decline of tumor suppressor gene effect or the generation that disappearance can cause tumour, have been found that miRNA is relevant with tumor diseases such as lung cancer, mammary cancer, prostate cancer, uterus carcinoma, colorectal carcinoma, Burkitt lymphoma and chronic lymphocytic leukemias.Analytical results shows that half miRNA that has found is positioned karyomit(e) oncogene relevant range and chromosomal fragile site approximately.These results of study show that all miRNA plays an important role in cell proliferation, differentiation and canceration.The discovery of the relevant miRNA of tumour may produce great influence to genetic treatment of tumor.Analyze by large-scale miRNA differential expression, can identify the miRNA that tumour is relevant tumour and healthy tissues.By introducing the performance that can suppress the miRNA effect with miRNA complementary antisense oligonucleotide effectively, suppress growth of tumor with oncogene characteristic.By modification to antisense oligonucleotide, can obtain more continual and steady inhibition effect, can be lower than other the toxic side effect of treatment means.On the contrary, cross expression by virus vector or plasmid vector and have the miRNA or the miRNA precursor of tumor suppressor gene effect, and then suppress the particular target expression of gene of its regulation and control, also can reach the effect that suppresses tumor growth.Therefore, the miRNA that finds TS expression has crucial meaning to diagnosing tumor and treatment based on miRNA.

Summary of the invention

Liver cancer is the major disease of serious harm human health, has important use at the discovery of the biomolecules of the diagnosis of liver cancer and treatment and is worth.The purpose of this invention is to provide a kind of miRNA, miRNA precursor and its Antisensedigonucleotsequence sequence, and expression vector, miRNA, miRNA precursor and its antisense oligonucleotide that this invention is related, and the purposes of expression vector in preparation treatment liver cancer diseases medicine.

The present invention is the clonal analysis that material carries out the miRNA molecule with people's liver cancer and cancer beside organism.Adopt the molecular biology routine techniques, separate obtaining microRNA from people's liver cancer with cancer beside organism, microRNA is mixed, add Poly (A) tail through 3 ' end, 5 ' end adds RNA joint, reverse transcription, pcr amplification, cloning and sequencing, the nucleotide sequence of acquisition gene fragment.Through order-checking and bioinformatic analysis, we have obtained the wherein RNA molecule of a treaty 22t.Through the Blast comparison, the RNA secondary structure analysis, Northern blot hybridization is confirmed, and it is miRNA molecule, called after miR-m30.MiRNA is the ripe body that is formed by enzyme processing back in cell by the miRNA precursor rna molecule, through the homology analysis of gene order, obtains the corresponding precursor RNA sequence of miR-m30.In addition, at this miRNA sequences Design synthesized its 2 '-the O-modified antisense oligonucleotide sequence that methylates, and the plasmid expression vector of this miRNA precursor, and its influence to liver cancer cell growth analyzed.

MiRNA clone provided by the present invention is from human liver cancer cell, and ripe miRNA sequence length is 22nt, and its precursor sequence can form the typical secondary structure of miRNA precursor, meets the constitutional features of miRNA.Northern blot and quantitative RT-PCR detected result show high expression level in this miRNA difference liver cancer tissue, the low expression in cancer beside organism.Make up the fibrocyte expression vector of the eucaryon of miR-m30, and transfection liver cancer cell HepG2, the result shows the propagation of expressing miR-m30 energy obvious stimulation liver cancer cell in liver cancer cell.The antisense 2 of synthetic miR-m30 '-the O-methyl RNA, and transfection liver cancer cell HepG2, the result shows that the antisense oligonucleotide of transfection miR-m30 in liver cancer cell can obviously suppress the propagation of liver cancer cell.Be accomplished based on above-mentioned working copy invention.

Specifically, human miRNAs-miR-m30 provided by the present invention comprises following sequence: 5 ' ACUCGGCGUGGCGUCG GUCGUG.

The precursor RNA of human miRNAs-miR-m30 provided by the present invention comprises following sequence: 5 ' CUACCAAUCUCGACCGGACCUCGACCGGCUCGUCUGUGUUGCCAAUCGACUCGGCG UGGCGUCGGUCGUGGUAG.

The antisense oligonucleotide of human miRNAs-miR-m30 provided by the present invention comprises following sequence: 5 ' CACGACCGACGCCACGCCGAGU.

