CN104147616B - The application of double-stranded RNA or its trim in tumor inhibitor is prepared - Google Patents
The application of double-stranded RNA or its trim in tumor inhibitor is prepared Download PDFInfo
- Publication number
- CN104147616B CN104147616B CN201410383877.3A CN201410383877A CN104147616B CN 104147616 B CN104147616 B CN 104147616B CN 201410383877 A CN201410383877 A CN 201410383877A CN 104147616 B CN104147616 B CN 104147616B
- Authority
- CN
- China
- Prior art keywords
- dsrna21
- ome
- cell
- nasopharyngeal carcinoma
- double
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses the application of double-stranded RNA or its trim in tumor inhibitor is prepared.The application of double-stranded RNA provided by the present invention or its trim in tumor inhibitor is prepared, a chain-ordering of the double-stranded RNA is SEQ ID No.1 in sequence table, and another chain-ordering of the double-stranded RNA is SEQ ID No.2 in sequence table；The trim of the double-stranded RNA is by following A 1) or A2) or A3) the obtained double-stranded RNA trim of modification：A1) 2 ' OH of the ribose of the double-stranded RNA are modified；A2) phosphodiester bond of the connection nucleotides to the double-stranded RNA is modified；A3 the modification of cholesterol) is connected to 5 ' ends of the ribose of the double-stranded RNA.It is demonstrated experimentally that 2 ' OMe the dsRNA21 of the application or its trim can effectively suppress tumour and tumour cell.
Description
Technical field
The present invention relates to the application of biological technical field double center chain RNA or its trim in tumor inhibitor is prepared.
Background technology
RNA interference (RNA interference, RNAi) be on a kind of molecular biology with homologous short of target-gene sequence
The particularly effective PTGS phenomenon (Fire, 1998) of the sequence-specific of double-stranded RNA (dsRNA) induction, its machine
System is translation by hindering specific gene or transcription come inhibition of gene expression.When importing in cell and endogenous mRNA code areas
During homologous double-stranded RNA, the mRNA occurs degraded and causes silenced gene expression.RNAi is a kind of distinctive gene of eukaryotic
Silencing Mechanisms, determining cell fate, cell differentiation direction and retaining etc. to play particularly important effect.Because RNAi has
Have and lock any ability for causing disease or disease related protein expression, and RNAi technology specificity is high, effect is rapid, side reaction
It is small, while effectively silencing of target genes, the regulator control system of cell itself is not influenceed.RNAi is as a kind of high at present
The sequence specific gene occluding technique of effect is extremely rapid in communicable disease and the development of malignant tumour field of gene.
Small nucleic acid (miRNA) be it is a kind of it is endogenous, wide expression is endogenous comprising 21~25 nucleotides in vivo
Property non-coding tiny RNA, is one of material for causing RNA interference phenomenon immediate causes.MiRNA by about 70 with hairpin structure~
The single stranded RNA precursor of 90 base sizes generates after the processing of Dicer enzymes, highly conserved in evolution, passes through Translational repression
Stability of the controlling gene expression without influenceing transcript.Each miRNA can have multiple regulation and control (target) genes, and several
MiRNA can also adjust same gene, it is assumed that miRNA adjusts the gene of one of trichotomy.MiRNA adjusts body
Important physiology and pathologic process, in cell differentiation, play a great role, and have during biological development and disease development
There is very strong tissue specificity, caused the concern of increasing researcher.
Cyclin dependent kinase 4 (cyclin dependent kinase 4, CDK4) is as a kind of important cycle
Albumen.Research shows tumour cell malignant proliferation mainly due to caused by the imbalance of cell cycle, Cyclin D-CDK4/
CDK6 is transition key factor of the cell cycle regulation from G1 to the S phases.Oneself is proved to be a kind of oncogene to CDK4 genes, with tumour
Generation, development and the prognosis of patient it is closely related.In kinds of tumor cells such as stomach cancer, breast cancer, non-small cell lung cancer, uterus
The overexpression with CDK4 and overactivity phenomenon are had been found that in endometrial carcinomas, liver cancer and cancerous issue, therefore CDK4 can be done
For a potential target spot in therapy of tumor.
In addition the G1 phases are proliferative cell unique periods that can receive from the incoming propagation in the external world or Inhibit proliferaton signal, are acted on
Have a common boundary the phase in G1 phases or G1/S, the active cell cycle and promote DNA synthesis cyclin D be one than other cyclins more
Sensitive index.
The content of the invention
The technical problems to be solved by the invention are how to suppress tumour cell and/or suppression tumour.The suppression tumour
Cell can be to suppress tumor cell proliferation, and the tumour that suppresses can be the generation for suppressing tumour and/or the growth for suppressing tumour.
In order to solve the above technical problems, present invention firstly provides a kind of double-stranded RNA or its trim to prepare tumour suppression
Application in preparation or inhibiting tumour cells agent, the double-stranded RNA, its entitled dsRNA21, the dsRNA21 chain
The nucleotides sequences from 5 ' ends to 3 ' ends be classified as SEQ ID No.1 in sequence table, another chain of the dsRNA21 from 3 ' ends
Nucleotides sequence to 5 ' ends is classified as SEQ ID No.2 in sequence table.
Wherein, SEQ ID No.1 are made up of 21 ribonucleotides, and SEQ ID No.2 are made up of 21 ribonucleotides,
SEQ ID No.1 1-19 positions ribonucleotide and SEQ ID No.2 3-21 positions ribonucleotide reverse complemental, by two
The double-stranded RNA that person is formed is named as dsRNA21.
In above-mentioned application, the trim is concretely modified the dsRNA21 double-stranded RNAs for being modified to obtain
Thing, its entitled dsRNA21-mimic.In the double-stranded RNA trim, various method of modifying can be selected, including selected from core
One or more of combinations in sugar-modified, base modification and phosphate backbones modification etc..The dsRNA21 can such as be carried out following
A1) or A2) or A3) modification obtain the double-stranded RNA trim：
A1) 2 '-OH of the ribose of the dsRNA21 are modified；
A2) phosphodiester bond of the connection nucleotides to the dsRNA21 is modified；
A3 the modification of cholesterol) is connected to 5 ' ends of the ribose of the dsRNA21.
In above-mentioned application, the phosphodiester bond of the connection nucleotides to the dsRNA21 is modified to will be described
The oxygen of phosphodiester bond is substituted with sulphur；2 '-OH of the ribose to the dsRNA21, which are modified to, uses the 2 '-OH
Methoxyl group or fluorine substitution carry out deoxidation modification to the 2 '-OH.
In one embodiment of the invention, the double-stranded RNA trim is by the SEQ ID No.2 of the dsRNA21
What 2 '-OH of all cytidine monophosphates were substituted by that chain shown in methoxyl group and SEQ ID No.1 do not modified to obtain in shown chain repaiies
Jewelry, its entitled 2 '-OMe-dsRNA21.
In above-mentioned application, the inhibiting tumour cells agent can be suppress tumor cell proliferation product (such as medicine) and/or
Promote the product (such as medicine or vaccine) of apoptosis of tumor cells, the tumor inhibitor can be to suppress tumorigenic product (such as
Medicine or vaccine) and/or suppress tumour growth product (such as medicine or vaccine).
In above-mentioned application, the tumour can be nasopharyngeal carcinoma, intestinal cancer, cervical carcinoma, liver cancer, stomach cancer, breast cancer, lung cancer, non-small
Cell lung cancer or carcinoma of endometrium.
In above-mentioned application, the tumor cell proliferation that suppresses can be the G1 phases for suppressing tumor cell proliferation.
In order to solve the above technical problems, present invention also offers the biomaterial related to dsRNA21 to prepare tumour suppression
Application in preparation or inhibiting tumour cells agent.
The biomaterial related to dsRNA21 provided by the present invention is preparing tumor inhibitor or inhibiting tumour cells agent
In application in, the biomaterial is following B1)-B12) any of：
B1 the DNA molecular of the dsRNA21) is encoded；
B2 B1) is contained) expression cassette of the DNA molecular；
B3 B1) is contained) recombinant vector of the DNA molecular；
B4 B2) is contained) recombinant vector of the expression cassette；
B5 B1) is contained) recombinant microorganism of the DNA molecular；
B6 B2) is contained) recombinant microorganism of the expression cassette；
B7 B3) is contained) recombinant microorganism of the recombinant vector；
B8 B4) is contained) recombinant microorganism of the recombinant vector；
B9 B1) is contained) the transgenetic animal cell system of the DNA molecular；
B10 B2) is contained) the transgenetic animal cell system of the expression cassette；
B11 B3) is contained) the transgenetic animal cell system of the recombinant vector；
B12 B4) is contained) the transgenetic animal cell system of the recombinant vector.
Application of the above-mentioned biomaterial related to dsRNA21 in tumor inhibitor or inhibiting tumour cells agent is prepared
In, the tumour can be intestinal cancer, nasopharyngeal carcinoma, cervical carcinoma, liver cancer, stomach cancer, breast cancer, lung cancer, non-small cell lung cancer or intrauterine
Film cancer.
Application of the above-mentioned biomaterial related to dsRNA21 in tumor inhibitor or inhibiting tumour cells agent is prepared
In, B2) described in the expression cassette (dsRNA21 expression cassettes) of DNA molecular containing coding dsRNA21 be to refer in host cell
Middle expression dsRNA21 DNA, the DNA not only may include the promoter for starting dsRNA21 transcriptions, may also include and terminate dsRNA21
The terminator of transcription.Further, the expression cassette may also include enhancer sequence.
The recombinant vector of the dsRNA21 expression cassettes can be contained with existing expression vector establishment.
Application of the above-mentioned biomaterial related to dsRNA21 in tumor inhibitor or inhibiting tumour cells agent is prepared
In, the carrier can be plasmid, sticking grain, bacteriophage or viral vector.
Application of the above-mentioned biomaterial related to dsRNA21 in tumor inhibitor or inhibiting tumour cells agent is prepared
In, B5)-B8) and described in microorganism can be yeast, bacterium, algae or fungi.
Application of the above-mentioned biomaterial related to dsRNA21 in tumor inhibitor or inhibiting tumour cells agent is prepared
In, B9)-B12) and described in transgenetic animal cell system do not include propagating materials.
Application of the above-mentioned biomaterial related to dsRNA21 in tumor inhibitor or inhibiting tumour cells agent is prepared
In, the tumor inhibitor can be the inhibitor for suppressing tumorigenic inhibitor and/or suppressing tumour growth.
Application of the above-mentioned biomaterial related to dsRNA21 in tumor inhibitor or inhibiting tumour cells agent is prepared
In, the inhibiting tumour cells agent is the product of suppression tumor cell proliferation and/or the product of promotion apoptosis of tumor cells.
In above-mentioned application, the tumor cell proliferation that suppresses can be the G1 phases for suppressing tumor cell proliferation.
Following M1) or purposes M2), fall within protection scope of the present invention：
M1) dsRNA21 or described dsRNA21-mimic are preparing suppression tumour cell cycle protein D expression reagent
In application；
M2) dsRNA21 or described dsRNA21-mimic are preparing suppression tumour cell cycle protein dependent kinase
Application in 4 expression reagents.
In such use, the tumour can be intestinal cancer, nasopharyngeal carcinoma, cervical carcinoma, liver cancer, stomach cancer, breast cancer, lung cancer, non-small
Cell lung cancer or carcinoma of endometrium.
In such use, the Cyclin D1 can be cyclinD3.
Following M3) or purposes M4), fall within protection scope of the present invention：
M3) above-mentioned biomaterial B1)-B12) preparing the application in suppressing tumour cell cycle protein D expression reagent；
M4) above-mentioned biomaterial B1)-B12) preparing the expression reagent of suppression tumour cell cycle protein dependent kinase 4
In application.
In such use, the tumour can be intestinal cancer, nasopharyngeal carcinoma, cervical carcinoma, liver cancer, stomach cancer, breast cancer, lung cancer, non-small
Cell lung cancer or carcinoma of endometrium.
In such use, the Cyclin D1 can be cyclinD3.
In order to solve the above technical problems, present invention also offers treatment and/or product (such as medicine or epidemic disease of pre- preventing tumor
Seedling).
Treatment provided by the present invention and/or the product (such as medicine or vaccine) of pre- preventing tumor, its active component is described
DsRNA21 or described dsRNA21-mimic or above-mentioned biomaterial B1)-B12) in it is any.
In the product of above-mentioned treatment and/or pre- preventing tumor (such as medicine or vaccine), the treatment and/or the production of pre- preventing tumor
Product can be the medicine for the treatment of and/or pre- preventing tumor, and the formulation of the medicine can be powder-injection.