Human miRNAs precursor-gene provided by the present invention is positioned human chromosome 10q24 on human chromosome.

MiRNA provided by the invention and precursor sequence thereof, antisense sequences also can adopt the method for chemosynthesis to obtain, for strengthening pharmacy features such as its stability, bioavailability, tissue target tropism, can carry out thio-modification or methoxyl group modification to it, also can take dual mode in conjunction with modification.For example adopt dna synthesizer when synthetic, to carry out thio-modification automatically.

MiRNA provided by the invention and precursor sequence thereof, antisense sequences and expression vector thereof can be used for preparing the medicine for the treatment of liver cancer diseases.For example with its separately or mixed form be that active principle is mixed with non-intestinal drug delivery agent, according to mode of administration, receptor's age, body weight, hepatic and renal function, disease degree with an amount of dosed administration; Also can adopt gene therapy methods, be expression vector with plasmid or adenovirus, and it is efficiently expressed at the canceration position.

Description of drawings

Fig. 1 .Northern blot detects miR-m30 and expresses in the HepG2 cell

Fig. 2. the expression of quantitative PCR detection miR-m30 in liver cancer and cancer beside organism

Fig. 3. cross expression miR-m30 and promote hepatoma cell proliferation

Fig. 4 .miR-m30 antisense oligonucleotide suppresses the propagation of system liver cancer cell

The present invention will be further described below in conjunction with embodiment.

Embodiment one

The clone of miRNA and analysis

1. the extraction purifying of the little RNA of human liver cancer cell

Use mirVana ^TMMiRNA Isolation (Ambion, Austin, TX) test kit from liver cancer and cancer beside organism extract little RNA (≤200nt), be dissolved in no RNase water, mix the back and measure RNA concentration in 260nm.

2. make up small RNA molecular cDNA library

At first use the Poly of Takara company (A) polysaccharase to add Poly (A) tail at microRNA 3 ' end.The ATP that adds 1.5 μ g small RNA, 5U poly (A) polysaccharase (Takara), 5 μ l 10 * damping fluids and 1mmol/L in 50 μ l reaction systems is in 37 ℃ of reaction 30min.Phenol/chloroform extracting, ethanol sedimentation reclaims RNA.Hold the RNA joint (CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA) that adds 44nt at 5 of RNA ' again with T4 RNA ligase (Invitrogen), phenol/chloroform extracting, ethanol sedimentation reclaims RNA.Then with the 60nt RT anchor primer (ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) that contains a plurality of T ₃₀VN carries out reverse transcription, and SuperScript III (invitrogen) ThermoScript II is used in reverse transcription, obtains cDNA.According to RT primer and RNA joint design PCR primer (primer 1; 5 '-GGACACTGACATGGACTGAAGGAGTA-3 ', primer 2: 5 '-ATTCTAGAGGCCGAGGCGGCCGACATGT-3 '), and be that template is carried out PCR with the product of reverse transcription.The capable native polyacrylamide gel electrophoresis of PCR product reclaims the PCR product that size is about 109bp, and is connected on the T carrier, the order-checking of picking positive colony.

3. the cloned sequence analysis of Huo Deing

Cloning and sequencing obtains sequence people's gene group sequence (http://www.ncbi.nlm.nih.gov/blast) is carried out the BLAST analysis, adopt Mfold program (http://www.bioinfo.rpi.edu/applications/mfold/old/rna/form1.cgi) that possible miRNA precursor RNA sequence is carried out structural analysis, screening obtains candidate's miRNA molecule and precursor molecule thereof with reference to the miRNA molecular criteria.Adopt bioinformatics method that the miRNA precursor molecule has been carried out chromosomal localization simultaneously.Wherein obtain a new miRNA, and the precursor RNA sequence.MiRNA called after miR-m30.The length of miR-m30 is 22nt (miR-m30:5 ' ACUCGGCGUGGCGUCGGUCGUG), its forebody length is 74nt (miR-m30 precursor 5 ' CUACCAAUCUCGACCGGACCUCGACCGGCUCGUCUGUGUUGCCAAUCGACUCGGCG UGGCGUCGGUCGUGGUAG), and the miR-m30 precursor can form the typical hair clip ring texture of miRNA precursor.The chromosomal localization analysis revealed, the miR-m30 precursor-gene is positioned human chromosome 10q24.