In the product of above-mentioned treatment and/or pre- preventing tumor (such as medicine or vaccine), the tumour is intestinal cancer, nasopharyngeal carcinoma, palace
Neck cancer, liver cancer, stomach cancer, breast cancer, lung cancer, non-small cell lung cancer or carcinoma of endometrium.
In the product of above-mentioned treatment and/or pre- preventing tumor (such as medicine or vaccine), the medicine can also include other medicines
Acceptable carrier on." pharmaceutically acceptable carrier " used herein should be with the double-stranded RNA in medicine of the present invention point
Son is compatible." pharmaceutically acceptable carrier " refers to internal transfection reagent, as polyethyleneimine (PEI), jetPEI are (linear
Polyethyleneimine), liposome, transferrins, folic acid, nano-emulsion, nanoparticle etc..Can be used as pharmaceutically acceptable carrier or its
The other examples of some materials of component are freeze drying protectant carbohydrates, such as lactose, dextrose and saccharose；Starch, such as cornstarch
And potato starch；Tragacanth powder；Malt；Gelatin；Talcum；Kollag, such as stearic acid and magnesium stearate；Calcium sulfate；
Vegetable oil, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cupu oil；Polyalcohol, such as glycerine, mannitol；Sea
Alginic acid；Emulsifying agent, such as Tween；Phosphatide, such as lecithin, soybean lecithin, phosphatidyl-ethanolamine, phosphatidyl glycerol, phosphatidyl-4
Alcohol, phosphatidylserine, stearmide；Cholesterol；Macromolecular polymer, such as polyethyleneimine, chitosan, hyaluronic acid；Profit
Humectant, such as NaLS；Colouring agent；Flavor enhancement；Tablet agent, stabilizer；Antioxidant；Preservative；Apirogen water；It is isotonic
Salting liquid；With phosphate buffer etc.；Physiological saline, glycerine and phosphate buffered saline (PBS).
In the product of above-mentioned treatment and/or pre- preventing tumor (such as medicine or vaccine), the powder-injection can with physiological saline or
The isotonic D/W of person is solvent.
In the product of above-mentioned treatment and/or pre- preventing tumor (such as medicine or vaccine), the powder-injection can be using mannitol as jelly
Dry protective agent.
The preparation method of above-mentioned powder-injection, falls within protection scope of the present invention.
The preparation method of above-mentioned powder-injection, including preparation of samples, pre-freeze, primary drying (lyophilization), redrying (solution
Blot dry) and it is sealed five steps.
Experimental result shows, the dsRNA21 of the application or its trim can significantly inhibit the propagation of nasopharyngeal carcinoma cell：Nasopharynx
For cancer cell when handling 48h through 2 '-OMe-dsRNA21,2 '-OMe-dsRNA21 inhibit 27.7% nasopharyngeal carcinoma cell to breed；
When handling 72h through 2 '-OMe-dsRNA21,2 '-OMe-dsRNA21 inhibit 33.7% nasopharyngeal carcinoma cell to breed；Passing through
When 2 '-OMe-dsRNA21 handle 96h, 2 '-OMe-dsRNA21 inhibit 30.7% nasopharyngeal carcinoma cell to breed；Through 2 '-
When OMe-dsRNA21 is handled 10 days, clone's number of nasopharyngeal carcinoma cell is 320 ± 13, the nasopharyngeal carcinoma handled through 2 '-OMe-NC
Clone's number of cell is 147 ± 14.
The dsRNA21 of the application or its trim can suppress transition of the cell from the G1 phases to the S phases：Through 2 '-OMe-dsRNA21
The percentage containing Edu cells is 21.94 ± 3.08% in the S phase nasopharyngeal carcinoma cells of processing, the S phases handled through 2 '-OMe-NC
Percentage containing Edu cells in nasopharyngeal carcinoma cell is 37.5 ± 4.49%, the key factor CDK4 genes of cell cycle regulation
It is expressed as in the nasopharyngeal carcinoma cell handled through 2 '-OMe-dsRNA21 in the nasopharyngeal carcinoma cell handled through 2 '-OMe-NC
74.3%, the CCND3 genes of expression are expressed as through 2 '-OMe- in the nasopharyngeal carcinoma cell handled through 2 '-OMe-dsRNA21
NC processing nasopharyngeal carcinoma cell in expression 60.8%.
The dsRNA21 of the application or its trim can suppress the increase of tumor weight, gross tumor volume：NC group nude mouse tumors
Average weight is 0.043g ± 0.015g, and the average weight of dsRNA21 group nude mouse tumors is 0.023g ± 0.0084g；Injection needle
During agent two days, the average external volume of NC group nude mouse tumors is 30.74mm3, the average external volume of dsRNA21 group nude mouse tumors is
20.53mm3；During injection four days, the average external volume of NC group nude mouse tumors is 37.74mm3, dsRNA21 group nude mouse tumors it is flat
Equal volume is 30.41mm3；During injection six days, the average external volume of NC group nude mouse tumors is 65.20mm3, dsRNA21 group nude mices
The average external volume of tumour is 45.27mm3；During injection eight days, the average external volume of NC group nude mouse tumors is 75.21mm3,
The average external volume of dsRNA21 group nude mouse tumors is 51.94mm3；During injection ten days, the average external volume of NC group nude mouse tumors is
93.97mm3, the average external volume of dsRNA21 group nude mouse tumors is 73.05mm3。
Experiment shows that the 2 '-OMe-dsRNA21 of the application or its trim can effectively suppress tumour and tumour cell.
Brief description of the drawings
Fig. 1 is the nasopharyngeal carcinoma cell number handled respectively through 2 '-OMe-dsRNA21 and 2 '-OMe-NC.Wherein, dsRNA21
Represent that 2 '-OMe-dsRNA21, miR-NC represent that 2 '-OMe-NC, figure A are nasopharyngeal carcinoma cell respectively through 2 '-OMe-dsRNA21
96 hour cell number situations of change are handled with 2 '-OMe-NC；Scheme B be nasopharyngeal carcinoma cell through 2 '-OMe-dsRNA21 and 2 '-
OMe-NC handles the change curve of 96h inner cell numbers；Scheme C be nasopharyngeal carcinoma cell respectively through 2 '-OMe-dsRNA21 and 2 '-
OMe-NC handles the outside drawing of 72 hours；It is that nasopharyngeal carcinoma cell is handled 10 days through 2 '-OMe-dsRNA21 and 2 '-OMe-NC to scheme D
Number of cells afterwards.
Fig. 2 is the cell containing Edu in the S phase nasopharyngeal carcinoma cells handled through 2 '-OMe-dsRNA21 and 2 '-OMe-NC.Its
In, NC represents that 2 '-OMe-NC, dsRNA21 represent 2 '-OMe-dsRNA21.Left figure is 2 '-OMe- under Laser Scanning Confocal Microscope
Cell positive Edu in the nasopharyngeal carcinoma cell of dsRNA21 or 2 '-OMe-NC processing；Right figure calculates 2 '-OMe- for statistics
The percentage of cells on total cells containing Edu in the nasopharyngeal carcinoma cell of dsRNA21 or 2 '-OMe-NC processing.
Fig. 3 is the expression feelings of CCND3 and CDK4 in the nasopharyngeal carcinoma cell handled through 2 '-OMe-dsRNA21 and 2 '-OMe-NC
Condition.Wherein, the agarose gel electrophoresis testing result that A is CCND3 and CDK4 is schemed, the real-time fluorescence that figure B is CCND3 and CDK4 is determined
Testing result is measured, Cyclin D3 represent that CCND3, dsRNA21 represent that 2 '-OMe-dsRNA21, miR-NC represent 2 '-OMe-NC.
Fig. 4 is nude mouse tumor weight, volume and the outward appearance handled respectively through 2 '-OMe-dsRNA21 and 2 '-OMe-NC.Its
In, figure A be nude mice gross tumor volume, scheme A in " D " expression " my god ", " MM3" expression " cubic millimeter "；Scheme B to inject for the 5th
The tumor weight of (the 10th day tested) two days later nude mice of injection；Figure C is (testing two days later for the 5th injection
The 10th day) appearance of tumors of nude mice.DsRNA21 represents that 2 '-OMe-dsRNA21, NC represent 2 '-OMe-NC.
Embodiment
The present invention is further described in detail with reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the scope being not intended to be limiting of the invention.
Experimental method in following embodiments, it is conventional method unless otherwise specified.
Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.
BALB/C nude mices in following embodiments are Guangdong Province's Experimental Animal Center product.
Nasopharyngeal carcinoma cell in following embodiments is Nasopharyngeal Carcinoma Cell Line (CNE cell line), and CNE cell lines are that Kunming is thin
Born of the same parents storehouse product, deposit number are KCB 86019YJ.
The preparation of embodiment 1,2 '-OMe-dsRNA21
The nucleotides sequence from 5 ' ends to 3 ' ends of a dsRNA21 chain is classified as SEQ ID No.1 in sequence table, described
The nucleotides sequence from 3 ' ends to 5 ' ends of dsRNA21 another chain is classified as SEQ ID No.2 in sequence table.Wherein, SEQ ID
No.1 is made up of 21 ribonucleotides, and SEQ ID No.2 are made up of 21 ribonucleotides, SEQ ID No.1 1-19
The 3-21 positions ribonucleotide reverse complemental of position ribonucleotide and SEQ ID No.2, the double-stranded RNA of the two formation is named
For dsRNA21.Random ds RNA is as negative control for present invention selection, one of random ds RNA entitled NC, NC
The nucleotides sequence from 5 ' ends to 3 ' ends of chain is classified as being held from 3 ' to 5 ' ends for a chain of SEQ ID No.3, NC in sequence table
Nucleotides sequence is classified as SEQ ID No.4 in sequence table.By 2 ' of all cytidine monophosphates in chain shown in dsRNA21 SEQ ID No.2-
OH be substituted by the dsRNA21 that chain shown in methoxyl group and SEQ ID No.1 is not modified to obtain trim be named as 2 '-
OMe-dsRNA21.2 '-OH of all cytidine monophosphates in chain shown in NC SEQ ID No.4 are substituted by methoxyl group and SEQ ID
The trim for the NC that chain shown in No.3 is not modified to obtain is named as 2 '-OMe-NC.
The synthesis of 2 '-OMe-dsRNA21 and 2 '-OMe-NC commissions Shanghai Ji agate (GenePharma) Pharmaceutical Technology Inc.
(Wincott F,DiRenzo A,Shaffer C,GrimmS,Tracz D,Workman C,Sweedler D,Gonzalez
C,Scaringe S and Usman N.Synthesis,deprotection,analysis and purification of
RNA and ribozymes.Nucleic Acids Res.1995,23:2677-84)。
The influence of embodiment 2,2 '-OMe-dsRNA21 to tumor cell proliferation
In triplicate, the method tested every time is as follows for experiment：
2 '-OMe-dsRNA21 the powder that embodiment 1 is obtained are dissolved in the sterilized water of no RNase, make its final concentration of
20pmol/L, obtain 2 '-OMe-dsRNA21 solution.5 μ L, the 2 '-OMe-dsRNA21 solution and 5 μ L are taken respectively
Lipofectamine 2000 (Invitrogen), it is diluted in respectively in 245 μ L serum free medium (Opti-MEM),
2 '-OMe-dsRNA21 serum-free mediums and the serum-free mediums of lipofectamine 2000 are respectively obtained, will
The serum-free mediums of lipofectamine 2000 are incubated 5 minutes at room temperature, then train 2 '-OMe-dsRNA21 serum-frees
Nutrient solution mixes with the serum-free mediums of lipofectamine 2000, obtains 2 '-OMe-dsRNA21- liposome complex cultures
The μ L of liquid 500, and by the 2 '-OMe-dsRNA21- liposome complexes nutrient solution in being stored at room temperature 20 minutes.
Trained with the DMEM fluid nutrient mediums (10%FBS-DMEM fluid nutrient mediums, GIBCO products) containing 10% hyclone
Nasopharyngeal carcinoma cell (CNE, Kunming cell bank, deposit number are KCB 86019YJ) is supported, collects the nasopharyngeal carcinoma in exponential phase
Cell culture fluid, with above-mentioned nasopharyngeal carcinoma cell of the DMEM fluid nutrient mediums adjustment in exponential phase for containing 10% hyclone
Cell concentration in nutrient solution, it is 30000/mL to make final concentration of cells, obtains diluting nasopharyngeal carcinoma cell nutrient solution, into 6 orifice plates
The 100 μ L dilution nasopharyngeal carcinoma cell nutrient solutions are separately added into, it is 3000 to make cell content in every hole, and contains 10% tire with above-mentioned
The DMEM fluid nutrient mediums of cow's serum mend the volume of nutrient solution in every hole to 2mL, obtain 6 holes containing nasopharyngeal carcinoma cell liquid
Plate.6 orifice plates for containing nasopharyngeal carcinoma cell liquid are placed in containing 5%CO237 DEG C of incubator in cultivate 12 hours, paste cell
Wall.