4.miR-m30 Northern blot identify

Use mirVanaTM miRNA Isolation (Ambion, Austin, TX) test kit from tire liver, liver cancer and cancer beside organism extract small RNA (≤200nt), miR-m30 reverse complemental oligonucleotide with [γ-32P] ATP mark is the hybridization detection probes, detect the expression of miR-m30 in people's tire liver, liver cancer and cancer beside organism, detected result such as Fig. 1 according to conventional northern blot method.

Embodiment two

The expression of quantitative PCR detection miR-m30 in liver cancer and cancer beside organism

With liver cancer tissue and corresponding cancer beside organism is material, extracts total RNA (working method is seen its specification sheets) with Trizol reagent (Invitrogen).Respectively get the total RNA of 10 μ g and add Poly (A) with Poly (A) polysaccharase (Ambion) at 3 ' end, reaction conditions is as follows: RNA10 μ g, 5 * damping fluid, 10 μ l, 25mM MnCl ₂5 μ l, 10mM ATP 5 μ l, Poly (A) polysaccharase 2U adds the H that DEPC handles ₂O is to cumulative volume 50 μ l.Add 50 μ l DEPC treating water after 30 minutes in 37 ℃ of reactions, add the phenol/chloroform (1: 1) of 100 μ l (equivalent) again, fully mixing.Centrifugal 5 minutes of 12000rpm gets supernatant and moves in another Eppendorf tube, adds 100 μ l (equivalent) chloroforms again, fully behind the mixing with 12000rpm centrifugal 5 minutes.Get supernatant and move in another Eppendorf tube, add 3MNaAc (pH5.2) mixing of 10 μ l (1/10 volume).The cold dehydrated alcohol that adds 250 μ l was again placed 1 hour for-20 ℃.In 4 ℃, with 12000rpm centrifugal 20 minutes, the ethanol rinsing precipitation with 75% was dissolved in after room temperature is dried in the water that an amount of DEPC handles.

RNA with above-mentioned processing is a template, with GCG AGC ACA GAA TTA ATA CGA CTC ACT ATAGG (T) ₁₈VN is that primer carries out reverse transcription reaction (reaction conditions is with reference to the specification sheets of reversed transcriptive enzyme), and synthetic cDNA is the template of quantitative PCR reaction.

With reverse transcriptase primer sequence GCG AGC ACA GAA TTA ATA CGA C is 3 ' PCR primer, with miR-m30 partial sequence ACT CGG CGT GGC GTC GGT C is 5 ' PCR primer, is that template is carried out the quantitative PCR reaction with QuantiTectSYBR Green PCR test kit with aforementioned cDNA.The expression of liver cancer and the miR-m30 of cancer beside organism is seen Fig. 2.LTP1 among Fig. 2, LTP2, LTP3 are the other tissue of liver cancer; LT1, LT2, LT3 are corresponding liver cancer tissue.The result shows with corresponding cancer beside organism and compares that the expression level of miR-m30 in liver cancer tissue significantly strengthens.This shows that there is notable difference in the expression level of miR-m30 in hepatic tissue and liver cancer tissue.

Embodiment three

Cross expression miR-m30 and promote hepatoma cell proliferation

The precursor sequence of pcr amplification miR-m30 is connected to the expression vector pcDNA-miR-m30 that makes up miR-m30 on the pcDNA3.0 carrier for expression of eukaryon.The HepG2 cell is cultivated based on 5%CO with the DMEM that contains 10% foetal calf serum ₂37 ℃ of incubators in cultivate.Transfection is planted in 96 orifice plates and go into 3000 cells/well the day before yesterday, carries out transfection with lipofectamine 2000 by its specification sheets, every hole transfection 0.1 μ g plasmid.Adopt mtt assay to detect the cell proliferation situation behind the transfection 72h, add MTT to final concentration 50 μ g/ml, continue to cultivate 4h in 37 ℃ of incubators in 96 porocyte culture plates, the sucking-off nutrient solution, every hole adds DMSO 150 μ l, and the 10min that vibrates on the vortex vibrator under the room temperature surveys its light absorption value in the 492nm place.The results are shown in Figure 3.As shown in Figure 3, compare with the HepG2 cell of transfection control vector pcDNA3.0, transfection pcDNA-miR-m30 overexpression miR-m30 can significantly promote the propagation of HepG2 liver cancer cell.This shows that miR-m30 has important biological function in liver cancer cell.