The above-mentioned 2 '-OMe-dsRNA21- liposomes of 500 μ L are added into every hole of 6 orifice plates after above-mentioned cell attachment respectively
Compound nutrient solution and 1500 μ L plasma-free DMEM mediums (Opti-MEM) are transfected, and obtain 2 '-OMe-dsRNA21 cells
Nutrient solution.2 '-OMe-dsRNA21 cell culture fluids are placed in containing 5%CO237 DEG C of incubator in cultivate 6 hours after, will cultivate
Base is replaced by 10%FBS-DMEM fluid nutrient mediums, continues to cultivate under normal condition, in incubation every 3 days according to above-mentioned side
Method transfects once, after cultivating 10 days, obtains the nasopharyngeal carcinoma cell handled through 2 '-OMe-dsRNA21.
According to the method described above, 2 '-OMe-dsRNA21 replace with 2 '-OMe-NC, and remaining step is constant, obtains through 2 '-OMe-
The nasopharyngeal carcinoma cell of NC processing.
The nasopharyngeal carcinoma cell handled through 2 '-OMe-dsRNA21 and the nasopharyngeal carcinoma cell handled through 2 '-OMe-NC are used respectively
Cold methanol is fixed, and use violet staining respectively, then with Gel-Pro counters respectively to being handled through 2 '-OMe-dsRNA21
Nasopharyngeal carcinoma cell clones number and the nasopharyngeal carcinoma cell handled through 2 '-OMe-NC clone's number is counted, and calculates nasopharyngeal carcinoma cell and increases
Grow inhibiting rate (nasopharyngeal carcinoma cell proliferation inhibition rate=(nasopharyngeal carcinoma cell clone number -2 '-OMe- of 2 '-OMe-NC processing
DsRNA21 processing nasopharyngeal carcinoma cell clone number)/2 '-OMe-NC processing nasopharyngeal carcinoma cell clone number), as a result such as Fig. 1 institutes
Show.
As a result show, when handling 48h through 2 '-OMe-dsRNA21,2 '-OMe-dsRNA21 are inhibited nasopharyngeal carcinoma cell
27.7% nasopharyngeal carcinoma cell propagation；When handling 72h through 2 '-OMe-dsRNA21,2 '-OMe-dsRNA21 inhibit 33.7%
Nasopharyngeal carcinoma cell propagation；When handling 96h through 2 '-OMe-dsRNA21,2 '-OMe-dsRNA21 inhibit 30.7% nasopharynx
Cancer cell multiplication；When being handled 10 days through 2 '-OMe-dsRNA21, clone's number of nasopharyngeal carcinoma cell is 147 ± 14, through 2 '-
Clone's number of the nasopharyngeal carcinoma cell of OMe-NC processing is 320 ± 13, and 2 '-OMe-dsRNA21 inhibit 54.1% nasopharynx
Cancer cell multiplication.Show to compare with the nasopharyngeal carcinoma cell handled through 2 '-OMe-NC, the nasopharyngeal carcinoma handled through 2 '-OMe-dsRNA21
Clone's number of cell significantly reduces, and illustrates that 2 '-OMe-dsRNA21 can significantly inhibit the propagation of nasopharyngeal carcinoma cell.
The influence of embodiment 3,2 '-OMe-dsRNA21 cell cycles
In triplicate, the method tested every time is as follows for experiment：
Trained with the DMEM fluid nutrient mediums (10%FBS-DMEM fluid nutrient mediums, GIBCO products) containing 10% hyclone
Nasopharyngeal carcinoma cell culture 18 hours is supported, obtains DMEM cell culture fluids.By DMEM cell culture fluids under 4 DEG C 5000 revs/min
Centrifugation, obtains nasopharyngeal carcinoma cell.It is resuspended with the DMEM fluid nutrient mediums containing 10% hyclone for being not added with penicillin and streptomysin
Nasopharyngeal carcinoma cell, blown and beaten uniformly with liquid-transfering gun, obtain nasopharyngeal carcinoma cell FBS-DMEM nutrient solutions.With being not added with penicillin and streptomysin
Containing 10% hyclone DMEM fluid nutrient mediums adjustment nasopharyngeal carcinoma cell nutrient solution in cell concentration, obtaining cell concentration is
2,000,000 cell/mL nasopharyngeal carcinoma cell cell liquid, by cell liquid point kind in 6 orifice plates, per the μ L of hole 100, i.e., per hole
In contain 200,000 nasopharyngeal carcinoma cell, obtain 6 orifice plates containing nasopharyngeal carcinoma cell liquid.
2 '-OMe-dsRNA21 solution in μ L of lipofectamine 2000 (Invitrogen) 5, embodiment 2 are taken respectively
10 μ L, it is diluted in respectively in 250 μ L serum free mediums (Opti-MEM), respectively obtains 2 '-OMe-dsRNA21 free serum cultures
Liquid and the serum-free mediums of lipofectamine 2000, the serum-free mediums of lipofectamine 2000 are incubated at room temperature
Educate 5 minutes, then mix 2 '-OMe-dsRNA21 serum-free mediums with the serum-free mediums of lipofectamine 2000,
Obtain 2 '-OMe-dsRNA21- liposome complex nutrient solutions.By 2 '-OMe-dsRNA21- liposome complex nutrient solutions in room
Temperature stands 20 minutes.By the DMEM nutrient solutions of above-mentioned 2 '-OMe-dsRNA21- liposome complexes nutrient solution and serum-free according to
Volume ratio is 1:2mL is taken after 3 ratio mixing, is added in 6 orifice plates of above-mentioned nasopharyngeal carcinoma cell liquid, obtains 2 '-OMe-dsRNA21
Cell culture fluid.By 2 '-OMe-dsRNA21 cell culture fluids on Tissue Culture Plate in 5%CO2Cultivated in 37 DEG C of incubator
6 hours, 2 '-OMe-dsRNA21 transfectional cell liquid are obtained, by 2 '-OMe-dsRNA21 transfectional cells liquid at 4 DEG C 5000 revs/min
Lower centrifugation, the cell after 2 '-OMe-dsRNA21 transfections is obtained, the cell after 2 '-OMe-dsRNA21 are transfected, which is used, contains 10% tire
Nasopharyngeal carcinoma cell is resuspended in the DMEM culture mediums of cow's serum, is blown and beaten uniformly with liquid-transfering gun, obtains the thin of 2 '-OMe-dsRNA21 transfections
Born of the same parents' nutrient solution, by the cell culture fluid of 2 '-OMe-dsRNA21 transfections in containing 5%CO237 DEG C of incubator in continue culture 48 small
When, obtain 2 '-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM nutrient solutions.
According to the method described above, 2 '-OMe-dsRNA21 being replaced with into 2 '-OMe-NC, other operating procedures are constant, obtain 2 '-
OMe-NC nasopharyngeal carcinoma cell FBS-DMEM nutrient solutions.
After 48 hours, respectively with-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM the nutrient solutions of hydroxycarbamide synchronization process 2 '
Nasopharyngeal carcinoma cell and 2 '-OMe-NC nasopharyngeal carcinoma cell FBS-DMEM nutrient solutions in nasopharyngeal carcinoma cell, make at nasopharyngeal carcinoma cell
In the G1 phases, other operations are according to the Fluorescence kit (Life of Click-iT EdU Alexa Fluor 488
Technologies, C10337) specification progress.
The nasopharynx in 2 '-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM nutrient solutions is observed under laser confocal microscope
Nasopharyngeal carcinoma cell in cancer cell and 2 '-OMe-NC nasopharyngeal carcinoma cell FBS-DMEM nutrient solutions, and quantitatively calculated with imaging software,
As a result it is as shown in Figure 2.
As a result show, the percentage containing Edu cells is in the S phase nasopharyngeal carcinoma cells handled through 2 '-OMe-dsRNA21
21.94 ± 3.08%, through 2 '-OMe-NC handle S phase nasopharyngeal carcinoma cells in the percentage containing Edu cells be 37.5 ±
4.49%, compared with showing the nasopharyngeal carcinoma cell with transfecting 2 '-OMe-NC, transfect the 2 '-OMe-dsRNA21 nasopharyngeal carcinoma cell S phases
Cell containing Edu substantially reduces.
Embodiment 4,2 '-OMe-dsRNA21 are to the inhibitory action of expression of target gene
2 '-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM nutrient solutions and 2 '-OMe-NC nasopharyngeal carcinoma in Example 3
Cell FBS-DMEM nutrient solutions, culture 42 hours after, respectively collect 2 '-OMe-dsRNA21 transfection nasopharyngeal carcinoma cell and 2 '-
OMe-NC transfection nasopharyngeal carcinoma cell, respectively carry out Cyclin dependent kinase 4 (cyclin dependent kinase 4,
CDK4) the detection of expression of gene and cyclinD3 (cyclin D3, CCND3) gene.
In triplicate, the step of repetition experiment is as follows every time for experiment：
Method according to TRIzol extractions RNA extracts the total serum IgE of the nasopharyngeal carcinoma cell of 2 '-OMe-dsRNA21 transfections, obtains
2 '-OMe-dsRNA21 the total serum IgEs containing DNA.Contained with DNase I (RNase-free) (TaKaRa) digestion process at 37 DEG C
There are DNA 2 '-OMe-dsRNA21 total serum IgEs 30 minutes, the DNA in the 2 '-OMe-dsRNA21 total serum IgEs containing DNA of degrading, obtain
2 '-OMe-dsRNA21 the total serum IgEs containing DNA after to DNA degradation.DNA degradation is extracted again according to the DNase I descriptions of product
The RNA in the 2 '-OMe-dsRNA21 total serum IgEs containing DNA afterwards, obtains 2 '-OMe-dsRNA21 total serum IgEs.By the 2 ' of 1 μ g-
OMe-dsRNA21 total serum IgEs mix with 0.5 μ g 50 μM of Oligo dT (16-18) (Takara Products), heat 5 minutes,
0 DEG C is rapidly cooled to obtain.Buffer solution is separately added into by the M-MLV reverse transcriptase systems of TaKaRa companies, and 1 is incubated in 42 DEG C
Hour, obtain 2 '-OMe-dsRNA21 cDNA.
According to the method described above, the 2 '-OMe-dsRNA21 nasopharyngeal carcinoma cells transfected are replaced with to the nose of 2 '-OMe-NC transfections
Pharynx cancer cell, other steps are constant, obtain 2 '-OMe-NC cDNA.
Using 2 '-OMe-dsRNA21cDNA as the template that PCR reacts, to target gene CCND3, (CCND3 primer is：
CCND3F：TACCCGCCATCCATGATCG, CCND3R：AGGCAGTCCACTTCAGTGC) and CDK4 (CDK4 primer is：
CDK4F：CCTACCTTTATATTTGGGGTCCT, CDK4R：GGCCCTGTAATTTAACCAGT semiquantitive PCR detection) is carried out, it is interior
Join that (GAPDH primer is for GAPDH：GAPDHF：GGAGCGAGATCCCTCCAAAAT, GAPDHR：
GGCTGTTGTCATACTTCTCATGG), after the completion of PCR reactions, PCR primer is entered into row agarose gel electrophoresis, as a result such as Fig. 3
Shown in middle A.As a result show, through 2 '-OMe-dsRNA21 and through 2 '-OMe-NC handle nasopharyngeal carcinoma cell in CDK4 genes and
CCND3 genes have expression, the CDK4 genes and CCND3 genes in nasopharyngeal carcinoma cell after 2 '-OMe-dsRNA21 processing
Expression decreases.Compared with transfecting the negative control group of small nucleic acids, it is thin that 2 '-OMe-dsRNA21 of transfection substantially suppress tumour
The CCND3 and CDK4 of born of the same parents expression.