Embodiment four

The miR-m30 antisense oligonucleotide suppresses the propagation of system liver cancer cell

2 of synthetic miR-m30 and miR-21 '-O-methyl modified antisense oligonucleotide RNA and irrelevant contrast RNA.MiR-m30 Antisensedigonucleotsequence sequence 5 ' CACGACCGACGCCACGCCGAGU; The miR-21 Antisensedigonucleotsequence sequence is 5 ' UCAACAUCAGUCUGAUAAGCUA; Irrelevant contrast RNA sequence is 5 ' UCUACUCUUUCUAGGAGGUUGUGA.The HepG2 cell is cultivated based on 5%CO with the DMEM that contains 10% foetal calf serum ₂37 ℃ of incubators in cultivate.Transfection is planted in 96 orifice plates and go into 3000 cells/well the day before yesterday, carries out transfection with Oligofectamine by its specification sheets, and sense-rna concentration is 100nM.Adopt mtt assay to detect the cell proliferation situation behind the transfection 72h, add MTT to final concentration 50 μ g/ml, continue to cultivate 4h in 37 ℃ of incubators in 96 porocyte culture plates, the sucking-off nutrient solution, every hole adds DMSO 150 μ l, and the 10min that vibrates on the vortex vibrator under the room temperature surveys its light absorption value in the 492nm place.The results are shown in Figure 4,1 is irrelevant RNA contrast in the drawings, 2 be 2 '-the antisense oligonucleotide RNA of the miR-21 that the O-methyl is modified, 3 be 2 '-the antisense oligonucleotide RNA of the miR-m30 that the O-methyl is modified.As shown in Figure 4, after sense-rna suppressed miR-m30, the propagation of HepG2 cell had been subjected to inhibition to a certain degree, and the sense-rna of contrast RNA and miR-21 does not all influence the propagation of HepG2 cell.This antisense oligonucleotide that shows miR-m30 is inhibited to the growth of liver cancer cell, has the purposes of treatment liver cancer relative disease.

Sequence table

＜110〉INST OF EMISSION ﹠ RADIATION M

＜120〉a kind of miRNA sequence and uses thereof

<160>3

<210>1

<211>22

<212>RNA

＜213〉people

<400>

ACUCGGCGUG?GCGUCGGUCG?UG?22

<210>2

<211>74

<212>RNA

＜213〉people

<400>

CUACCAAUCU?CGACCGGACC?UCGACCGGCU?CGUCUGUGUU?GCCAAUCGAC?UCGGCGUGGC?GUCGGUCGUG?GUAG?74

<210>3

<211>22

<212>RNA

＜213〉artificial sequence

<220>

＜223〉people source miR-m30 antisense oligonucleotide

<400>

CACGACCGAC?GCCACGCCGA?GU?22

Claims (9)

1. a human miRNAs-miR-m30 is characterized in that comprising following miRNA sequence: 5 ' ACUCGGCGUGGC GUCGGUCGUG.

2. the precursor RNA of the described miR-m30 of claim 1 is characterized in that comprising following sequence: 5 ' CUACCAAUCUCGACCGGACCUCGACCGGCUCGUCUGUGUUGCCAAUCGACUCGGCG UGGCGUCGGUCGUGGUAG.

3. the antisense oligonucleotide of the described miR-m30 of claim 1 is characterized in that comprising following sequence: 5 ' CACGACCGACGCCACGCCGAGU.

4. the described antisense oligonucleotide of claim 3, this Nucleotide is selected from DNA or RNA.

5. the described arbitrary nucleotide sequence of claim 1～3 is characterized by this sequence and has carried out thio-modification, methoxyl group modification or both combination modifications.

6. the described arbitrary nucleotide sequence of claim 1～3 is characterized by this sequence and obtains by chemosynthesis.

7. the described arbitrary nucleotide sequence of claim 1～3 is characterized by this sequence and expresses acquisition by making up eukaryotic expression vector.

8. the described arbitrary nucleotide sequence of claim 7, it is characterized by described carrier is plasmid vector or virus vector.

9. arbitrary miR-m30, miR-m30 precursor, miR-m30 antisense oligonucleotide and its expression vector purposes in preparation treatment liver cancer diseases medicine.

Images