Respectively using above-mentioned 2 '-OMe-dsRNA21cDNA and above-mentioned 2 '-OMe-NC cDNA as template, using GAPDH as internal reference
(GAPDH primer is：GAPDHF：GGAGCGAGATCCCTCCAAAAT, GAPDHR：
GGCTGTTGTCATACTTCTCATGG), CDK4 genes and CCND3 genes are carried out according to Syb kits operation instruction
The real time fluorescent quantitative detection of expression, the primer of CDK4 genes are：CDK4F：CCTACCTTTATATTTGGGGTCCT, CDK4R：
The primer pair of GGCCCTGTAATTTAACCAGT, CCND3 gene is：CCND3F：
TACCCGCCATCCATGATCG, CCND3R：AGGCAGTCCACTTCAGTGC, as a result as shown in B in Fig. 3.As a result
It has been shown that, the expression quantity of CDK4 genes is the nose handled through 2 '-OMe-NC in the nasopharyngeal carcinoma cell handled through 2 '-OMe-dsRNA21
The 74.3% of the expression quantity of CDK4 genes in pharynx cancer cell, through 2 '-OMe-dsRNA21 handle nasopharyngeal carcinoma cell in CCND3 bases
The expression quantity of cause is 60.8% of the expression quantity of CCND3 genes in the nasopharyngeal carcinoma cell handled through 2 '-OMe-NC, show through 2 '-
CDK4 genes in nasopharyngeal carcinoma cell and the expression quantity of CCND3 genes after OMe-dsRNA21 processing decrease.
The preparation of embodiment 5,2 '-OMe-dsRNA21 freeze drying powder injections
1st, with liquid
By 2 '-OMe-dsRNA21 in embodiment 1 with without RNase water for injection dissolve, obtain no RNase 2 '-
OMe-dsRNA21 solution, 2 '-OMe-dsRNA21 content is 2.29 μ g/ μ in the 2 '-OMe-dsRNA21 solution without RNase
L；Waters for injection of the freeze drying protectant mannitol 4.4g without RNase is dissolved, and adjusted with sodium hydroxide solution and hydrochloric acid solution
It is 6-7 to save its pH, and benefit injects water to 100mL, obtains frozen-dried protective agent solution；According to 2 '-OMe-s of the 1mL without RNase
DsRNA21 solution is mixed with the volume ratio of 50mL frozen-dried protective agent solutions, obtains the mixing of 2 '-OMe-dsRNA21 protective agents
Liquid.
2nd, freeze
Pre-freeze：The packing of above-mentioned 2 '-OMe-dsRNA21 protective agents mixed liquor is better than in cillin bottle, it is pre- in -80 DEG C of refrigerators
Freeze overnight.Freeze-drying：2 '-OMe-dsRNA21 protective agent mixed liquors of precooling are vacuumized, then under the conditions of lucifuge
Freeze-drying, obtains 2 '-OMe-dsRNA21 freeze drying powder injections.
According to the method described above, 2 '-OMe-dsRNA21 are replaced with into 2 '-OMe-NC in embodiment 1, other are constant, obtain
To 2 '-OMe-NC freeze drying powder injections.
2 '-OMe-dsRNA21 freeze drying powder injections and 2 '-OMe-NC freeze drying powder injections are sealed, Cord blood.
Embodiment 6,2 '-OMe-dsRNA21 are to the inhibitory action of tumour growth
The male BALB/C nude mices 10 of 4 week old are taken, 0.1mL nasopharynxs are subcutaneously injected in the dorsal part alar part of every nude mice respectively
(nasopharyngeal carcinoma cell content is 3 × 10 to cancer cell suspension in nasopharyngeal carcinoma cell suspension5Individual cell/mL), into knurl after 10 days, it is obtained
10 dorsal part alar parts subcutaneously form the BALB/C nude mices of transplantable tumor.Above-mentioned 10 dorsal part alar parts are subcutaneously formed into transplantable tumor
BALB/C nude mices are randomly divided into two groups, every group 5, respectively NC groups nude mice and dsRNA21 group nude mices.
2 '-OMe-dsRNA21 freeze drying powder injections in 20 μ g embodiments 5 are dissolved with the μ L of sterilized water 11.3 without RNase, and
Transfection reagent jetPEI (Polyplus Products) 1.2 μ L are added, the mixing for obtaining 2 '-OMe-dsRNA21 and jetPEI is molten
Liquid, it is 10% isometric glucose solution of the solution to be added into 2 '-OMe-dsRNA21 and jetPEI mixed solution, is mixed
Close the 2 '-OMe-dsRNA21 injections for uniformly, obtaining that cumulative volume is 25 μ l.According to the method described above, by 2 '-OMe- in embodiment 5
DsRNA21 freeze drying powder injections replace with 2 '-OMe-NC freeze drying powder injections in embodiment 5, and other are constant, obtain cumulative volume and are
25 μ l 2 '-OMe-NC injections.
The above-mentioned μ l of 2 '-OMe-NC injections 25 of the transplanting intratumor injection of every nude mice into NC group nude mices, the injection same day are designated as
The 0th day of experiment, every nude mice injected the once above-mentioned μ l of 2 '-OMe-NC injections 25 containing 20 μ g2 '-OMe-NC every 1 day,
Co-injection 5 times；The above-mentioned μ l of 2 '-OMe-dsRNA21 injections 25 of the transplanting intratumor injection of every nude mice into dsRNA21 group nude mices,
The injection same day is designated as the 0th day of experiment, and every nude mice once above-mentioned contained 20 μ g2 '-OMe-dsRNA21's every injection in 1 day
The μ l of 2 '-OMe-dsRNA21 injections 25, co-injection 5 times.Before per injection injection (test the 0th day, the 2nd day, the 4th day, the 6th
My god, the 8th day) and (the 10th day tested) two days later of the 5th injection to measure NC groups respectively with vernier caliper measurement naked
Mouse and the tumour most major diameter (L) and transverse diameter (S) of dsRNA21 group nude mices, and calculate the approximate volumes of tumour.Calculation formula is：V
(mm3)=0.5 × L × S2.In (the 10th day tested) two days later of every group of nude mice the 5th injection, take out in every group
The tumour of every nude mice, and measure gross tumor volume, weigh tumor weight, photograph to record, as a result as shown in Figure 4.
Experimental result shows, the average weights of NC group nude mouse tumors is 0.043g ± 0.015g, dsRNA21 group nude mouse tumors
Average weight be 0.023g ± 0.0084g.During injection two days, the average external volume of NC group nude mouse tumors is 30.74mm3,
The average external volume of dsRNA21 group nude mouse tumors is 20.53mm3；During injection four days, the average external volume of NC group nude mouse tumors is
37.74mm3, the average external volume of dsRNA21 group nude mouse tumors is 30.41mm3；During injection six days, NC group nude mouse tumors it is flat
Equal volume is 65.20mm3, the average external volume of dsRNA21 group nude mouse tumors is 45.27mm3；During injection eight days, NC group nude mices
The average external volume of tumour is 75.21mm3, the average external volume of dsRNA21 group nude mouse tumors is 51.94mm3；During injection ten days,
The average external volume of NC group nude mouse tumors is 93.97mm3, the average external volume of dsRNA21 group nude mouse tumors is 73.05mm3.As a result table
Bright, compared with NC group nude mices, dsRNA21 group nude mouse tumors weight, the increase of gross tumor volume are substantially small, 2 '-OMe-dsRNA21 pins
Agent substantially inhibits the growth of nude mouse tumor.
Claims (2)
1. application of the trim of double-stranded RNA in tumor inhibitor is prepared, a chain-ordering of the double-stranded RNA is sequence table
Middle SEQ ID No.1, another chain-ordering of the double-stranded RNA is SEQ ID No.2 in sequence table；The tumour is nasopharynx
Cancer；The trim of the double-stranded RNA is that 2 '-OH of all cytidine monophosphates in chain shown in the SEQ ID No.2 of the double-stranded RNA are equal
The trim that chain shown in methoxyl group and SEQ ID No.1 is not modified to obtain is substituted by, is named as 2 '-OMe-
dsRNA21。
2. application according to claim 1, it is characterised in that：The tumor inhibitor is the tumorigenic inhibitor of suppression
And/or suppress the inhibitor of tumour growth.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410383877.3A CN104147616B (en) | 2014-08-06 | 2014-08-06 | The application of double-stranded RNA or its trim in tumor inhibitor is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410383877.3A CN104147616B (en) | 2014-08-06 | 2014-08-06 | The application of double-stranded RNA or its trim in tumor inhibitor is prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104147616A CN104147616A (en) | 2014-11-19 |
| CN104147616B true CN104147616B (en) | 2018-03-02 |
Family
ID=51873375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410383877.3A Active CN104147616B (en) | 2014-08-06 | 2014-08-06 | The application of double-stranded RNA or its trim in tumor inhibitor is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104147616B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104667299A (en) * | 2015-02-28 | 2015-06-03 | 清华大学深圳研究生院 | Application of double-stranded RNA and anti-tumor composition related to double-stranded RNA in preparation of tumor cell inhibitor |
| CN106924757B (en) * | 2015-12-31 | 2020-07-24 | 中国科学院遗传与发育生物学研究所 | Application of miR-449c-5p and mimic thereof in preparation of products for treating and preventing heart valve diseases |
| CN110302388A (en) * | 2019-06-28 | 2019-10-08 | 浙江大学 | A kind of cholesterol modification microRNA is preparing the application in CamK-A inhibitor |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011028550A1 (en) * | 2009-08-24 | 2011-03-10 | Merck Sharp & Dohme Corp. | Segmented micro rna mimetics |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101555519A (en) * | 2008-04-10 | 2009-10-14 | 上海市肿瘤研究所 | Gene chip and application thereof |
| CN102140471B (en) * | 2011-01-10 | 2013-11-20 | 清华大学深圳研究生院 | Oligo-nucleic acid for suppressing tumor growth and application thereof |
-
2014
- 2014-08-06 CN CN201410383877.3A patent/CN104147616B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011028550A1 (en) * | 2009-08-24 | 2011-03-10 | Merck Sharp & Dohme Corp. | Segmented micro rna mimetics |
Non-Patent Citations (1)
| Title |
|---|
| "MiR-188-5p靶向AAC11抑制肝细胞癌生长和侵袭转移的研究";房锋;《中国博士学位论文全文数据库（电子期刊）医药卫生科技辑》;20111215(第12期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104147616A (en) | 2014-11-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2018214137B2 (en) | MiRNA and its diagnostic therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated BRAF pathway | |
| ES2672124T3 (en) | miRNA for the treatment of diseases and conditions associated with neoangiogenesis | |
| CN102575254B (en) | Methods and compositions for the specific inhibition of KRAS by asymmetric double-stranded RNA | |
| ES2631458T3 (en) | MRNA molecule defined by its source and its therapeutic uses in cancer associated with EMT | |
| JP2018507866A (en) | Pharmaceutical composition for cancer treatment comprising microRNA as an active ingredient | |
| JP2010504350A (en) | Genes and pathways regulated by miR-200 as targets for therapeutic intervention | |
| JP2010510964A (en) | MiR-15, miR-26, miR-31, miR-145, miR-147, miR-188, miR-215, miR-216, miR-331, mmu-miR-292 as targets for therapeutic intervention Genes and pathways regulated by 3p | |
| EP2794881B1 (en) | Mirna for treating head and neck cancer | |
| CN104147616B (en) | The application of double-stranded RNA or its trim in tumor inhibitor is prepared | |
| CN105861551A (en) | Vector for jointly expressing MicroRNAs to inhibit breast cancer cell proliferation and construction method and application thereof | |
| CN101353656B (en) | siRNA inhibiting expression of epidermal growth factor receptor genes and use thereof | |
| US10150966B2 (en) | RNA sequence having anti-tumour activity | |
| CN107893115B (en) | ALKBH1 gene and application of expression product thereof in preparation of kit for diagnosing tumors and drugs for treating tumors | |
| Huang et al. | Effects of hTERT antisense oligodeoxynucleotide on cell apoptosis and expression of hTERT and bcl-2 mRNA in keloid fibroblasts. | |
| JP2010504349A (en) | Genes and pathways regulated by miR-143 as targets for therapeutic intervention | |
| CN109966496A (en) | MiRNA-5571 is preparing the application in resistive connection rectal neoplasm drug | |
| CN107164528A (en) | A kind of application of the Noncoding gene related to liver cancer genesis and development | |
| CN113476606A (en) | Application of UPK1A-AS1 inhibitor in preparation of antitumor drugs | |
| CN104667299A (en) | Application of double-stranded RNA and anti-tumor composition related to double-stranded RNA in preparation of tumor cell inhibitor | |
| CN101270358A (en) | MiRNA sequence and uses thereof | |
| CN103667430A (en) | Application and relevant medicament of nucleotide octamer binding protein expression gene | |
| CN116808215A (en) | Application of LINC02159 serving as therapeutic target in preparation of medicines for preventing and treating non-small cell lung cancer | |
| ES2764699T3 (en) | MiRNA molecule defined by its source and its diagnostic and therapeutic uses in diseases or conditions associated with TEM | |
| JP2018183163A (en) | RNA INTERFERENCE AGENTS FOR GST-π GENE MODULATION |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |