ES2764699T3 - MiRNA molecule defined by its source and its diagnostic and therapeutic uses in diseases or conditions associated with TEM - Google Patents

Abstract

MiRNA-520f molecule or mimetic or isomiR thereof, or source thereof, wherein said source of said miRNA molecule or mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% of identity with SEQ ID NO: 1, or composition comprising said miRNA-520f molecule, mimetic or isomiR or source thereof, for use in the treatment, reversal, cure and / or delay of a cancer associated with TEM by inducing a TME process, where said miRNA-520f molecule comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 104 or 105 and / or has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98%, 99% or 100% identity with SEQ ID NO: 19, 118 and / or 119 and has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 , 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 4 0 nucleotides or more.

Description

DESCRIPTION

MiRNA molecule defined by its source and its diagnostic and therapeutic uses in TEM-associated diseases or conditions

Field of the Invention

[0001] The invention relates to the therapeutic uses of a miRNA molecule defined by its source below in a cancer associated with TEM (epithelial-mesenchymal transition). The disclosure relates to the diagnostic and therapeutic uses of a miRNA molecule defined by its source below in TEM-associated diseases and conditions.

Background of the Invention

[0002] Most solid tumors are of epithelial origin (ie carcinomas). Loss of epithelial cell markers (eg, E-cadherin) and gain of mesenchymal cell markers (eg, N-cadherin and vimentin) have been observed in patient tumor samples, including prostate cancer (one). Cancer cells can be de-differentiated through this so-called epithelial-mesenchymal transition (TEM). During TEM, the intercellular cell junctions are broken down, thus giving tumor cells the ability to migrate and invade surrounding tissue or through the walls of blood vessels. Such phenotypic changes are thought to play an important role in the spread of the disease and ultimately lead to disease progression, which is often associated with a poor prognosis for patients (2; 3).

[0003] Loss of expression of E-cadherin is considered a molecular hallmark of TEM. TEM in tumor cells results from transcriptional reprogramming of the cell. In particular, transcriptional repression of the E-cadherin gene promoter (CDH1) has been shown to trigger the TEM phenotype. The E-cadherin protein is one of the most important cadherin molecules for mediating cell-cell contacts in epithelial cells / tissues. CDH1 is repressed by the binding of transcriptional repressors, SNAI1, SNAI2, TCF3, TW iSt, ZEB1, ZEB2 or KLF8 (4-7), to three so-called E boxes in the proximal promoter region of CDH1 (8-10). Inhibition of the binding of these repressors to the CDH1 promoter can reverse TEM, also called mesenchymal-epithelial transition (TME), and inhibit invasion of tumor cells and tumor progression (11).

[0004] Recently, the expression of various microRNAs has been shown to be related to TEM (12). By comparing microRNA expression profiles of cells with an epithelial and mesenchymal phenotype (induced), members of the miR-200 family (miR-141, miR-200a / b / c and miR-429) and miR-205 were identified as miR associated with TEM (13-15). The target genes of miR-200 family TEM-associated microRNAs were shown to be ZEB1 and ZEB2. No microRNAs directed against the other known transcriptional repressors of CDH1 (ie SNAI1, SNAI2, TCF3 and TWIST1) have yet been found. Identifying these microRNAs in an expression profile of cells that have undergone TEM does not necessarily mean that these microRNAs are involved during TEM.

[0005] There are currently no known effective medications that can be used to specifically prevent, treat, reverse, and / or delay a TEM-associated disease or condition in a subject. The only standard treatments include chemotherapy, radiation therapy, surgery. Particularly, the identification of patients who will develop or have already developed metastases and / or the early treatment of patients with tumors that express TEM markers, such as mesenchymal cadherin expression and / or a lower E-cadherin expression, could contribute to better disease-free and overall survival. Therefore, there is still a need for diagnostic markers for TEM and for new treatments for TEM-associated diseases or conditions.

Description of the Invention

[0006] In a first aspect of the invention, there is provided a miRNA-520f molecule or a mimetic or an isomiR thereof, or a source thereof, wherein a source of said miRNA molecule or a mimetic or isomiR of the It comprises at least 80 nucleotides and comprises a motif with at least 98% identity with SEQ ID NO: 1,

or a composition comprising said miRNA-520f, mimetic or isomiR molecule or source thereof, for use in the treatment, reversal, cure and / or delay of a cancer associated with TEM by induction of a process from TME,

wherein said miRNA-520f molecule comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 104 or 105 and / or has at least 80%, 81%, 82%, 83%, 84% , 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 19, 118 and / or 119 and has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides or more. In one aspect of the disclosure, a miRNA molecule or equivalent thereof is provided wherein a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1 or a composition comprising said miRNA molecule or equivalent thereof or said source thereof for use as a medicine for prevention, treatment, reversal, cure and / or or the delay of a TEM-associated disease or condition.

[0007] MicroRNAs (miRNAs) are small 17-25 nucleotide RNAs that function as regulators of gene expression in eukaryotes. MiRNAs are initially expressed in the nucleus as part of long primary transcripts called primary miRNAs (pri-miRNAs). Within the nucleus, pri-miRNAs are partially digested by the enzyme Drosha, to form hairpin precursor miRNAs (pre-miRNAs) 65-120 nucleotides long that are exported to the cytoplasm for further processing by Dicer into mature shorter miRNAs , which are the active molecules. In animals, these short RNAs comprise a proximal 5 '"seed" region (nucleotides 2 to 8) that appears to be the primary determinant of the specificity of pairing of the miRNA with the 3' untranslated region (3'-UTR) of a Target mRNA. A more detailed explanation is given in the part devoted to general definitions.

[0008] Each of the definitions given below about a miRNA molecule, a miRNA equivalent, or a miRNA source must be used for each of the identified miRNAs or miRNA equivalent or miRNA sources in this application: miRNA-124 -1, miRNA-206, miRNA181a-1, miRNA-141, miRNA-200a, miRNA-200b, miRNA-200c, miRNA-429, miRNA-205, miRNA518b, miRNA520f, miRNA524 and sources thereof, including a source comprising at least 80 nucleotides and comprising a motif with at least 98% identity to the motif represented by SEQ ID NO: 1. The mature preferred sequences (as identified in Table 3), seed (as identified in Table 5), isomiR (as identified in Table 6) or source (as identified in Tables 2 (RNA precursor) or 4 (DNA encoding an RNA precursor)) of said miRNA molecule or equivalent thereof are identified, respectively, in the corresponding tables.

[0009] Throughout the text of the application, unless otherwise indicated, a miRNA may also be called a miRNA molecule, a miR or equivalent thereof, or a source or precursor thereof. A preferred equivalent is a mature one, an isomiR, or a mimetic. Each sequence identified here can be identified as SEQ ID NO used in the application text or corresponding to SEQ ID NO in the sequence listing.

[0010] In the context of the invention a miRNA molecule or an equivalent or a mimetic or an isomiR thereof may be a synthetic or natural or recombinant or mature miRNA or a part of a mature miRNA or a human or derived miRNA a human miRNA as defined later in the part devoted to general definitions. A human miRNA molecule is a miRNA molecule found in a human cell, tissue, organ, or body fluid (that is, an endogenous human miRNA molecule). A human miRNA molecule can also be a human miRNA molecule derived from an endogenous human miRNA molecule by substitution, deletion and / or addition of a nucleotide. A miRNA molecule or an equivalent or a mimetic thereof can be a single-stranded or double-stranded RNA molecule.

[0011] In the context of the disclosure, a preferred miRNA molecule or equivalent or a mimetic or isomiR thereof is such that a source of said miRNA molecule or equivalent or mimetic or isomiR thereof comprises or consists of at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1 is further preferably defined as follows.

SEQ ID NO: 1 is as follows:

UCAnGCUGUGnCCCUnnAnAGGGAAGCnCUUUCUnUnGUCnnAAnGAAAAnnA

nGnGCUnCCnUUUnGAGnnUUACnGUUUG

[0012] In the motif represented by SEQ ID NO: 1, n can be any base A, U, C or G.

[0013] In another preferred embodiment, a miRNA molecule or an equivalent or a mimetic or an isomiR thereof is provided such that a source of said miRNA molecule or an equivalent or mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1. More preferably, the identity is at least 99% or 100%. In a preferred embodiment, said source is a precursor of a miRNA-520f molecule or an equivalent or a mimetic or an isomiR thereof. Preferred sources and precursors are defined below here. Therefore, the disclosure refers to a miRNA molecule or an equivalent or a mimetic or an isomiR thereof or a source thereof or a composition comprising said miRNA molecule or an equivalent or a mimetic or isomiR thereof or source thereof, as defined in the following paragraphs, where the miRNA molecule is a miRNA-518b, miRNA-520f and / or miRNA-524 or an equivalent or a mimetic or an isomiR thereof or a source thereof. The preferred miRNA molecule, equivalent, mimetic, and isomiR are defined hereinafter.

[0014] In a preferred embodiment, an equivalent of a miRNA-520f is a molecule of human miRNA. A human miRNA molecule is a miRNA molecule found in a human cell, tissue, or organ. A human miRNA molecule can also be a human miRNA molecule derived from an endogenous human miRNA molecule by substitution, deletion and / or addition of a nucleotide. In this context, a "nucleotide" can mean 1, 2, 3, 4, 5 or more nucleotides. A preferred equivalent of a miRNA-520f is not a mml-mir-519a or mml-mir-520c miRNA molecule as identified hereinafter. A preferred source or precursor of a miRNA520f molecule is not a source or a precursor of a miLl-mir-519a miRNA molecule or a mlI-mir-520c miRNA as identified hereinafter. Preferred neglected mml-mir-519a mature and precursor sequences are identified as SEQ ID NO: 108 and 109. Preferred mml-mir-520c mature and precursor sequences are identified as SEQ ID NO: 110 and 111.

[0015] In a preferred embodiment, a miRNA or equivalent or mimetic or isomiR molecule thereof comprises at least 6 of the 7 nucleotides present in the seed sequence of said miRNA or equivalent or mimetic or isomiR molecule thereof. (Table 5 shows a preferred seed sequence of each of the miRNA molecules identified here). Preferably in this embodiment, a miRNA molecule or an equivalent or a mimetic or isomiR thereof may be 6, 7, 8, 9, 10, 11, 12 to 30 nucleotides in length and more preferably comprises at least 6 of the 7 nucleotides present in the seed sequence of said miRNA molecule or equivalent thereof. Even more preferably, a miRNA molecule or an equivalent or a mimetic or isomiR thereof is 15 to 28 nucleotides in length and more preferably comprises at least 6 of the 7 nucleotides present in the seed sequence. Even more preferably, a miRNA molecule is at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 long, 24, 25, 26, 27, 28, 29, 30 nucleotides or more and preferably comprises at least 6 of the 7 nucleotides present in the seed sequence. In each of these embodiments, a mirRNA or equivalent molecule or a mimetic or isomiR thereof may comprise the 7 nucleotides of the seed sequence as identified in Table 5. Even more preferably, a miRNA molecule has a length of at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30 nucleotides or more and comprises the 7 nucleotides present in the seed sequence as identified in Table 5.

[0016] Accordingly, a preferred or equivalent miRNA-520f or mimetic or isomiR molecule thereof comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 104 or 105 and more preferably is of a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30 nucleotides or more.

[0017] Accordingly, a preferred or equivalent miRNA-518b molecule or mimetic or isomiR thereof according to the disclosure comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 103 and more preferably has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more.

[0018] Accordingly, a preferred or equivalent miRNA-524 molecule or mimetic or isomiR thereof according to the disclosure comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 106 or 107 and more preferably has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more.

[0019] In another preferred embodiment, a miRNA molecule or an equivalent or mimetic or isomiR thereof comprises at least 6 of the 7 nucleotides present in a given seed sequence relative to miRNA-520f as identified in the table 5 as SEQ ID NO: 87-107 and has at least 80% identity with the full mature sequence (Table 3 shows preferred mature sequences of each of the miRNAs identified here). Preferably the identity is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% , 94%, 95% or higher, such as 96%, 97%, 98%, 99% or 100%.

[0020] Alternatively, preferably in this embodiment, a miRNA molecule or an equivalent or a mimetic or an isomiR thereof has a length of not more than 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38 , 39, 40 nucleotides, comprises at least 6 of the 7 nucleotides present in a given seed sequence relative to miRNA-520f as identified in Table 5 as SEQ ID NO: 87-107 and has at least 80% identity with the complete mature sequence according to It is identified in Table 3 as SEQ ID NO: 2-21. Preferably the identity is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, 99% or 100%.

[0021] In another preferred embodiment, an isomiR of a miRNA molecule has at least 80% identity with the entire isomiR sequence (Table 6 shows preferred isomiRs of each of the mature miRNAs identified as SEQ ID NO : 118-162). Preferably the identity is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% , 94%, 95% or higher, such as 96%, 97%, 98%, 99% or 100%. Preferably in this embodiment, an isomiR of a miRNA molecule or an equivalent or a mimetic thereof has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more.

[0022] Identity can be evaluated using various pathways as defined hereinafter. However, in a preferred embodiment, identity means percent identity and is calculated by the number of equal nucleotides between the subject sequence and the test sequence, divided by the total length of the test sequence and multiplied by 100.

[0023] Accordingly, a preferred or equivalent miRNA-520f molecule or mimetic or isomiR thereof comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 104 or 105 and / or has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 945, 95%, 96% , 97%, 98%, 99% or 100% identity with SEQ ID NO: 19, 118, 119 and / or 120 and / or has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides or more.

[0024] Accordingly, a preferred or equivalent miRNA-518b molecule or mimetic or isomiR thereof according to the disclosure comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 103 and / or has the minus 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 945, 95%, 96 %, 97%, 98%, 99% or 100% identity with SEQ ID NO: 18, 121,122 and / or 123 and / or has a length of at least 6, 7, 8, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37 , 38, 39, 40 nucleotides or more. Accordingly, a preferred or equivalent miRNA-524 molecule or mimetic or isomiR thereof according to the disclosure comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 106 or 107 and / or has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 945, 95%, 96% , 97%, 98%, 99% or 100% identity with SEQ ID NO: 20, 21, 124, 125, 126, 127 and / or 128 and / or has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides or more.

[0025] Another preferred or equivalent miRNA molecule or mimetic or an isomiR thereof has at least 80% identity with a miRNA-520f related seed sequence (as identified in Table 5) or with a related mature sequence with miRNA-520f (as identified in Table 3) or with a precursor sequence related to miRNA-520f (as identified in Table 2) or with DNA encoding a precursor of RNA related to miRNA-520f (as identified in Table 4) or with an isomiR sequence related to miRNA-520f (as identified in Table 6). The identity can be at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100%. Identity is preferably evaluated throughout SEQ ID NO as identified in a given table. However, identity can also be evaluated in part of a given SEQ ID NO. Part can mean at least 50% of the length of SEQ ID NO, at least 60%, at least 70%, at least 80%, at least 90% or 100%.

[0026] An equivalent can be an isomiR or a mimetic. A precursor sequence may result in more than one isomiR sequence depending on the maturation process (see, for example, miRNA-520f or miRNA-518b or miRNA-524 where, in certain tissues, multiple isomiRs have been identified (Table 6: SEQ ID NO: 118-128) A mimetic is a molecule that has an activity similar or identical to a miRNA molecule In this context, a similar activity is given the same meaning as an acceptable level of activity.

[0027] Each of the miRNA or equivalent or mimetic or isomiR molecules thereof as identified herein has an acceptable level of activity for a given miRNA from which they are derived. An acceptable level of an activity preferably means that said miRNA or equivalents or mimetics or isomiR thereof is still capable of displaying an acceptable level of said activity of said miRNA. An activity of a given miRNA or an equivalent thereof is, for example, the ability to induce a detectable TME as defined herein below. An acceptable level of an activity is preferably at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the activity of the miRNA from which they are derived. Such activity can be as measured in an individual's bladder cell or in vitro in a cell compared to the activity of the miRNA from which they are derived. Activity evaluation can be performed at the mRNA level, preferably using an RT-qPCR. Activity evaluation can be performed at the protein level, preferably using an analysis Western blotting, immunohistochemistry or immunofluorescence analysis of cross sections.

[0028] Activity evaluation can be performed using cells expressing a firefly luciferase construct driven by a CDH1 promoter and measuring luciferase activity.

[0029] A preferred activity of any of the miRNA molecules or equivalent thereof as identified herein (ie, miRNA-124-1, miRNA-206, miRNA181a-1, miRNA-141, miRNA-200a, miRNA-200b, miRNA-200c, miRNA-429, miRNA-205, miRNA-518b, miRNA-520f, miRNA-524) or a preferred activity of a miRNA molecule or equivalent thereof identified by a preferred source (i.e. , a miRNA molecule or an equivalent thereof where a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO. : 1) is to induce a detectable TME in a subject as defined hereinafter.

[0030] A source of a miRNA molecule or a source of an equivalent of a miRNA molecule, mimetic, isomiR can be any molecule that is capable of inducing the production of a miRNA molecule or an equivalent thereof such as a mimetic or isomiR as identified herein and comprising a hairpin-like structure and / or a double-stranded nucleic acid molecule. The presence of a hairpin-like structure can be evaluated using the RNAshapes program (Steffen P. et al, (2006), Bioinformatics, 22: 500-503) using sliding windows of 80, 100 and 120 nt or more. The presence of a hairpin-like structure is normally present in a natural or endogenous source of a miRNA molecule, while a double-stranded nucleic acid molecule is normally present in a synthetic or recombinant source of a miRNA molecule or an equivalent of the same.

[0031] A source of a miRNA molecule or its equivalent or a mimetic or an isomiR thereof may be a single-stranded RNA, a double-stranded RNA or a partially double-stranded RNA, an example of which is described in WO2008 / 10558. As used herein, "partially double-stranded" refers to double-stranded structures that also comprise single-stranded structures at the 5 'and / or 3' end. It can occur when each strand of a miRNA molecule is not the same length. In general, such a partial double-stranded miRNA molecule may have less than 75% double-stranded structure and more than 25% single-stranded structure, or less than 50% double-stranded structure and more than 50% single-stranded structure, or more preferably less than 25%, 20% or 15% of double-stranded structure and more than 75%, 80%, 85% of single-stranded structure. Alternatively, a source of a miRNA molecule or an equivalent or a mimetic or an isomiR thereof is a DNA molecule encoding a precursor of a miRNA molecule or an equivalent or a mimetic or an isomiR thereof. Preferred DNA molecules in this context are identified in Table 4 in relation to miRNA-520f. The invention encompasses the use of a DNA molecule encoding a precursor of a miRNA molecule that has at least 80% identity with said sequence as identified in Table 4. Preferably, the identity is at least 80% , 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98%, 99% or 100%. Preferably in this embodiment, a DNA molecule is at least 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 long nucleotides or more and have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89% 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, 99% or 100% identity with a DNA sequence as identified in Table 4 in relation to miRNA-520f. Accordingly, a preferred source of a miRNA-520f molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with SEQ ID NO: 45 and / or has a length of at least 50, 55 , 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 nucleotides or more.

[0032] Accordingly, a preferred source of a miRNA-518b molecule according to the disclosure has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with SEQ ID NO: 44 and / or has a length of at least 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 nucleotides or more.

[0033] Accordingly, a preferred source of a miRNA-524 molecule according to the disclosure has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with SEQ ID NO: 46 and / or has a length of at least 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 nucleotides or more.

[0034] Induction of the production of a given miRNA molecule or an equivalent thereof or a mimetic or an isomiR thereof is preferably obtained when said source is introduced into a cell using an assay as defined then. The cells encompassed by the present invention are defined below.

[0035] A preferred source of a miRNA molecule or an equivalent thereof or a mimetic or an isomiR thereof is a precursor thereof, more preferably a nucleic acid encoding said miRNA molecule or an equivalent of the same or a mimetic or an isomiR thereof. A preferred precursor is a naturally occurring precursor. A precursor can be a synthetic or recombinant precursor.

[0036] A preferred precursor of a given miRNA molecule is identified in Table 2 as SEQ ID NO: 22-35. The invention encompasses the use of a precursor of a miRNA molecule or an equivalent thereof that has at least 80% identity with said sequence. Preferably the identity is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98%, 99% or 100%. Preferably in this embodiment, an RNA molecule is at least 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 long nucleotides or more and have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence as identified in Table 2 as SEQ ID NO: 22-35.

[0037] Accordingly, a preferred source of a miRNA-520f molecule has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with SEQ ID NO: 33 and / or has a length of at least 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 nucleotides or more.

[0038] Accordingly, a preferred source of a miRNA-518b molecule according to the disclosure has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with SEQ ID NO: 32 and / or has a length of at least 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 nucleotides or more.

[0039] Accordingly, a preferred source of a miRNA-524 molecule according to the disclosure has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of identity with SEQ ID NO: 34 and / or has a length of at least 50, 55, 60, 70, 75, 80, 85, 90, 95, 100, 130, 150, 200, 250, 300, 350, 400 nucleotides or more.

[0040] Preferred sources or precursors have been defined hereinafter. A preferred source includes or comprises an expression construct comprising a nucleic acid, i.e. DNA encoding said precursor of said miRNA, more preferably said expression construct is a viral gene therapy vector selected from gene therapy vectors based on a adenovirus, an adeno-associated virus (AAV), a herpesvirus, a smallpox virus, and a retrovirus. A preferred viral gene therapy vector is an AAV or lentiviral vector. Other preferred vectors are viral oncolytic vectors. Such vectors are further described here below. Alternatively, a source may be a synthetic miRNA molecule or a chemical mimetic as further defined in the part dedicated to general definitions.

[0041] Detection of the presence of a miRNA molecule or an equivalent thereof such as a mimetic or an isomiR can be performed using any technique known to the skilled person. Assessment of the level of expression or the presence of a miRNA molecule or an equivalent thereof is preferably performed using traditional molecular biology techniques such as qPCR (real-time), microarrays, bead matrices, ribonuclease protection assay or Northern assay or cloning and sequencing. The skilled person will understand that, alternatively or in combination with the quantification of a miRNA molecule or an equivalent thereof, the quantification of a substrate of a corresponding miRNA molecule or of an equivalent thereof or any compound known to be associated with a function of said miRNA molecule or said equivalent thereof or the quantification of a function or activity of said miRNA molecule or said equivalent thereof using a specific assay is encompassed within the scope of the invention.

[0042] Preferred compositions and formulations are all defined hereinafter. A miRNA molecule or an equivalent thereof or a mimetic or an isomiR thereof can be used as such as a naked molecule, with or without chemical modifications, or encapsulated in a particle or conjugated to a fraction. A preferred composition comprises a miRNA molecule or an equivalent thereof or a mimetic or an isomiR thereof encapsulated in a nanoparticle or liposomal structure. A miRNA molecule or equivalent thereof or a mimetic or an isomiR thereof may be an aptamer-miRNA hybrid. A miRNA molecule or equivalent thereof can be an aptamer-miRNA hybrid. An aptamer-miRNA is defined as a miRNA bound to an RNA (or DNA) oligonucleotide, where the latter takes a conformation that directs the aptamer-miRNA hybrid molecule to a cell surface protein (eg, membrane antigen Prostate Specific (PSMA)). The aptamer-labeled miRNA can bind to, for example, polyethylene glycol, which increases the circulating half-life of the chimera (Dassie, JP et al. Nat. Biotechnol. 27: 839-849 (2009)).

[0043] In the disclosure, a molecule as defined herein can be prevented, delayed, cured and / or treated with any molecule or condition where TEM is involved or associated. In the invention, any cancer where TEM is involved or associated can be prevented, delayed, cured, and / or treated with a molecule as defined herein.

[0044] In the context of the invention, the epithelial-mesenchymal transition (TEM) is an orchestrated series of events where cell-cell and cell-extracellular matrix (MEC) interactions are modified to allow the release of epithelial cells from the surrounding tissue . The cytoskeleton of the epithelial cell is rearranged to confer the cell's ability to move through a three-dimensional MEC by molecular reprogramming of the cell. Molecular reprogramming of an epithelial cell is necessary to achieve a mesenchymal phenotype and involves down-regulation or reduction of expression of epithelial proteins, such as E-cadherin and binding proteins such as desmoplakine, claudin, and occluder. Furthermore, the expression of mesenchymal proteins is up-regulated or up-regulated, including, for example, the expression of MEC proteins such as MMPs and fibronectin and cell surface proteins such as N-cadherin and avpo integrin. Transcription factors such as, for example, SNAI1 (also known as SNAIL), TWIST, ZEB1 (also known as 6EF1) and ZEB2 (also known as SIP1) may also be upregulated or upregulated in cells that exhibit a mesenchymal phenotype. . Reference to induction of the "transition" from an epithelial cell to a cell exhibiting a mesenchymal phenotype should be understood as a reference to the induction of genetic, morphological and / or functional changes required to change an epithelial cell to a cell. that exhibits a mesenchymal phenotype of the type defined here. The reference to induction of the mesenchymal-epithelial transition should be understood with the inverse meaning.

[0045] As part of the disclosure, in a disease or condition of the invention, TEM may be detectable before the onset of the disease or condition, ie, before the onset of a symptom of said disease or condition. The present invention further encompasses that TEM is detectable during the development of said disease or condition, that is, after the onset of a symptom of said disease or condition, where the disease or condition is a cancer associated with TEM. Furthermore, it also encompasses that TEM is detectable before the onset of cancer and during the development of said cancer. In a cancer of the invention, TEM can be detectable before the onset of the cancer, that is, before the appearance of a symptom of said cancer. The present invention further encompasses that TEM is detectable during the development of said cancer, that is, after the appearance of a symptom of said cancer. Furthermore, it also encompasses that TEM is detectable before the onset of cancer and during the development of said cancer.

[0046] TEM can be detected using any technique known to the skilled person. Preferably, TEM is evaluated by detecting a decrease in epithelial E-cadherin expression and / or an increase in mesenchymal vimentin and / or mesenchymal cadherin expression using immunohistochemistry using specific antibodies directed against E-cadherin and / or mesenchymal vimentin. and / or mesenchymal cadherin respectively (2, 3). N-cadherin (CDH2) and OB-cadherin (CDH11) are two examples of mesenchymal cadherins. Expression evaluation is preferably performed in a biopsy or tumor section at various time points for a given subject or at one or more time points for a given subject and a healthy control. The evaluation can be done every week, every month. Therefore, the increase / decrease can be evaluated every week, month. Preferably, a reduction in epithelial E-cadherin expression means a significant reduction, preferably a reduction of at least 5% of expression using immunohistochemistry. More preferably, a reduction means a reduction of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90% or 100%. In this case, no expression is detectable. A 25-fold increase in E-cadherin was obtained using a miRNA-520f molecule as identified herein (a representative example is shown in Example 2, Figure 4B). The effect of this miRNA molecule on this marker is quantitatively more pronounced (at least 1.5-fold) than the corresponding effect of the family 200 miRNA molecule that was previously known to have an effect on E-cadherin as shown in Example 2, Figure 4B. Therefore, we can anticipate that a miRNA-520f molecule as identified herein can be considered an attractive molecule for use as identified herein.

[0047] Preferably, an increase in the expression of mesenchymal vimentin and / or mesenchymal cadherin means a significant increase, preferably an increase of at least 5% of expression using immunohistochemistry. More preferably, an increase means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 100%, or at least 150% or more.

[0048] As part of the disclosure, a disease or condition where TEM is involved or associated is preferably a disease or condition where a dedifferentiation process occurs. As part of the invention, a cancer where TEM is involved or associated is preferably a cancer where a dedifferentiation process occurs. In this dedifferentiation process, a reduction in the expression of epithelial E-cadherin and / or an increase in the expression of mesenchymal vimentin and / or mesenchymal cadherin occurs preferably and can be evaluated as explained here. As an example, TEM can be shown by cancer cells that undergo this process and thus become metastatic due to their ability to separate from neighboring cells and penetrate into and through surrounding tissues. Therefore, a preferred disease of the invention is cancer (eg, malignant, metastatic) and a further disease of the disclosure is fibrosis. Cancers of a preferred embodiment of the invention include cancer of epithelial origin or carcinoma or solid tumor. Cancer cells can be from the bladder, brain, breast, colon, esophagus, gastrointestinal, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. Furthermore, cancer may be specifically of the following histological types, but is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; Giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; basal cell carcinoma; Pilomatrix carcinoma; transitional cell carcinoma; transitional cell papillary carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; hepatocellular carcinoma and combined cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; adenocarcinoma, familial polyposis of the colon; solid carcinoma; malignant, carcinoid tumor; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobic carcinoma; acidophilic carcinoma; oxyphilic adenocarcinoma; basophilic carcinoma; clear cell adenocarcinoma; granule cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; non-encapsulated sclerosing carcinoma; cortical adrenal carcinoma; F; carcinoma of the skin annexes; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; Papillary cystadenocarcinoma; Papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease of the breast; acinar cell carcinoma; adeno-squamous carcinoma; adenocarcinoma with squamous metaplasia; malignant ovarian stromal tumor; androblastoma, malignant; Sertoli cell carcinoma. The TEM-associated disease or condition is cancer, preferably bladder or prostate cancer. TEM does not occur in all cancers. In soft tissue sarcomas and leukemias, the TEM dedifferentiation process does not occur. Therefore, in a preferred embodiment, a cancer as identified herein is a carcinoma and / or is not a leukemia and / or is not a tissue sarcoma.

[0049] TEM according to the disclosure can also occur during chronic inflammation or conditions that promote prolonged tissue breakdown that can stimulate fibrosis, thus compromising tissue integrity and organ function. Fibrosis is also known as organ fibrosis or organ degeneration (reviewed in Thierry J.P. et al, 2009, Cell, 139: 871-890). In fibrotic tissues, myofibroblasts accumulate and secrete an excessive amount of collagen that is deposited as fibers, thus compromising organ function and leading to its failure. Fibrosis originates from the conversion of a significant portion of epithelial cells into myofibroblasts through a TEM process (Iwano et al., 2002 J. Clin. Invest. 110: 341-50). Initially demonstrated in differentiated tubule and renal duct cells, it is now clear that lens epithelium, endothelium, hepatocytes, and cardiomyocytes can all undergo TEM and contribute significantly to tissue fibrosis. Each fibrosis where TEM is suspected or suspected to occur is covered within the scope of the disclosure.

[0050] A TEM-associated condition or disease according to the disclosure may also be poor wound healing, diabetic kidney nephropathy, allograft dysfunction, cataracts, or defects in heart valve formation.

[0051] There are currently no known effective medications that can be used specifically to prevent, treat, reverse, cure and / or delay a TEM associated cancer in a subject. The invention encompasses the use of a miRNA molecule or an equivalent thereof where a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity with the motif depicted by SEQ ID NO: 1 or a composition comprising said miRNA molecule or equivalent thereof or a source thereof for this purpose. Preferred or equivalent miRNA molecules or mimetic or isomiR or sources thereof have already been defined herein.

[0052] This use includes pharmacologically increasing an activity or steady state level of said miRNA molecule or equivalent thereof or said source thereof in a subject, in a cell of said subject, in a tissue of said subject or in a body fluid of said subject.

[0053] In this use, an activity or steady state level of said miRNA, or equivalent thereof or source thereof, is increased to induce a detectable TME in a subject. A TME, mesenchymal-epithelial transition, is the opposite of a TEM. Therefore, induction of TME is identical to reversal of TEM. Preferably, a TME is evaluated by detecting an increase in epithelial E-cadherin expression and / or a decrease in mesenchymal vimentin expression using immunohistochemistry using a specific antibody directed against E-cadherin, respectively mesenchymal vimentin and / or mesenchymal cadherin ( 2. 3). Expression evaluation is preferably performed in a biopsy or tumor section at various time points for a subject given or at one or more time points for a given subject and a healthy control. Assessment can be done at regular time intervals, for example, every week, every month. Therefore, the increase / decrease can be evaluated regularly, for example, every week, every month. A TME has preferably been detected when an increase in epithelial E-cadherin expression and / or a reduction in mesenchymal vimentin and / or mesenchymal cadherin expression has been detected for at least one time point. Preferably, a TME has been detected when such an increase in epithelial E-cadherin expression and / or reduced mesenchymal vimentin and / or mesenchymal cadherin expression has been detected for at least two, three, four, five time points. Preferably, an increase in epithelial E-cadherin expression means a significant increase, preferably an increase of at least 5% of expression using immunohistochemistry. More preferably, an increase means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more.

[0054] Preferably, a reduction in the expression of mesenchymal vimentin and / or mesenchymal cadherin means a significant reduction, preferably a reduction of at least 5% of expression using immunohistochemistry. More preferably, a reduction means a reduction of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90% or 100%. In this case, no expression is detectable.

[0055] An activity or steady state level of said miRNA molecule or an equivalent or a mimetic or an isomiR thereof, wherein a source of said miRNA molecule or an equivalent or mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity with the motif represented by SEQ ID NO: 1, it can be increased in the level of the miRNA molecule (or equivalent or mimetic or isomiR thereof), for example , providing said miRNA or equivalent molecule or mimetic or isomiR thereof to a subject, preferably to a cell of a subject, or to a tissue of said subject, or to an organ of said subject or to said subject where said miRNA molecule or equivalent or mimetic or isomiR thereof comes from an exogenous source. For the provision of a miRNA or equivalent or mimetic or isomiR molecule thereof from an exogenous source, said miRNA or equivalent or mimetic or isomiR molecule thereof may conveniently be produced by expression of a nucleic acid encoding said molecule. of miRNA or equivalent or mimetic or isomiR thereof or encoding a source of said miRNA or equivalent or mimetic or isomiR thereof in a suitable host cell as described below or as fully synthetic molecules by chemical synthesis.

[0056] Preferably, however, an activity or steady state level of a miRNA or equivalent molecule or a mimetic or an isomiR thereof is increased by regulating the level of expression of a nucleotide sequence encoding said miRNA molecule or equivalent or mimetic or isomiR thereof or encoding a source of said miRNA molecule or equivalent or mimetic or isomiR thereof. Preferably, the level of expression of a nucleotide sequence is regulated in a cell of said subject or in a tissue of said subject or in the subject. The level of expression of a miRNA or equivalent or mimetic or isomiR molecule thereof or a source of said miRNA or equivalent or mimetic or isomiR molecule thereof can be increased by introduction of a miRNA, or equivalent or mimetic molecule. or isomer thereof, or a source thereof, or an expression construct (or vector) in a cell, tissue, organ, or body fluid of said subject, or in the subject by which an expression vector comprises a sequence of nucleotides comprising a miRNA or equivalent molecule or a mimetic or an isomiR thereof or comprising a source of said miRNA or equivalent molecule or a mimetic or an isomiR thereof, and by which a nucleotide sequence is under the control of a promoter capable of directing the expression of a nucleotide sequence in said cell, tissue, organ, subject. The level of expression of a miRNA or equivalent molecule or a mimetic or an isomiR thereof or source thereof can also be increased by introducing an expression construct into a cell, tissue, organ, subject, by which a Construction comprises a nucleotide sequence encoding a factor capable of transactivation of an endogenous nucleotide sequence encoding a miRNA or equivalent molecule or mimetic or isomiR thereof.

[0057] A use of the invention preferably comprises the step of administering to a subject a therapeutically effective amount of a pharmaceutical composition comprising a nucleic acid construct to enhance the activity or steady state level of a miRNA molecule or a equivalent or a mimetic or an isomiR thereof where a source of said miRNA molecule or equivalent or a mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity with the motif represented by the SEQ ID NO: 1 or a source thereof as identified herein. A nucleic acid construct can be an expression construct as further specified herein. Preferably, an expression construct is a viral gene therapy vector selected from gene therapy vectors based on an adenovirus, an adeno-associated virus (AAV), a herpesvirus, a smallpox virus, an oncolytic virus vector, and a retrovirus. A preferred viral gene therapy vector is an AAV or lentiviral vector. Alternatively, a use of the invention preferably comprises the step of administering to a subject a therapeutically effective amount of a pharmaceutical composition comprising a miRNA molecule or a equivalent or a mimetic or an isomiR thereof where a source of said miRNA molecule or equivalent or a mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity with the motif represented by the SEQ ID NO: 1 or a source thereof as defined here.

[0058] In one use of the invention, a cell, tissue, organ, or body fluid is preferably from a subject suspected of having a high risk of having TEM-associated cancer due, for example, to their age or genetic background or diet. Alternatively, in another preferred embodiment, the use of the invention is applied to a cell, tissue, organ, or body fluid of a subject diagnosed as either having a predictive risk of later developing TEM-associated cancer. A diagnostic method used is preferably one of the descriptions as described herein. Alternatively, a cell, tissue, or organ to be treated can be selected based on the risk of progression of the TEM-associated disease or condition. Such risk of progression can be assessed using traditional clinicopathological criteria or a prognosis based on biomarkers known to the expert. The disclosure also encompasses administering a miRNA molecule or equivalent or a mimetic or isomiR thereof where a source of said miRNA molecule or equivalent or mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity with the motif represented by SEQ ID NO: 1 or a precursor thereof or a composition comprising said miRNA or equivalent molecule or mimetic or isomiR thereof or source thereof in a tissue or organ of said subject. Preferred or equivalent miRNA molecules or mimetic or isomiR or sources thereof have already been defined herein. In the invention, a preferred cell, tissue or organ is a cell, tissue or organ that is or comprises a cell or tissue of the bladder or prostate or is or comprises the bladder or prostate as an organ.

[0059] A treatment of a cancer associated with TEM may include a treatment that avoids TEM in a tumor cell that has not yet metastasized or reverses TEM (defined as mesenchymal-epithelial transition) in a tumor cell that has already metastasized and / or is migrating from the primary tumor to distant sites in the body.

[0060] In another use, the invention mentioned herein can be combined with standard TEM associated cancer treatments such as chemotherapy, radiotherapy or surgery. Examples of chemotherapeutic agents are exemplified hereinafter.

[0061] Although gene therapy is a possibility of preventing, treating, reversing and / or delaying a condition or disease associated with TEM, other possible treatments may also be envisaged. For example, "small molecule" drug treatment is also preferred to direct certain molecular pathways in the desired direction. These small molecules are preferably identified by the screening method of the invention as defined hereinafter.

[0062] In the context of disclosure, preventing, treating, reversing, curing, and / or delaying a TEM-associated disease or condition may mean that:

- at least one symptom of this disease or condition has improved, and / or

- At least one parameter associated with this disease or condition has been improved.

[0063] In the context of the invention, preventing, treating, reversing, curing and / or delaying a TEM-associated cancer can mean that:

- at least one symptom of this cancer has improved, and / or

- At least one parameter associated with this cancer has been improved.

[0064] A symptom may be the presence of metastasis as explained below. One parameter may be the evaluation of the TME as explained hereinabove. In the context of the invention, preventing, treating, reversing, curing and / or delaying a cancer associated with TEM can be replaced by achieving an antitumor effect. Unless otherwise indicated, an antitumor effect is preferably evaluated or detected after at least one week, two weeks, three weeks, four weeks, one month, two months, three months, four months, five months, six months, or more in a treated subject. An antitumor effect is preferably identified in a subject as:

- an inhibition of the proliferation of tumor cells and / or

- an increase in the differentiation capacity of tumor cells and / or

- an induction or increased induction of tumor cell death and / or

- a delay in the appearance of metastasis and / or the migration of tumor cells and / or

- an inhibition or prevention or delay of weight gain or growth of a tumor and / or

- a prolongation of survival of patients of at least one month, several months or more (compared to those not treated or treated with a control or compared to the subject at the start of treatment).

[0065] In the context of the invention, a patient can survive and / or be considered to be disease free. Alternatively, the cancer may have been stopped or delayed. An inhibition of tumor cell proliferation can be at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70% or 75%, or more. Cell proliferation can be evaluated using known techniques.

[0066] An induction of tumor cell death can be at least 1%, 5%, 10%, 15%, 20%, 25%, or more. Tumor growth can be inhibited by at least 5%, 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, or 75%, or more. Tumor cell death can be assessed using techniques known to the skilled person. Tumor cell death can be assessed using MRI (magnetic resonance imaging) or CT (computed tomography).

[0067] In certain embodiments, tumor weight gain or tumor growth can be inhibited by at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, or 75% or more. Tumor weight or tumor growth can be assessed using techniques known to the skilled person.

[0068] Detection of tumor growth or detection of tumor cell proliferation can be evaluated in vivo by measuring changes in glucose utilization by positron emission tomography with the glucose analogue 2- [18F] -fluoro-2 -deoxy-D-glucose (FDG-PET) or [18F] - '3-fluoro-'3-deoxy-L-thymidine PET. An ex vivo alternative may be staining a tumor biopsy with Ki67.

[0069] A delay in the occurrence of metastasis and / or migration of tumor cells can be a delay of at least one week, one month, several months, one year or longer. The presence of metastases can be assessed using MRI, CT, or ultrasound, or techniques that allow the detection of circulating tumor cells (CTC). Examples of the latest tests are the CellSearch CTC (Veridex) test, a magnetic selection of peripheral blood CTC based on the EpCam. In certain embodiments, tumor growth can be delayed by at least a week, a month, two months, or more. In a particular embodiment, an occurrence of metastasis is delayed by at least one week, two weeks, three weeks, four weeks, one month, two months, three months, four months, five months, six months, or more. A miRNA molecule or an equivalent or a mimetic or an isomiR thereof or a source thereof where a source of said miRNA molecule or an equivalent or mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with al minus 98% identity to the motif represented by SEQ ID NO: 1 has been surprisingly found to delay the occurrence of metastasis and / or migration of tumor cells in a more pronounced manner than the corresponding effect of the miRNA molecule of the Family 200 that was already known to have such an effect as shown in Example 2, Figure 6D. Therefore, we can anticipate that a miRNA molecule or a source thereof as identified herein may be considered an attractive molecule for use as identified herein.

[0070] An increase in the differentiation capacity of tumor cells can be evaluated using a specific differentiation marker and by following the presence of such a marker in the treated cells. Preferred markers or parameters have already been identified herein, i.e. markers associated with TME. This can be done using RT-PCR, Western blotting, or immunohistochemistry. An increase in differentiation capacity can be at least a detectable increase after at least one week of treatment using any of the identified techniques. Preferably, the increase is 1%, 5%, 10%, 15%, 20%, 25%, or more, which means that the number of differentiated cells within a given sample will increase accordingly. In certain embodiments, tumor growth can be delayed by at least a week, a month, two months, or more. In a particular embodiment, an occurrence of metastasis is delayed by at least one week, two weeks, three weeks, four weeks, one month, two months, three months, four months, five months, six months, or more.

[0071] In another preferred embodiment, a composition is provided which further comprises another miRNA molecule selected from:

a) at least one of miRNA-124-1, miRNA-206, miRNA-181a-1, miRNA-141, miRNA-200a, miRNA-200b, miRNA-200c, miRNA-429 and miRNA-205 and / or an equivalent or a mimetic or an isomiR or a source thereof.

[0072] Since each of the identified or equivalent miRNA molecules or isomiRs or mimetics thereof is not expected to have the same target genes, the use of one miRNA molecule or an equivalent or an isomiR or a mimetic thereof where a source of said miRNA molecule or equivalent or isomiR or mimetic thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1 optionally combined with at least one of the miRNA molecules, or equivalent or isomiR or mimetic thereof or source thereof identified above under a) allows more effective treatment of a cancer associated with TEM. As part of the disclosure, it allows for more effective treatment of a TEM-associated disease or condition. MiRNA or equivalent molecules or mimetic or isomiR or preferred sources thereof have already been defined herein. A tumor treated by a composition or a cocktail of at least one miRNA molecule or equivalent or an isomiR or a mimetic thereof where a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1, it is expected that they will have less possibilities of escaping or resisting said treatment. In another preferred embodiment of the disclosure, the diagnosis of the expression of each of the miRNA molecules or their target genes as identified herein and based on the result is encompassed to tailor the identity of the miRNA molecules. used for treatment.

[0073] When the invention relates to a composition comprising more than one miRNA or equivalent molecule or isomiR or mimetic thereof or source thereof, it is encompassed that each miRNA molecule or equivalent or isomiR or mimetic thereof or source thereof may each be present in a separate composition, where each composition is administered consecutively or simultaneously to a subject. Alternatively, it is also encompassed that more than one of the miRNA or equivalent molecules or isomiR or mimetics thereof or sources thereof is present in a composition as defined herein.

[0074] In another aspect, there is provided the use of a miRNA or equivalent molecule or an isomiR or a mimetic thereof where a source of said miRNA molecule or equivalent or isomiR or mimetic thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1 or a source thereof or a composition comprising said miRNA molecule, an equivalent or isomiR or mimetic or a source of the same for the production of a medicine to prevent, treat, reverse, cure and / or delay a cancer associated with TEM. In another aspect of the disclosure, the miRNA molecule or an equivalent or an isomiR or a mimetic thereof is for preventing, treating, reversing, curing and / or delaying a TEM associated disease or condition. Each feature of this additional aspect has already been described herein.

[0075] In another aspect of the disclosure, there is provided a method of preventing, preventing, treating, reversing, curing and / or delaying a TEM-associated condition or disease by administering a miRNA or equivalent molecule or isomiR or mimetic thereof or source thereof or composition as defined herein above to a subject in need thereof. Each feature of this additional aspect has already been described herein.

[0076] In another aspect of the disclosure, there is provided a method of diagnosing TEM or a TEM-associated disease or condition in a subject, wherein the method comprises the steps of:

(a) determining the level of expression of a miRNA molecule or equivalent or isomiR or mimetic thereof where a source of said miRNA molecule or equivalent or isomiR or mimetic thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity with the motif represented by SEQ ID NO: 1 or a source thereof in a subject and, optionally,

(b) comparing the level of expression of said molecule or equivalent thereof or source thereof as defined in (a) with a reference value for the level of expression of said molecule, equivalent, isomiR, mimetic or source thereof, where the reference value is preferably the average value for the level of expression of said molecule, equivalent, isomiR, mimetic or source thereof in a healthy subject.

[0077] In the context of this disclosure, diagnostic means either a predictive assessment of a subject's risks of developing a TEM-associated disease or condition or of developing TEM itself. In the context of the invention, a subject can be an animal. Preferably, a subject is a mammal. A preferred mammal is a human. Preferably, a subject is a human being.

Since the expression levels of these nucleotide sequences and / or amounts of the corresponding or equivalent miRNA molecule or isomiR or mimetic thereof or source thereof may be difficult to measure in a subject, it is preferably used a sample of a subject. According to another preferred embodiment, the level of expression (of a nucleotide sequence or miRNA molecule or equivalent or isomiR or mimetic or source thereof) is determined ex vivo in a sample obtained from a subject. The sample preferably comprises a body fluid from a subject. A body fluid may comprise or be derived from blood, serum, plasma, deposition, urine or a tissue biopsy or a tumor biopsy or a cancerous tissue of epithelial origin from a subject. A preferred tissue is bladder or prostate. Specifically, it is contemplated that the disclosure can be used to evaluate or diagnose differences between the stages of the TEM-associated disease or condition, such as between pre-cancer and cancer, or between a primary tumor and a metastatic tumor.

[0079] An increase or decrease in the level of expression of a nucleotide sequence (or steady state level of the encoded or equivalent miRNA molecule or isomiR or mimetic or source thereof) is preferably defined as a detectable change in level of expression of a nucleotide (or steady state level of an encoded miRNA molecule or equivalent or isomiR or mimetic or source thereof or any detectable change in biological activity of a miRNA molecule or equivalent or isomiR or mimetic or source of the same) using a method as defined above compared to the expression level of a corresponding nucleotide sequence (or steady state level of a corresponding or equivalent encoded miRNA molecule or isomiR or mimetic or source thereof) ) in a healthy subject. A preferred nucleotide sequence is a sequence encoding a precursor of a miRNA or equivalent molecule or isomiR or mimetic thereof or a precursor sequence of a miRNA or equivalent molecule or isomiR or mimetic thereof. According to a preferred embodiment, an increase or decrease in miRNA activity is quantified using a specific assay for miRNA activity. A preferred test is the evaluation of TME as defined herein above.

[0080] Preferably, a reduction in the level of expression of a nucleotide sequence means a reduction of at least 5% in the level of expression of the nucleotide sequence using matrices. More preferably, a reduction in the level of expression of a nucleotide sequence means a reduction of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%. , at least 70%, at least 90% or 100%. In this case, there is no detectable expression.

[0081] Preferably, a reduction in the level of expression of a miRNA or equivalent molecule or isomiR or mimetic or source thereof means a reduction of at least 5% in the level of miRNA expression using a qPCR, microarrays or an analysis. Northern transfer. Preferably, the qPCR is a hairpin qPCR RT. More preferably, a reduction in the level of expression of a miRNA or equivalent molecule or isomiR or mimetic or source thereof means a reduction of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90% or 100%. In this case, there is no detectable expression.

[0082] Preferably, a reduction of a miRNA activity means a reduction of at least 5% of a miRNA activity using a suitable assay. More preferably, a reduction in a miRNA activity means a reduction of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least one 70%, at least 90% or 100%. In this case, there is no detectable expression.

[0083] Preferably, an increase in the level of expression of a nucleotide sequence means an increase of at least 5% in the level of expression of the nucleotide sequence using any of the techniques mentioned herein. More preferably, an increase in the level of expression of a nucleotide sequence means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%. , at least 70%, at least 90%, at least 150% or more.

[0084] Preferably, an increase in the level of expression of a miRNA or equivalent molecule or isomiR or mimetic or source thereof means an increase of at least 5% in the expression level of the miRNA or equivalent molecule or isomiR or mimetic or source thereof using an RT-qPCR, preferably a hairpin RT-qPCR. More preferably, an increase in the level of expression of a miRNA or equivalent molecule or isomiR or mimetic or source thereof means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more.

[0085] Preferably, an increase in a miRNA activity means an increase of at least 5% in a miRNA activity using a suitable assay. More preferably, an increase in miRNA activity means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least one 70%, at least 90%, at least 150% or more.

[0086] Preferably, a level of expression is determined ex vivo in a sample obtained from a subject. More preferably, the sample is as defined herein above and where subsequently, a given nucleotide sequence and / or miRNA or equivalent molecule or isomiR or mimetic or source thereof is extracted and purified using methods known to the expert person. More preferably, the sample is or comprises or is derived from a tumor, blood or urine biopsy.

[0087] In a diagnostic method of the disclosure, the expression level of more than one, more preferably at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, is preferably determined, 13, 14, 15 miRNA molecules or equivalent or isomiR or mimetic or source thereof and / or the steady state levels of the corresponding miRNA molecules or equivalent or isomiR or mimetic or source thereof.

[0088] Accordingly, in a preferred method, in step (a) the expression level of another miRNA molecule or equivalent or source thereof selected from:

(a) at least one of miRNA-124-1, miRNA-206, miRNA-181a-1, miRNA-141, miRNA-200a, miRNA-200b, miRNA-200c, miRNA-429 and miRNA-205 and / or a equivalent or a source thereof.

[0089] In another preferred method of the disclosure, TEM or a TEM associated disease or condition is diagnosed when the comparison leads to the discovery of a reduction in the level of expression of said miRNA molecule or an equivalent or a mimetic or a isomiR thereof, where a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1. The molecules of More preferred miRNAs or equivalents or mimetics or isomiRs or sources thereof have all been defined hereinabove.

[0090] In another preferred method of disclosure, TEM or a TEM associated disease or condition is diagnosed when the comparison leads to the discovery of a reduction in the level of expression of the miRNA molecule or an equivalent thereof, where a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1 or a source thereof and a reduction in expression level of at least one of another miRNA selected from:

(a) at least one of miRNA-124-1, miRNA-206, miRNA-181a-1, miRNA-141, miRNA-200a, miRNA-200b, miRNA-200c, miRNA-429 and miRNA-205 and / or a equivalent or a mimetic or an isomiR or a source thereof.

[0091] In another aspect of the disclosure, there is provided a method for identifying a substance or molecule capable of preventing, treating, reversing, curing and / or delaying TEM or a TEM-associated condition or disease in a subject , where the method comprises the steps of:

(a) providing a population of test cells capable of expressing a miRNA molecule or an equivalent or a mimetic or an isomiR thereof, wherein a source of said miRNA molecule or an equivalent or mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1 or source thereof, preferably the test population comprises bladder or prostate cells, and / or the population test cell comprises cancer cells and / or the test cell population comprises mammalian cells, and / or the test cell population comprises human cells;

(b) contacting the test cell population with the substance;

(c) determining the level of expression of said miRNA molecule or equivalent or mimetic or isomiR thereof or source thereof or the activity or steady state level of said miRNA molecule or equivalent or mimetic or isomiR thereof or source thereof in the test cell population that has been contacted with the substance;

(d) comparing the expression, activity, or steady state level determined in (c) with the expression, activity, or steady state level of said miRNA molecule or equivalent or mimetic or isomiR thereof or source of the same in a population of test cells that has not been contacted with the substance; and

(e) identifying a substance that produces a difference in the level of expression, activity or level of stable state of said miRNA molecule or equivalent or mimetic or isomiR thereof or source thereof, among the population of cells of test that the substance has been contacted and the test cell population that has not been contacted with the substance.

[0092] Preferably, in step a), a test cell comprises a nucleic acid construct comprising a source or a precursor of a miRNA molecule or an equivalent or a mimetic or an isomiR thereof where a source or a precursor of said miRNA molecule or equivalent or mimetic or isomiR thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity with the motif represented by SEQ ID NO: 1. The most preferred miRNA molecules or the equivalents or the mimetics or the isomiR or the sources thereof have all been defined hereinabove. More preferably, a test cell comprises a firefly luciferase construct driven by a CDH1 promoter. Preferably, expression, activity or steady state levels are compared in one method. of more than one nucleotide sequence or more than one miRNA molecule, equivalent or mimetic or isomiR or source thereof. Preferably, in one method, a population of test cells comprises mammalian cells, more preferably human cells. Even more preferably, a test cell population comprises cells of the bladder or prostate. A preferred test cell population does not express a miRNA molecule or an equivalent or a mimetic or an isomiR thereof where a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif with at least 98% identity to the motif represented by SEQ ID NO: 1 or source thereof or has reduced expression compared to a normal epithelial homolog expressing CDH1. More preferably, a test cell population comprises a mesenchymal cell with low CDH1 expression, but is capable of expressing CDH1. Alternatively or in addition to the cells mentioned above, in one aspect, the disclosure also relates to a substance that is identified in the aforementioned methods.

General definitions and general technologies referred to herein

[0093] MicroRNA molecules ("miRNAs") are generally 21 to 22 nucleotides in length, although lengths of 17 and up to 25 nucleotides have been reported. Therefore, any length of 17, 18, 19, 20, 21, 22, 23, 24, 25 is encompassed by the present invention. The miRNAs are each processed from a longer precursor RNA molecule ("miRNA precursor"). Precursor miRNAs are transcribed from genes that do not encode proteins. A precursor can be at least 50, 70, 75, 80, 85, 100, 150, 200 nucleotides in length or more. Precursor miRNAs have two regions of complementarity that allow them to form a hairpin or collapsed structure, which is cleaved by enzymes called Dicer and Drosha in animals. Dicer and Drosha are nucleases of the ribonuclease type Ill. The processed miRNA is typically a portion of the stem.

[0094] The processed miRNA (also called "mature miRNA") becomes part of a large complex, known as the RNA-induced silencing complex (RISC), to regulate (down-regulate) a particular target gene. Examples of animal miRNAs include those that perfectly or imperfectly base pair with the mRNA target, resulting in either mRNA degradation or translation inhibition, respectively (Olsen et al, 1999; Seggerson et al , 2002). The siRNA molecules are also processed by Dicer, but from a double-stranded long RNA molecule. SiRNAs are not naturally found in animal cells, but they can function in such cells in an RNA-induced silencing complex (RISC) to direct the sequence-specific cleavage of an mRNA target (Denli et al, 2003).

[0095] The study of endogenous miRNA molecules is described in US patent application 60 / 575,743. A miRNA is apparently active in the cell when the mature single-stranded RNA is linked by a protein complex that regulates the translation of mRNAs that hybridize to the miRNA. The introduction of exogenous RNA molecules that affect cells in the same way as endogenously expressed miRNAs require that a single-stranded RNA molecule of the same sequence as mature endogenous miRNA be taken up by the protein complex that facilitates translational control. A variety of designs of RNA molecules have been evaluated. Three general designs have been identified that maximize the uptake of the desired single-stranded miRNA via the miRNA pathway. An RNA molecule with a miRNA sequence that has at least one of the three designs can be called a synthetic miRNA.

[0096] The miRNA molecules of the invention can replace or complement the gene silencing activity of an endogenous miRNA. An example of such molecules, the characteristics and preferred modifications of such molecules and compositions comprising such molecules is described in WO2009 / 091982.

[0097] The miRNA molecules of the invention or equivalents or sources thereof comprise, in some embodiments, two RNA molecules where an RNA is identical to a naturally occurring mature miRNA. The RNA molecule that is identical to a mature miRNA is called the active chain. The second RNA molecule, called the complementary strand, is at least partially complementary to the active strand. The active and complementary strands hybridize to create a double-stranded RNA, which is similar to the naturally occurring miRNA precursor that is bound by the protein complex immediately prior to miRNA activation in the cell. Maximizing the activity of said miRNA requires maximizing the uptake of the active chain and minimizing the uptake of the complementary chain by the miRNA protein complex that regulates gene expression at the translation level. Molecular designs that provide optimal miRNA activity involve complementary strand modifications.

[0098] Two designs incorporate chemical modifications of the complementary chain.

[0099] The first modification involves the creation of a complementary RNA with a group other than a phosphate or a hydroxyl at its 5 'end. The presence of the 5 'modification apparently eliminates the uptake of the complementary chain and subsequently favors the uptake of the active chain by the miRNA protein complex. The 5 'modification can be any of a variety of molecules including NH2, NHCOCH3, biotin, and others.

[0100] The second chemical modification strategy that significantly reduces the uptake of the complementary strand by the miRNA pathway is the incorporation of nucleotides with sugar modifications in the first 2-6 nucleotides of the complementary strand. It should be noted that sugar modifications according to the second design strategy can be coupled with 5 'terminal modifications according to the first design strategy to further improve miRNA activities.

[0101] The third miRNA design involves the incorporation of nucleotides at the 3 'end of the complementary strand that are not complementary to the active strand.

[0102] The resulting complementary and active RNA hybrids are very stable at the 3 'end of the active chain but relatively unstable at the 5' end of the active chain. Studies with siRNA indicate that 5 'hybrid stability is a key indicator of RNA uptake by the protein complex that supports RNA interference, which is at least related to the miRNA pathway in cells. The inventors have discovered that the judicious use of mismatches in the complementary RNA strand significantly improves the activity of said miRNA.

MiRNA Libraries

[0103] According to the disclosure, a key application for miRNAs as identified herein is the evaluation or diagnosis of the presence of an individual or groups of miRNAs in a sample. Cell populations can then be evaluated with each of the different miRNAs to identify miRNAs whose presence affects a cell phenotype (ie TEM). The number of different miRNAs in the libraries is variable. It is contemplated that there may be, be at least or be at most 1,2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20 or more, or any derivable range included, different miRNA-specific molecules in the library. In specific embodiments, libraries have from 1 to 20 different miRNA-specific molecules or from 5 to 20 different miRNA-specific molecules. "Different" miRNA-specific molecules refers to nucleic acids that specifically encode miRNAs with different sequences.

[0104] MiRNAs are contemplated to be made primarily of RNA, although in some embodiments, they may be RNA, nucleotide analogs, such as blocked nucleic acids (LNA) or unlocked nucleic acids (UNA), DNA, or any combination DNA, RNA, nucleotide analogs and ANP (peptide nucleic acids). Accordingly, the library is understood to contain one or more nucleic acids for these different miRNAs. In specific embodiments, the library is specific for human miRNAs, although libraries for multiple organisms are contemplated.

[0105] An RNA molecule for use in the invention has or comprises or consists of a miRNA region. In specific embodiments, a miRNA molecule or equivalent thereof has a sequence that is derived from any of SEQ ID NOs: 2-21 inclusive related to miRNA-520f (Table 3). It is particularly contemplated that nucleic acid molecules of the invention may be derived from any of the mature miRNA sequences in SEQ ID NOs: 2-21 related to miRNA-520f.

[0106] A miRNA molecule or equivalent thereof will include a sequence that extends at least 1 to 5 nucleotides from the coding sequence upstream and / or downstream of the predicted miRNA sequence. In some embodiments, the molecules have up to 1, 2, 3, 4, 5, 6, 7, or more contiguous nucleotides, or any derivable range included, that flank the sequence encoding the processed miRNA predominant on one or both sides ( 5 'and / or 3' end).

[0107] The libraries of the disclosure can contain miRNA sequences from any organism with miRNA, including specifically, but not limited to, mammals such as humans, non-human primates, rats, and mice. Specifically, libraries are contemplated that have, that have at least or that have at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more different miRNAs (ie, specific miRNA molecules that have different sequences derived from different miRNA genes). Such libraries described in the preceding sentence are specifically contemplated with respect to any of SEQ ID NOs: 2-21, particularly those corresponding to miRNA sequences (mature sequence).

Nucleic acids

[0108] The present invention relates to nucleic acid molecules also called miRNA sources or precursors that can introduce miRNA into cultured cells or a subject. Nucleic acids may have been produced in cells or in vitro by purified enzymes, although they are preferably produced by chemical synthesis. They can be raw or purified. The term "miRNA", unless otherwise indicated, refers to the processed miRNA, after it has been cleaved from its precursor. Table 2 indicates which SEQ ID does NOT correspond to a particular precursor sequence of a miRNA (SEQ ID NO: 22-35 and Table 3 which SEQ ID does NOT correspond to the mature sequence of a miRNA (SEQ ID NO: 2-21. Table 4 identifies the DNA sequences cloned into the lentiviral vector (SEQ ID NO: 36-47, which were used in functional screening as described in the examples. Table 5 identifies the preferred seed sequence (such as SEQ ID NO: 87-107) of each of the Mature miRNAs from Table 3. The name of the miRNA is often abbreviated and referred to without the prefix and will be understood as such, depending on the context. Unless otherwise noted, the miRNAs to which it is made Reference in the application are human sequences identified as mir-X or let-X, where X is a number and / or letter.

[0109] It is understood that a miRNA is derived from genomic sequences or a non-coding gene. In this regard, the term "gene" is used for simplicity to refer to the genomic sequence encoding the miRNA precursor for a given miRNA. However, the embodiments of the invention may involve genomic sequences of a miRNA that are involved in its expression, such as a promoter or other regulatory sequences.

[0110] The term "recombinant" can be used and this generally refers to a molecule that has been manipulated in vitro or that is the replicated or expressed product of such a molecule.

[0111] The term "nucleic acid" is well known in the art. A "nucleic acid" as used herein will generally refer to a molecule (one or more strands) of DNA, RNA, or a derivative or analog thereof, comprising a nucleobase. A nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (eg, an adenine "A", a guanine "G", a thymine "T", or a cytosine "C" ) or in RNA (for example, an A, a G, an uracil "U" or a C). The term "nucleic acid" encompasses the terms "oligonucleotide" and "polynucleotide", each as a subgenus of the term "nucleic acid".

[0112] The term "miRNA" generally refers to a single-stranded molecule, but in specific embodiments, the molecules implemented in the invention will also encompass an additional region or chain that is partially (between 10 and 50% complementary to along the length of the chain), substantially (more than 50% but less than 100% complementary along the length of the chain) or completely complementary to another region of the same single-chain molecule or to another nucleic acid. Thus, nucleic acids can encompass a molecule comprising one or more complementary or self-complementary strand (s) or "complement (s)" of a particular sequence comprising a molecule. For example, a precursor miRNA may have a self-complementary region, which is up to 100% complementary.

[0113] As used herein, "hybridization", "hybridization" or "capable / capable of hybridizing" is understood to mean the formation of a double-stranded or three-stranded molecule or a molecule with a partially double-stranded or three-stranded nature using known techniques by the skilled person such as Southern transfer procedures. The term "mate" as used in this case is synonymous with "hybridize". The term "hybridization", "hybrid (n)" or "capable / capable of hybridizing" may refer to "low", "medium" or "high" hybridization conditions as defined below.

[0114] Low to medium to high stringency conditions means prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 pg / ml denatured, cut salmon sperm DNA, and 25% formamide , 35% or 50% for low to medium to high astringency, respectively. Subsequently, the hybridization reaction is washed three times for 30 minutes each using 2X SSC, 0.2% SDS, and 55 ° C, 65 ° C, or 75 ° C for low to medium to high astringency.

[0115] The nucleic acids or derivatives thereof of the invention will comprise, in some embodiments, the miRNA sequence of any miRNA described in SEQ ID NO: 2-21 or described in SEQ ID NO: 22- 35 or in SEQ ID NO: 36-47. It is contemplated that the nucleic acid sequences of the invention derived from SEQ ID NO: 2-21 may have, have at least, or have at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 , 15, 16, 17, 18, 19, 20, 21, 22, 23, contiguous nucleotides of SEQ ID NOs: 2-21 (or any derivable range included). In other embodiments, the nucleic acids are, are at least, or are at most 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 , 96, 97, 98, 99, 100% identical to the miRNA sequence of SEQ ID NO: 2-21 or the precursor sequence of any of SEQ ID NO: 22-35 or any combination or derivable range included.

Nucleobases

[0116] As used in this case, a "nucleobase" refers to a heterocyclic base, such as, for example, a naturally occurring nucleobase (ie, an A, T, G, C, or U) that is found in at least one naturally occurring nucleic acid (ie, DNA and RNA), and naturally or non-naturally derived derivative (s) and analogs of such a nucleobase. A nucleobase can generally form one or more hydrogen bonds ("pair" or "hybridize") with at least a naturally occurring nucleobase in a way that can substitute for naturally occurring nucleobase pairing (eg, hydrogen bonding between A and T, G and C, and A and U).

[0117] "Purine" and / or "pyrimidine" nucleobase (s) encompass naturally occurring purine and / or pyrimidine nucleobases and also derivative (s) and analog (s) thereof, including, but not limited to a, those with a purine or pyrimidine substituted by one or more alkyl, carboxyalkyl, amino, hydroxyl, halogen (ie, fluoro, chloro, bromo, or iodo), thiol, or alkylthiol moieties. Preferred alkyl moieties (eg, alkyl, carboxyalkyl, etc.) comprise from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Other non-limiting examples of a purine or a pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a xanthine, a hypoxanthine, an 8-bromoguanine, an 8-chloroguanin, a bromothymine, an 8-aminoguanin, an 8-hydroxyguanine, an 8-methylguanine, an 8-thioguanine, an azaguanine, a 2-aminopurine, a 5-ethylcytosine, a 5-methylcytosine, a 5-bromouracil, a 5-ethyluracil, a 5-yodouracil, a 5 -chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a methylthioadenine, an N, N-dimethyladenine, azaadenines, an 8-bromoadenine, an 8-hydroxyadenine, a 6-hydroxy aminopurine, a 6-thiopurine, a 4- (6-aminohexyl / cytosine) and the like. Other examples are known to those skilled in the art.

[0118] A nucleobase can be comprised of either a nucleoside or a nucleotide, using any natural or chemical synthesis method described herein or known to a person skilled in the art. Such a nucleobase can be labeled or it can be part of a molecule that is labeled and contains the nucleobase.

Nucleosides

[0119] As used in this case, a "nucleoside" refers to a single chemical unit comprising a nucleobase covalently attached to a nucleobase connecting moiety. A non-limiting example of a "nucleobase connecting moiety" is a sugar comprising 5 carbon atoms (ie, a "5-carbon sugar"), including, but not limited to, a deoxyribose, a ribose, an arabinose, or a derivative or analog of a 5-carbon sugar. Non-limiting examples of a derivative or analog of a 5-carbon sugar include a 2'-fluoro-2'-deoxyribose or a carbocyclic sugar where one carbon is replaced by an oxygen atom in the sugar ring.

[0120] Different types of covalent bond (s) from a nucleobase to a nucleobase connecting moiety are known in the art. By way of non-limiting example, a nucleoside comprising a purine (i.e., A or G) or a 7-deazapurine nucleobase typically covalently links the 9-position of a purine or a 7-deazapurine to the 1 'position of a sugar 5 carbons. In another non-limiting example, a nucleoside comprising a pyrimidine nucleobase (i.e., C, T, or U) typically covalently links a 1-position of a pyrimidine to a 1-position of a 5-carbon sugar (Kornberg and Baker , 1992).

Nucleotides

[0121] As used herein, a "nucleotide" refers to a nucleoside that further comprises a "backbone fraction". A backbone fraction generally covalently links a nucleotide to another molecule that comprises a nucleotide or to another nucleotide to form a nucleic acid. The naturally occurring nucleotide "backbone fraction" typically comprises a phosphorous fraction, which is covalently attached to a 5-carbon sugar. The binding of the backbone fraction typically occurs at the 3 'or 5' position of the 5-carbon sugar. However, other types of junctions are known in the art, particularly when a nucleotide comprises derivatives or analogs of a naturally occurring fraction of a 5-carbon sugar or phosphorous.

Nucleic Acid Analogs

[0122] A nucleic acid can comprise, or be fully composed of, a nucleobase derivative or analog, a nucleobase connecting moiety and / or a backbone moiety that may be present in a naturally occurring nucleic acid. RNA with nucleic acid analogs can also be labeled according to methods of the invention. As used in this case, a "derivative" refers to a chemically modified or altered form of a naturally occurring molecule, while the terms "mimetic" or "analog" refer to a molecule that may or may not structurally resemble to a molecule or fraction of natural origin, but it has similar functions. As used in this case, a "fraction" generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are well known in the art and have been described (see, eg, Scheit,

[0123] Additional non-limiting examples of nucleosides, nucleotides, or nucleic acids comprising derivatives or analogs of 5-carbon sugars and / or skeleton fractions, include those in: US Patent No. 5,681,947, which describes oligonucleotides comprising purine derivatives that form triple helices with and / or prevent expression of dsDNA; US Patents 5,652,099 and 5,763,167, which describe nucleic acids incorporating fluorescent nucleoside analogs found in DNA or RNA, particularly for use as fluorescent nucleic acid probes; US Patent 5,614,617, which describes oligonucleotide analogues with pyrimidine ring substitutions that possess improved nuclease stability; US Patents 5,670,663, 5,872,232 and 5,859,221, which describe oligonucleotide analogues with modified 5-carbon sugars (ie, modified T-deoxyfuranosyl fractions) used in the detection of nucleic acids; US Patent 5,446,137, which describes oligonucleotides comprising at least a 5-carbon sugar moiety substituted at the 4 'position with a substituent other than hydrogen that can be used in hybridization assays; US Patent 5,886,165, which describes oligonucleotides with both deoxyribonucleotides with 3'-5 'internucleotide linkages and ribonucleotides with 2'-5' internucleotide linkages; US Patent 5,714,606, which describes a modified internucleotide linkage where an oxygen at the 3 'position of the internucleotide linkage is replaced by a carbon to improve nuclease resistance of nucleic acids; US Patent 5,672,697, which describes oligonucleotides containing one or more methylene phosphonate 5'-internucleotide linkages that improve resistance to nucleases; US Patents 5,466,786 and 5,792,847, which describe the binding of a substituent moiety that may comprise a drug or marker at the 2 'carbon of an oligonucleotide to provide improved nuclease stability and the ability to deliver drugs or fractions detection; US patent

5,223,618, which describes oligonucleotide analogs with a 2 'or 3' carbon backbone linkage linking the 4 'position and 3' position of the adjacent 5-carbon sugar moiety to improve cell uptake, resistance to nucleases and hybridization with the target RNA; US Patent 5,470,967, which describes oligonucleotides comprising at least one sulfamate or sulfamide internucleotide linkage that are useful as a nucleic acid hybridization probe; US Patents 5,378,825, 5,777,092, 5,623,070, 5,610,289, and 5,602,240, which describe oligonucleotides with a three or four atom linker moiety by replacing the phosphodiester backbone moiety used to improve nuclease resistance, cell uptake, and regulate RNA expression; US Patent 5,858,988, which describes a hydrophobic carrier agent attached to the 2'-0 position of oligonucleotides to improve their stability and membrane permeability; US Patent 5,214,136, which describes 5 'end anthraquinone conjugated oligonucleotides that possess enhanced hybridization to DNA or RNA; improved stability to nucleases; US Patent 5,700,922, which describes ANP-DNA-ANP chimeras where DNA comprises 2'-deoxy-erythro-pentofuranosyl nucleotides to improve nuclease resistance, binding affinity, and the ability to activate ribonuclease H ; and WO98 / 39352, WO99 / 14226, WO2003 / 95467, WO2003 / 95467 and WO2007 / 085485, which describe modified RNA nucleotides of which the ribose fraction is modified with an extra bridge connecting 2 'oxygen and 4 carbon '. Locked ribose significantly increases specificity and binding affinity; and WO2008 / 147824, which describes modified RNA nucleotides called UNA (unlocked nucleic acid). UNAs are acyl analogs of RNA in which the bond between the C2 'and C3' atoms has been cleaved, lowering the binding affinity for a complementary strand. UNAs are compatible with ribonuclease H recognition and RNA cleavage and enhance siRNA-mediated gene silencing; WO2008 / 036127, which describes morpholino nucleic acid analogs, which contain linkages between both uncharged and cationic subunits; WO / 2007/069092 and EP2075342, which describe zip nucleic acids (ZNA), which contain conjugation spermine derivatives as cationic fractions (Z units) with an oligonucleotide; US Patent 5,708,154, which describes RNA linked to DNA to form a DNA-RNA hybrid; US Patent 5,728,525, which describes the labeling of nucleoside analogues with a universal fluorescent marker.

[0124] Additional instructions for nucleoside analogs and nucleic acid analogs are US Patent 5,728,525, which describes nucleoside analogs that are end-labeled; US patent

5,637,683, 6,251,666 (L-nucleotide substitutions) and 5,480,980 (7-deaza-2'-deoxyguanosine nucleotides and nucleic acid analogues thereof).

[0125] The use of other analogs is specifically contemplated for use in the context of the present invention. Such analogs can be used in the synthetic nucleic acid molecules of the invention, both throughout the molecule and in selected nucleotides. They include, but are not limited to,

1) ribose modifications (such as 2'F, 2 'NH2, 2'N3,4'tio or 2' O-CH3) and

2) phosphate modifications (such as those found in phosphorothioates, methylphosphonates, and phosphoborates).

[0126] Such analogues have been created to confer stability on RNAs by reducing or eliminating their ability to be cleaved by ribonucleases. When these nucleotide analogs are present in RNAs, they can have profoundly positive effects on the stability of RNAs in animals. It is contemplated that the use of nucleotide analogs can be used alone or in conjunction with any of the design modifications of a synthetic miRNA for any nucleic acid of the invention.

Modified nucleotides

[0127] The miRNAs of the invention specifically contemplate the use of nucleotides that are modified to enhance their activities. Such nucleotides include those that are at the 5 'or 3' end of the RNA, as well as those that are internal to the molecule. The modified nucleotides used in the complementary chains of said miRNAs either block 5'OH or phosphate of the RNA or introduce internal modifications of sugar that improve the uptake of the active chain of the miRNA. Modifications for miRNAs include internal sugar modifications that enhance hybridization as well as stabilize molecules in cells and terminal modifications that further stabilize nucleic acids in cells. In addition, modifications that can be detected by microscopy or other methods to identify cells containing synthetic miRNAs are contemplated.

Nucleic Acid Preparation

[0128] A nucleic acid can be prepared by any technique known to a person skilled in the art, such as, for example, chemical synthesis, enzyme production or biological production. Although miRNAs according to the invention could be produced using recombinant methods, it is preferred to produce miRNAs by chemical synthesis or enzymatic production. MiRNAs can be produced by a number of methods, including methods involving recombinant DNA technology.

[0129] Nucleic acid synthesis is performed according to standard methods. See, for example, Itakura and Riggs (1980). Additionally, US Patent 4,704,362, US Patent 5,221,619, and US Patent 5,583,013 each describe various methods of preparing nucleic acids. Non-limiting examples of a nucleic acid (eg, an oligonucleotide) include a nucleic acid made by chemically in vitro synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques as described in EP 266,032, or via of deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986 and US Patent Serial No. 5,705,629. In the methods of the present invention, one or more oligonucleotides can be used. Several different mechanisms of oligonucleotide synthesis have been described, for example, in US Patents 4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244.

[0130] A non-limiting example of an enzymatically produced nucleic acid includes one produced by enzymes in amplification reactions such as PCR (™) (see eg patent

[0131] from US 4,683,202 and US Patent 4,682,195) or the synthesis of an oligonucleotide described in US Patent No. 5,645,897.

[0132] Oligonucleotide synthesis is well known to those skilled in the art. Several different oligonucleotide synthesis mechanisms have been described, for example, in US Pat.

4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744, 5,574,146, 5,602,244.

[0133] Basically, chemical synthesis can be achieved by the diester method, the triester method, the polynucleotide phosphorylase method, and by solid phase chemistry. These methods are discussed in more detail below.

Diester method

[0134] The diester method was the first to be developed in a usable state, mainly by Khorana and coworkers (Khorana, 1979). The basic step is the union of two suitably protected deoxynucleotides to form a dideoxynucleotide with a phosphodiester bond. The diester method is well established and has been used to synthesize DNA molecules (Khorana, 1979).

Tryster method

[0135] The main difference between the diester and triester methods is the presence in the latter of an extra protecting group on the phosphate atoms of the reagents and products (Itakura et al., 1975). The phosphate protecting group is normally a chlorophenyl group, which makes nucleotides and polynucleotide intermediates soluble in organic solvents. Therefore, the purifications are made in chloroform solutions. Other method improvements include (i) block coupling of larger trimers and oligomers, (ii) the extensive use of high-performance liquid phase chromatography for purification of both intermediates and end products, and (iii) synthesis in solid phase.

Polynucleotide phosphorylase method

[0136] This is an enzymatic method of DNA synthesis that can be used to synthesize many useful oligonucleotides (Gillam et al., 1978; Gillam et al, 1979). Under controlled conditions, the polynucleotide phosphorylase predominantly adds a single nucleotide to a short oligonucleotide.

[0137] Chromatographic purification allows the desired single adduct to be obtained. At least one trimer is required to start the procedure, and this primer must be obtained by some other method. The polynucleotide phosphorylase method works and has the advantage that the procedures involved are familiar to most biochemists.

Solid phase methods

[0138] Based on the technology developed for solid phase synthesis of polypeptides, it has been possible to unite the initial nucleotide with solid support material and proceed with the gradual addition of nucleotides. All mixing and washing steps are simplified, and the procedure becomes susceptible to automation. These syntheses are now routinely performed using automated nucleic acid synthesizers.

[0139] Phosphoramidite chemistry (Beaucage and Lyer, 1992) has become by far the most widely used coupling chemistry for oligonucleotide synthesis. As is well known to those skilled in the art, phosphoramidite synthesis of oligonucleotides involves activation of nucleoside phosphoramidite monomeric precursors by reaction with an activating agent to form activated intermediates, followed by sequential addition of intermediates. activated to the growing oligonucleotide chain (generally anchored at one end to a suitable solid support) to form the oligonucleotide product.

Recombinant methods

[0140] Recombinant methods for producing nucleic acids in a cell are well known to those skilled in the art. These include the use of vectors, plasmids, cosmids, and other vehicles for the delivery of a nucleic acid to a cell, which may be the target cell or simply a host cell (to produce large amounts of the desired RNA molecule). Alternatively, such vehicles can be used in the context of a cell-free system as long as the reagents to generate the RNA molecule are present. Such methods include those described in Sambrook, 2003, Sambrook, 2001, and Sambrook, 1989. In certain embodiments, the present invention relates to nucleic acid molecules that are not synthetic. In some embodiments, the nucleic acid molecule has a chemical structure of a naturally occurring nucleic acid and a sequence of a naturally occurring nucleic acid, such as the exact and complete sequence of a single-stranded primary miRNA (see Lee 2002), a single-stranded precursor miRNA or a mature single-stranded miRNA. In addition to the use of recombinant technology, such non-synthetic nucleic acids can be chemically generated, such as by using the technology used to create oligonucleotides.

MiRNA design

[0141] miRNAs typically comprise two chains, an active chain that is identical in sequence to the mature miRNA being studied and a complementary chain that is at least partially complementary to the active chain. The active chain is the biologically relevant molecule and should preferably be taken up by the complex in the cells that modulates translation or through degradation of mRNA or translational control. The preferential uptake of the active chain has two profound results: (1) the observed activity of said miRNA increases dramatically and (2) the unintended effects induced by the uptake and activation of the complementary chain are essentially eliminated. In accordance with the invention, various miRNA designs can be used to ensure preferential uptake of the active chain.

Blocking agent 5 '

[0142] The introduction of a stable fraction other than phosphate or hydroxyl at the 5 'end of the complementary strand affects its activity in the miRNA pathway. This ensures that only the active miRNA strand will be used to regulate translation in the cell. 5 'modifications include, but are not limited to, NH2, biotin, an amine group, a lower alkylamino group, an acetyl group, 2'O-Me, DMTO, fluorescein, a thiol or acridine, or any other group with this type of functionality.

[0143] Other modifications of the sense chain. The introduction of nucleotide modifications such as 2'-O Me, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl (2'-0-MOE), 2 '-O-aminopropyl (2'-0-AP), 2'-O-dimethylaminoethyl (2'-0-DMAOE), 2'-O-dimethylaminopropyl (2'-0-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-ON-methylacetamido (2'- 0-NMA), NH2, biotin, an amine group, a lower alkylamino group, an acetyl group, DMTO, fluorescein, a thiol, or acridine or any other group with this type of functionality in the complementary strand of the miRNA can eliminate the activity of the complementary chain and improve the uptake of the active chain of miRNA.

[0144] Base mismatches in the sense chain. As with siRNAs (Schwarz 2003), the relative stability of the 5 'and 3' ends of the active strand of miRNA apparently determines the uptake and activation of active by the miRNA pathway. The destabilization of the 5 'end of the miRNA active chain by the strategic placement of base mismatches at the 3' end of the synthetic miRNA complementary chain improves the activity of the active chain and essentially eliminates the activity of the complementary chain.

Host cells and target cells

[0145] As part of the disclosure, cells where a miRNA or a source thereof is introduced or where the presence of a miRNA is assessed can be derived from or contained in any organism. Preferably, the cell is a vertebrate cell. More preferably, the cell is a mammalian cell. Even more preferably, the cell is a human cell.

[0146] A mammalian cell may be germline or somatic, totipotent or pluripotent, dividing or non-dividing, epithelial, immortalized or transformed, or the like. The cell can be an undifferentiated cell, such as a stem cell, or a differentiated cell, such as an organ or tissue cell. Alternatively, the cells can be classified as epithelial cells, brain, breast, cervix, colon, gastrointestinal tract, heart, kidney, large intestine, liver, lung, ovary, pancreas, heart, prostate, bladder, small intestine, stomach, testes or uterus.

[0147] As used in this case, the terms "cell", "cell line" and "cell culture" can be used interchangeably. All these terms also include their progeny, which is any and all subsequent generations formed by cell division. It is understood that all progeny may not be identical due to deliberate or involuntary mutations. A host cell can be "transfected" or "transformed," which refers to a process by which an exogenous nucleic acid is transferred or introduced into the host cell. A transformed cell includes the cell of the primary subject and its progeny. As used herein, the terms "engineered" and "recombinant" cells or host cells are intended to refer to a cell into which an exogenous nucleic acid sequence has been introduced, such as, for example, a small interfering RNA or a template construct that encodes a reporter gene. Therefore, recombinant cells are distinguishable from naturally occurring cells that do not contain a recombinantly introduced nucleic acid.

[0148] As part of the disclosure, a tissue may comprise a host cell or cells to be transformed or contacted with a nucleic acid delivery composition and / or an additional agent. Tissue can be part of or separate from an organism. In certain embodiments of the disclosure, a tissue and its constituent cells may comprise, but are not limited to, brain, stem cells, liver, lung, bone, breast, cervix, colon, endometrium, epithelial, esophagus, goblet cells, kidney, ovaries, pancreas, prostate, bladder, skin, small intestine, stomach, testicles, heart, blood vessel.

[0149] In certain embodiments of the disclosure, the host cell or tissue may be comprised of at least one organism. In certain embodiments, the organism can be a mammal, a human, a primate, or a murine. A person skilled in the art would further understand the conditions under which to incubate all of the host cells described above to maintain them and to allow their division to form progeny.

Administration methods

[0150] The present invention involves in some embodiments administering a nucleic acid to a cell. This can be done as part of a screening method or can be related to a therapeutic or diagnostic application as described herein.

[0151] RNA molecules can be encoded by a nucleic acid molecule comprised in a vector. The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can replicate. A nucleic acid sequence can be "exogenous", meaning that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell, but at a position in the acid nucleic acid of the host cell where the sequence is not ordinarily found. Vectors include plasmids, cosmids, viruses (bacteriophages, animal viruses, lentiviruses, and plant viruses), and artificial chromosomes (eg, YAC). A person skilled in the art would be well equipped to construct a vector using standard recombinant techniques, which are described in Sambrook et al, 1989 and Ausubel et al, 1996. In addition to encoding a modified polypeptide such as modified gelonin, a vector can encode unmodified polypeptide sequences such as a tag or targeted molecule. A targeted molecule is one that targets the desired nucleic acid to a particular organ, tissue, cell, or other location in a subject's body.

[0152] The term "expression vector" refers to a vector with a nucleic acid sequence encoding at least part of a gene product capable of being transcribed. Expression vectors can contain a variety of "control sequences", which refer to nucleic acid sequences necessary for transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that direct transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described

[0153] There are several ways in which expression vectors can be introduced into cells. In certain embodiments of the invention, the expression vector comprises a virus or a designed vector derived from a viral genome. The ability of certain viruses to enter cells by receptor-mediated endocytosis, to integrate into the host cell genome, and to express viral genes stably and efficiently has made them attractive candidates for transfer of foreign genes into mammalian cells ( Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). The earliest viruses used as gene vectors were DNA viruses, including papovaviruses (40 simian viruses, bovine papillomavirus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). These have a relatively low capacity for foreign DNA sequences and have a restricted host spectrum. Furthermore, its oncogenic potential and cytopathic effects on permissive cells raise safety issues. They can host only up to 8 kb of foreign genetic material, but can be easily introduced into a variety of cell lines and laboratory animals (Nicolas and Rubenstein, 1988; Temin, 1986). Expression vectors may contain an RNAi expression cassette comprising a promoter and one or more hairpin structures separated by one or more spacer regions (WO2006 / 084209).

[0154] Another way of introducing expression vectors into cells, using avidin fusion proteins, is described in US6,287,792.

[0155] Retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells; they can also be used as vectors. Other viral vectors can be used as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988), adeno-associated virus (AAV) (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat and Muzycska) can be used. , 1984), lentiviruses (WO2008 / 071959, WO2004 / 054512), hemagglutinating virus of Japan (WO2004 / 035779), Baculovirus (WO2006 / 048662) and herpesviruses. They offer several attractive characteristics for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988; Horwich et al, 1990).

[0156] Other suitable methods for nucleic acid administration to affect the expression of compositions of the present invention are believed to include virtually any method by which a nucleic acid can be introduced (eg, DNA, including viral vectors and not viral) in an organelle, a cell, a tissue or an organism, as described in this case or as a person skilled in the art would know. Such methods include, but are not limited to, direct administration of DNA such as by injection (US Patent Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466, and 5,580,859), including microinjection (Harlan and Weintraub, 1985; US Patent No. 5,789,215); by electroporation (US Patent No. 5,384,253); by precipitation of calcium phosphate (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); using DEAE dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic charge (Fechheimer et al, 1987); by liposome-mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al, 1987; Wong et al, 1980; Kaneda et al., 1989; Kato et al., 1991); by photochemical internalization (W02008 / 007073); for microprojectile bombardment (PCT Applications Nos. W or 94/09699 and 95/06128; US Patent Nos. 5,610,042; 5,322,783, 5,563,055, 5,550,318, 5,538,877 and 5,538,880); by stirring with silicon carbide fibers (Kaeppler et al, 1990; US Patent Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (US Patent Nos. 5,591,616 and 5,563,055); or by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993; US Patent Nos. 4,684,611 and 4,952,500); by DNA uptake mediated by desiccation / inhibition (Potrykus et al., 1985). Through the application of techniques such as these, organelle (s), cell (s), tissue (s) or organism (s) can be stably or transiently transformed.

[0157] A review provides several ways to formulate an RNA molecule to optimize its internalization into a cell (Kim SS. Et al, Trends Mol. Med., 2009, 15: 491-500). The following other publications disclose Alternative ways to formulate an RNA molecule to enhance its internalization in a cell: WO 2007/095152, which describes the use of PTD-DRBD (double-stranded binding domain peptide transduction domains) for the administration of oligonucleotides, WO 2009/086558, which describes the use of SNALP particles (stable nucleic acid lipid particles), which comprise a mixture of cationic and fusion lipids that allow cell uptake and endosomal release of the particle's nucleic acid payload, WO 2009/149418, which describes neutral phospholipid-oil-RNAi emulsions, WO 2007/121947, which describes the use of a lipoplex-based delivery vehicle, WO 2009/132131, which describes the use of novel lipids and acid particles. nucleic lipid that provide efficient encapsulation and efficient delivery of encapsulated nucleic acid to cells, WO2004 / 091578 and WO2004 / 064805, which describe a cocl technology Eato of alternating spiral lipid layers around a nucleic acid molecule, WO2003 / 047494 and WO2003 / 047493, which describe reverse micelles incorporating nucleic acids for oral and mucosal administration, WO 2008/156702, which describes bacteria and a bacterial therapeutic particle (BTP), including oligonucleotides as a vehicle of administration to cells. Each of the formulations referenced or described in these publications is encompassed by the present invention.

[0158] A variety of compounds have been attached to the ends of oligonucleotides to facilitate their transport across cell membranes. Short signal peptides found in HIV TAT, HSV VP22, Drosophila antennapedia and other proteins have been found to allow rapid transfer of biomolecules across membranes (reviewed by Schwarze 2000). These signal peptides, called protein transduction domains (PTDs), have been linked to oligonucleotides to facilitate their administration to cultured cells (Eguchi A, Dowdy SF, Trends Pharmacol Sci., 2009, 7: 341-5). Cholesterols have been conjugated to oligonucleotides to improve their uptake into cells in animals (MacKellar 1992). Terminal cholesterol groups apparently interact with receptors or lipids on cell surfaces and facilitate internalization of the modified oligonucleotides. Likewise, poly-L-lysine has been conjugated with oligonucleotides to reduce net negative charge and improve uptake into cells (Leonetti 1990).

[0159] A variety of compounds have been developed that complex nucleic acids, administer them to cell surfaces, and facilitate their uptake into and release from endosomes. Among these are: (1) a variety of lipids such as DOTAP (or another cationic lipid), DDAB, DHDEAB, and DOPE, and (2) non-lipid-based polymers such as polyethyleneimine, polyamidoamine, and dendrimers of these and other polymers. In some of these embodiments, a combination of lipids such as DOTAP and cholesterol or a cholesterol derivative is used (US Patent 6,770,291). Several of these reagents have been shown to facilitate nucleic acid uptake in animals.

[0160] The cellular components involved in the miRNA pathway are becoming known. Proteins that stabilize and / or transport miRNAs within cells can improve the stability and activity of miRNAs because they should protect and guide bound miRNAs once they are in cells. Mixtures of the miRNA and miRNA transporter proteins could improve the efficacy of miRNA-based treatments. RNAs are hydrophilic molecules by virtue of their anionic phosphate and sugar skeleton. Although nucleobases are hydrophobic, hydrophilicity dominates due to the extensive hydrogen bonding resulting from the phosphate and sugar residues. The hydrophilic character and the anionic skeleton reduce cell permeation. The conjugation of lipophilic groups such as cholesterol (Manoharan, 2002) and derivatives of lauric and lithocolic acids with C32 functionality (Lorenz et al, 2004) have been shown to improve cell uptake. Furthermore, the binding of steroid-conjugated oligonucleotides to different lipoproteins in the blood stream, such as LDL, protects their integrity and directs their biodistribution (Rump et al, 2000). Cholesterol bound to antisense molecules (Bijsterbosch et al., 2001) and aptamers (Rusconi et al., 2004) have also been shown to stabilize oligonucleotides by allowing binding to lipoproteins. Cholesterol has been shown to improve serum siRNA uptake and stability in vitro (Lorenz et al., 2004) and in vivo (Soutschek et al., 2004). Additionally, a series of small molecules such as SB-435495 (Blackie et al, (2002)), isradipine (Oravcova et al, 1994), amlodipine (Oravcova et al, 1994) and 2.2 ', 4.4', 5 , 5'-hexachlorobiphenyl (Borlakoglu et al, 1990) could improve cell uptake and improve resistance to nucleases by promoting lipoprotein association.

Screening with miRNA libraries

[0161] As used in the patent application, screening is a process where multiple specific miRNA reagents are administered separately to individual or animal cell populations. At one or more designated times after administration, cell populations or animals are evaluated for one or more phenotypes. Those cells or animals that have a significantly different phenotype than the cells or animals in the negative control group are classified as positive. The miRNA that was being manipulated in the sample is defined as a match. The matches represent targets for further research and potential therapeutic development.

[0162] In some embodiments, there is a multi-step process for screening, in certain embodiments, there are four general steps:

(1) Develop a quantitative assay to control the cellular process that is being studied.

[0163] Assays that measure the intensity of a cell phenotype range from microscopic assays that control cell size, cell cycle status, or antibody staining to enzyme assays that assess the production of a specific substrate in a cell lysate to measurements Direct from biomolecules or small molecules in lysates, cells or medium.

[0164] Critical to the success of a screen is creating an assay that actually measures the cell phenotype and maximizing the signal to noise ratio of the assay. Maximizing signal to noise involves testing variables such as assay time, assay components, cell type, and the length of time between transfection and assay. The greater the difference in assay results between a positive phenotype and a negative control phenotype, the greater the extent of screening results and the better the opportunity to identify interesting genes.

(2) Optimize transfection conditions for desired cells.

[0165] The first step in this process is to identify a transfection reagent and the seeding conditions that maximize the uptake of synthetic miRNAs while maintaining high cell viability. We found it useful to test 2-5 different transfection reagents when using cell lines or 5-10 electroporation conditions when using primary or suspension cells. Transfection can be optimized for the reagent or electroporation condition that performed best among the tested conditions. Screening for specific miRNA libraries requires conditions for high throughput transfection. In this type of screening, a lentiviral introduction was used instead of transfection. This may require alternative optimization techniques.

(3) Screening

[0166] Once the assay and transfection process have been developed, a library of virus-expressed synthetic miRNAs or miRNAs can be sequentially introduced into cells in a 24- or 96-well plate. Duplicate or triplicate transfections for each reagent provide sufficient data for a reasonable statistical analysis.

(4) Validate matches

[0167] Validating a match involves demonstrating that the observed phenotype is due to the target miRNA. Matches are typically confirmed by administering a dilution series of the synthetic miRNA or miRNA inhibitor that has been recorded as a match in the cell that was originally evaluated. Confirmation is slightly different from validation. Confirmation is a repeat of the miRNA-induced phenotype, while validation may also include reversing the phenotype by antagonizing the miRNA-mediated phenotype.

Marking and marking techniques

[0168] In some embodiments of the disclosure, the present invention relates to labeled miRNAs, such as for screening assays to assess the therapeutic or diagnostic relevance of a particular miRNA species. It is contemplated that miRNA can first be isolated (or from a cell where the miRNA is endogenous to the cell or from a cell where the miRNA is exogenous to the cell) and / or purified prior to labeling. This can achieve a reaction that more efficiently marks the miRNA, unlike other RNA in a sample where the miRNA is not isolated or purified prior to labeling. In many embodiments of the invention, the marker is non-radioactive. Generally, nucleic acids can be labeled by adding labeled nucleotides (one-step process) or adding nucleotides and labeling added nucleotides (two-step process).

[0169] In addition, miRNAs can be labeled as described in US Patent Application Serial No. 60 / 649,584. Such nucleotides include those that can be labeled with a dye, including a fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are readily available; they can be purchased commercially or can be synthesized by reactions known to those skilled in the art.

Nucleotides to mark

[0170] Nucleotides for labeling are not naturally occurring nucleotides, but refer to prepared nucleotides that have a reactive fraction in them. Specific reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl, aminosulfhydryl, azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorothriazine, dichlorotriazine, mono- or di-halogen substituted diazine, maleimidine, epoxide, sulfonyl halide, acid halide, alkyl halide, aryl halide, alkylsulfonate, N-hydroxysuccinimide ester, imide ester, hydrazine, azidonitrophenyl, azide, 3- (2-pyridyldithio) -propionamide, glyoxal, aldehyde, iodoacetyl, cyanomethyl ester, p-nitrophenyl ester, o-nitrophenyl ester, hydroxypyridine ester, carbonylimidazole and the other such chemical groups. In some embodiments, the reactive functionality can be attached directly to a nucleotide, or it can be attached to the nucleotide through a linking group. The functional fraction and any linkers cannot substantially impair the ability of the nucleotide to be added to the miRNA or to be labeled. Representative linking groups include carbon-containing linking groups, typically ranging from about 2 to 18, typically about 2 to 8 carbon atoms, where the carbon-containing linking groups may or may not include one or more heteroatoms, for example, S, O, N, etc., and may or may not include one or more unsaturation sites. Of particular interest in many embodiments are the alkyl linking groups, typically lower alkyl linking groups of 1 to 16, typically 1 to 4 carbon atoms, where the linking groups may include one or more unsaturation sites . The functionalized nucleotides (or primers) used in the above functionalized target generation methods can be manufactured using known protocols or purchased from commercial vendors, eg Sigma, Roche, Ambion and IDT. Functional groups can be prepared in ways known to those skilled in the art, including representative information found in U.S. patents.

Nos. 4,404,289; 4,405,711; 4,337,063 and 5,268,486, and Br. Patent No. 1,529,202.

[0171] Amine modified nucleotides are used in various embodiments of the invention. The amine modified nucleotide is a nucleotide that has a reactive amine group for marker binding. It is contemplated that any ribonucleotide (G, A, U, or C) or deoxyribonucleotide (G, A, T, or C) can be modified for labeling. Examples include, but are not limited to, the following modified ribo- and deoxyribonucleotides: 5- (3-aminoalyl) -UTP; 8 - [(4-amino) butyl] -amino-ATP and 8 - [(6-amino) butyl] -amino-ATP; N6- (4-amino) butyl-ATP, N6- (6-amino) butyl-ATP, N4- [2,2-oxy-bis- (ethylamine)] - CTP; N6- (6-amino) hexyl-ATP; 8 - [(6-amino) hexyl] -amino-ATP; 5-propargilamino-CTP, 5-propargilamino-UTP; 5- (3-aminoalyl) -dUTP; 8 - [(4-amino) butyl] -amino-dATP and 8 - [(6-amino) butyl] -amino-dATP; N- (4-amino) butyl-dATP, N6- (6-amino) butyl-dATP, N4- [2,2-oxy-to- (ethylamino)] - dCTP; N6- (6-amino) hexyl-dATP; 8 - [(6-amino) hexyl] -amino-dATP; 5-propargilamino-dCTP and 5-propargilamino-dUTP. Such nucleotides can be prepared according to methods known to those skilled in the art. Furthermore, a person skilled in the art could prepare other nucleotide entities with the same amine modification, such as a 5- (3-aminoalyl) -CTP, g Tp, ATP, dCTP, dGTP, dTTP or dUTP instead of a 5- (3- aminoallyl) -UTP.

Marking techniques

[0172] In some embodiments, nucleic acids are labeled by catalytically adding to the nucleic acid an already labeled nucleotide (s). One or more labeled nucleotides can be added to the miRNA molecules. See US Patent 6,723,509.

[0173] In other embodiments, an unlabelled nucleotide or nucleotides (s) is catalytically added to a miRNA and the unlabelled nucleotide is modified with a chemical moiety allowing it to be subsequently labeled, in embodiments of the invention, the chemical fraction is a reactive amine such that the nucleotide is an amine modified nucleotide. Examples of amine modified nucleotides are well known to those skilled in the art and many are commercially available such as from Ambion, Sigma, Jena Bioscience and TriLink.

[0174] Unlike cDNA tagging during synthesis, the question of tagging miRNAs is how to tag the existing molecule. To this end, we can use an enzyme capable of using a di- or triphosphate ribonucleotide or deoxyribonucleotide as a substrate for addition to a miRNA, a small RNA molecule. Furthermore, in specific embodiments, this involves using a modified di- or triphosphate ribonucleotide, which is added to the 3 'end of a miRNA. The source of the enzyme is not limiting. Examples of sources for the enzymes include yeast, gram-negative bacteria such as E. coli, Lactococcus lactis, and sheep pox virus.

[0175] Enzymes capable of adding such nucleotides include, but are not limited to, poly (A) polymerase, terminal transferase, and polynucleotide phosphorylase. In specific embodiments of the invention, ligase is contemplated to be NOT the enzyme used to add the marker, and instead a non-ligase enzyme is employed.

[0176] Poly (A) polymerase has been cloned from a number of organisms, from plants to humans. It has been shown to catalyze the addition of homopolymer tracts to RNA (Martin et al, RNA, 4 (2): 226-30, 1998).

[0177] Terminal transferase catalyzes the addition of nucleotides to the 3 'end of a nucleic acid.

[0178] The polynucleotide phosphorylase can polymerize nucleotide diphosphates without the need for a primer.

Markers and labels

[0179] miRNAs or miRNA probes can be labeled with a positron emission label or tag (including radioactive), enzymatic, colorimetric (includes visible and UV spectrum, including fluorescent), luminescent, or other for the purpose of detection or isolation. The marker can be detected directly or indirectly. Radioactive labels include 125I, 32P, 33P, and 35S. Examples of enzyme markers include alkaline phosphatase, luciferase, horseradish peroxidase, and p-galactosidase. The markers can also be proteins with luminescent properties, for example green fluorescent protein and phycoerythrin.

[0180] Colorimetric and fluorescent labels contemplated for use as conjugates include, but are not limited to, AMCA, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL, BODIPY 630/650, BODIPY 650/665, BODIP Y-R6G , BODIPY-TRX; Cascade Blue; Cascade Yellow; coumarin and its derivatives, such as 7-amino-4-methyl coumarin, amino coumarin, and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins and erythrosines; fluorescein and its derivatives, such as fluorescein isothiocyanate; macrocyclic chelates of lanthanide ions, such as Quantum Dye (™>; Marina Blue; Oregon Green; rhodamine dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red;

[0181] Specific examples of colorants include, but are not limited to, those identified above and the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 700 and Alexa Fluor 750; amino-reactive BODIPY dyes, such as BODIPY 493/503, BODEPY 530/550, BODEPY 558/568, BODIPY 564/570, BODDPY 576/589, BODIPY 581/591, BODEPY 630/650, BODIPY 650/655, BODIPY FL , BODIPY R6G, BODEPY TMR and BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA , 2 ', 4', 5 ', 7-tetrabromosulfonfluorescein and TET.

[0182] Specific examples of fluorescently labeled ribonucleotides are available from Molecular Probes, and these include Alexa Fluor 488-5-UTP, Fluorescein-12-UTP, BODEPY FL-14-UTP, BODIPY TMR-14-UTP, tetramethylrodamine-6- UTP, Alexa Fluor 546-14-UTP, Texas Red-5-UTP and BODIPY TR-14-UTP. Other fluorescent ribonucleotides are available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP. Examples of fluorescently labeled deoxyribonucleotides include dinitrophenyl (DNP) -11-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, fluorescein-12-dUTP, Oregon Green 488-5-dUTP, BODEPY FL-14-dUTP , rhodamine-5-dUTP green, Alexa Fluor 532-5-dUTP, BODEPY TMR-14-dUTP, tetramethylrodamine-6-dUTP, Alexa Fluor 546-14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12 -dUTP, Texas Red-5-dUTP, BODEPY TR-14-dUTP, Alexa Fluor 594-5-dUTP, BODEPY 630 / 650-14-dUTP, BODIPY 650 / 665-14-dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor 594-7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP. It is contemplated that nucleic acids can be labeled with two different labels.

[0183] It is contemplated that synthetic miRNAs can be labeled with more than one marker or with two different labels. Furthermore, fluorescence resonance energy transfer (FRET) can be employed in methods of the invention (eg, Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001). Fluorescent energy transfer dyes can be used, such as the thiazole-ethidium orange heterodimer; and, TOTAB.

[0184] Alternatively, the marker may not be detectable per se, but indirectly detectable or that allows isolation or separation of the nucleic acid to which it is directed. For example, the marker could be biotin, digoxigenin, polyvalent cations, chelating groups, and the other ligands, include ligands for an antibody.

Visualization techniques

[0185] A number of techniques for visualizing or detecting labeled nucleic acids are readily available. The reference by Stanley T. Crooke, 2000 has a discussion of such techniques (Chapter 6). Such techniques include, microscopy, matrices, fluorometry, Light cycler devices or other real-time PCR (™> machines, FACS analysis, scintillation counters, Phosphoimager devices, Geiger counters, MRI, TAC, detection methods antibody-based (Western blots, immunofluorescence, immunohistochemistry), histochemical techniques, HPLC (Griffey et al, 1997, spectroscopy, capillary gel electrophoresis (Cummins et ah, 1996), spectroscopy; mass spectroscopy; radiological techniques; and mass balance Alternatively, nucleic acids can be labeled or tagged to allow for efficient isolation In other embodiments of the invention, nucleic acids are biotinylated.

[0186] When two or more differentially colored markers are employed, fluorescence resonance energy transfer (FRET) techniques can be employed to characterize the dsRNA. Furthermore, a person skilled in the art is well aware of ways to visualize, identify and characterize labeled nucleic acids and, accordingly, such protocols can be used as part of the invention. Examples of tools that can be used also include fluorescence microscopy, a bioanalyzer, a plate reader, Storm (Molecular Dynamics), matrix scanner, FACS (fluorescence activated cell sorter), or any instrument that has the ability to excite and detect a fluorescent molecule.

Matrix Preparation

[0187] The present invention can be used with miRNA matrices, which are microarrays or ordered microarrays of nucleic acid molecules (probes) that are completely or nearly complementary or identical to a plurality of miRNA molecules or precursor miRNA molecules and that they are positioned on a support material in a spatially separate organization. Macroarrays are typically nitrocellulose or nylon sheets on which the probes have been located. Microarrays position nucleic acid probes denser so that up to 10,000 nucleic acid molecules can fit in a region typically 1 to 4 square centimeters. Microarrays can be manufactured by locating nucleic acid molecules, eg, genes, oligonucleotides, etc., on substrates or by manufacturing oligonucleotide sequences in situ on a substrate. Localized or manufactured nucleic acid molecules can be applied in a high-density matrix pattern of up to about 30 non-identical nucleic acid molecules per square centimeter or larger, for example, up to about 100 or even 1000 per square centimeter. Microarrays typically use coated glass as a solid support, unlike the nitrocellulose-based material in filter matrices. With an ordered array of nucleic acid samples complementary to miRNA, the position of each sample can be tracked and linked to the original sample. Those skilled in the art are aware of a variety of different array devices where a plurality of different nucleic acid probes are stably associated with the surface of a solid support. Useful substrates for matrices include nylon, glass, and silicon. Such matrices can vary in a number of different ways, including the average length of the probes, the sequence or types of probes, the nature of the bond between the probe and the surface of the matrix, eg, covalent or non-covalent, and Similar.

[0188] Representative methods and equipment for preparing a microarray have been described, for example, in US Patent Nos. 5,143,854; 5,202,231; 5,242,974; 5,288,644; 5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049; 5,436,327; 5,445,934; 5,468,613; 5,470,710; 5,472,672; 806; 5,525,464; 5,503,980; 5, 270; 5525 464; 5527 681; 5529 756; 5532 128; 5545 531; 5547, 839; 5,554,5556,752; 5,561,071; 5571, 639; 5580 726; 5580, 732; 5593 839; 5599 695; 5599 672; 5610, 287; 5624 711; 5631 134; 5 639, 603; 5654413; 5,658,734; 5661, 028; 5665 547; 5667 972; 5695 940; 5700, 637; 5 744 305; 5,800 992; 5,807 522; 5830, 645; 5,837,196; 5871, 928; 5,847 219; 5,876 932; 5,919 626; 6004, 755; 6 087 102; 6368 799; 6,383,749; 6,617,112; 6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995; WO 95/21265; WO 95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO 97/27317; WO 99/35505; WO 09923256; WO 09936760; WO0138580; WO 0168255; WO 03020898; WO 03040410; WO 03053586; WO 03087297; WO 03091426; WO03100012; WO 04020085; WO 04027093; EP 373203; EP 785280; EP 799897 and UK 8803000. It is contemplated that the matrices may be high-density matrices, such that they contain 100 or more different probes. It is contemplated that they may contain 1,000, 16,000, 65,000, 250,000, or 1,000,000 or more different probes. Probes can be targeted to one or more different organisms. Oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, or 15 to 40 nucleotides in length in some embodiments, in certain embodiments, the oligonucleotide probes are 20 to 25 nucleotides in length.

[0189] The location and sequence of each different probe sequence in the array are generally known. Furthermore, the large number of different probes can occupy a relatively small area that provides a high-density matrix that has a probe density generally greater than about 60, 100, 600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 probe. different oligonucleotides per cm2 The surface area of the matrix can be about or less than about 1, 1.6, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cm2.

[0190] Furthermore, a person skilled in the art could easily analyze generated data using a matrix. Such protocols are described above and include information found in WO 9743450; WO 03023058; WO 03022421; WO 03029485; WO03067217; WO 03066906; WO 03076928; WO 03093810; WO 03100448A1.

[0191] Recently, alternative profiling methods have become available, based on solution hybridization and subsequent immobilization and identification, eg Illumina platform.

Sample preparation

[0192] It is contemplated that miRNA from a wide variety of samples can be analyzed using the assays described herein. While endogenous miRNA is contemplated for use with some embodiments, recombinant or synthetic miRNA - including nucleic acids that are identical to endogenous miRNA or precursor miRNA - can also be managed and analyzed as described herein. The samples can be biological samples, in which case they can be from blood, CSF, tissue, organs, tumor, semen, sputum, deposition, urine, saliva, tears, other body fluid, hair follicles, skin or any sample that contains or constitutes biological cells. Alternatively, the sample may not be a biological sample, but rather a chemical mixture, such as a cell-free reaction mixture (which may contain one or more biological enzymes).

Cellular assays to identify miRNAs related to a disease

[0193] In the disclosure, specifically contemplated applications include identifying miRNAs that contribute to TEM that are themselves parts of a disease or condition or could otherwise be associated with a particular disease. Applications specifically contemplated for the invention include identifying miRNAs that contribute to TEM that are themselves parts of a cancer or could otherwise be associated with a particular disease. Additionally, a contemplated application includes identifying miRNAs that are capable of reversing TEM and inducing TME. In addition, miRNA functions can be compared between a sample believed to be susceptible to a particular TEM-associated cancer and one believed to be non-susceptible or resistant to that cancer. Specifically, it is contemplated that the a Rn molecules of the present invention can be used to treat any of the diseases or conditions discussed in the preceding section or to modulate any of the cellular pathways discussed in the preceding section. Specifically contemplated applications include identifying miRNAs that contribute to cellular TEM processes that are themselves parts of a disease or may otherwise be associated with a particular disease. In addition, miRNA functions can be compared between a sample believed to be susceptible to a particular TEM-associated cancer and one believed to be not susceptible or resistant to that cancer.

[0194] The efficacy of different therapeutic drugs can be modified by miRNA as defined and used according to the present invention. Furthermore, it has been described that tumor cells that have undergone TEM can become resistant to chemotherapy and immunotherapy (Thiery et al. 2009 Cell 139: 871-90). Therefore, miRNA-based drugs that induce TEM inversion can improve susceptibility to, for example, chemotherapy and immunotherapy. Such therapeutic drugs include, but are not limited to, chemotherapeutic drugs. A "chemotherapeutic agent" is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent can be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis. Most chemotherapeutic agents fall into the following categories: alkylating agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and nitrosoureas.

[0195] Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide; alkyl sulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carbocuone, meturedopa, and uredopa; ethyleneimines and methylamelamines, including altretamine, triethylenemelamine, triethylene phosphoramide, triethylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bulatazine and bulatacinone); a camptothecin (including the synthetic analogue topotecan); Bryostatin; calistatin; CC-1065 (including its synthetic analogues adozelesin, carzelesin, and bizelesin); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including synthetic analogues KW-2189 and CBl-TMl); eleutherobin; pancratistatina; a sarcodictin; spongistatin; nitrogen mustards such as chlorambucil, chlornafazine, colophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine hydrochloride, melphalan, novembiquina, phenesterin, prednimustine, trophosphamide, mosquito, nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as enediine antibiotics (eg, calicheamicin, especially gamma calicheamicin and omega calicheamicin); dynemycin, including dynemycin A; bisphosphonates, such as clodronate; a esperamicina; as well as neocarcinostatin chromophore and related enediine chromoprotein antiobiotic chromophores, Clarinomycin, actinomycin, autrarnicin, azaserine, bleomycin, cactinomycin, carabicin, carminomycin, chromomycin, dactinomycin, daunorubicin-5, norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, and deoxydoxorubicin), epirubicin, perazinicin, mitomycin, cyclin, icarubicin, marcin potfiromycin, puromycin, chelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone; antisuprenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucilo; bisantrene; edatraxate; defofamin; demecolcin; diazicuone; elformitin; eliptinium acetate; an epothilone; ethoglucid; gallium nitrate; hydroxyurea; lentinano; lonidainin; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; fenamet; pyrarubicin; losoxantrone; podophyllic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex; razoxane; rhizoxine; sizofirano; spirogermanium; tenuazonic acid; triazicuone; 2,2 ', 2 "-trichlorothriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridine A, and angidin); urethane; vindesine; dacarbazine; manomustine; mitobronitol; mitolactol; pipobromann; gacytosine; arabinoside (" Ara-C ");cyclophosphamide;thiotepa; taxoids, eg paclitaxel and doxetaxel; chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin, and carboplatin; vinblastine ; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (eg CPT-Il); topoisomerase inhibitor RFS 2000 DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the foregoing.

[0196] Also included in this definition are anti-hormonal agents that act to regulate or inhibit hormonal action in tumors such as anti-estrogens and selective estrogen receptor modulators (MSREs), including, for example, tamoxifen, raloxifene, droloxifene, 4-hydroxytaxamine. , trioxifene, keoxifen, LYl 17018, onapristone and toremifene; aromatase inhibitors that inhibit the enzyme aromatase, which regulates the production of estrogens in the adrenal glands, such as, for example, 4 (5) -imidazoles, aminoglutethimide, megestrol acetate, exemestane, formestania, fadrozole, vorozole, letrozole, and anastrozole; and antiandrogens such as flutamide, nilutamide, bicalutamide, leuprolide, and goserelin; as well as troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those that inhibit the expression of genes in signaling pathways involved in aberrant cell proliferation, such as, for example, PKC-a, Raf and H-Ras; ribozymes such as an inhibitor of VEGF expression and an inhibitor of HER2 expression; vaccines such as gene therapy vaccines and pharmaceutically acceptable salts, acids or derivatives of any of the foregoing. A list of US FDA approved cancer drugs with their approved indications can be found on the global computer network at accessdata.fda.gov/scripts/cder/onctools/druglist.cfm. Furthermore, it is contemplated that samples showing differences in the activity of certain pathways can also be compared. Such cellular pathways include, but are not limited to, the following: any pathways of adhesion or motility, including, but not limited to, those involving cyclic AMP, protein kinase A, G-protein coupled receptors, adenyl cyclase, L-selectin , E-selectin, PECAM, VCAM-I, a-actinin, paxiline, cadherins, AKT, integrin-a, integrin-p, RAF-I, ERK, PI-3 kinase, vinculin, matrix metalloproteinases, Rho GTPases, p85, trefoil factors, profilin, FAK, MAP kinase, Ras, caveolin, calpain-1, calpain-2, epidermal growth factor receptor, ICAM-1, ICAM-2, cofilin, actin, gelsolin, Rho A, Rac, myosin light chain kinase, platelet-derived growth factor receptor or ezrin; any pathways of apoptosis, including, but not limited to, those involving AKT, Fas ligand, NFKB, caspase-9, PB kinase, caspase-3, caspase-7, ICAD, CAD, EndoG, granzyme B, Bad, Bax , Bid, Bak, APAF-I, cytochrome C, p53, a Tm, Bcl-2, PARP, Chkl, Chk2, Rho-21, c-Jun, Rho73, Rad51, Mdm2, Rad50, c-Abl, BRCA-I , perforin, caspase-4, caspase-8, caspase-6, caspase-1, caspase-2, caspase-10, Rho, Jun kinase, Jun kinase kinase, Rip2, lamina-A, lamina-Bl, lamin-B2, Fas receptor, H2O2, granzyme A, NADPH oxidase, HMG2, CD4, CD28, CD3, TRADD, IKK, FADD, GADD45, death receptor DR3, death receptor DR4 / 5, FLIP, APO-3, GRB2, SHC, ERK , MEK, RAF-1, cyclic AMP, protein kinase A, E2F, retinoblastoma protein, Smac / Diablo, ACH receptor, 14-3-3, FAK, SODD, TNF receptor, RTP, cyclin-Dl, PCNA, BcI -XL, PIP2, PIP3, PTEN, ATM, Cdc2, protein kinase C, calcineurin, IKKa, IKKp, IKKy, SOS-I, c-FOS, Traf-1, Traf-2, kBp or the proteasome; any cellular activation pathway, including, but not limited to, those involving protein kinase A, nitric oxide, caveolin-1, actin, calcium, protein kinase C, Cdc2, cyclin B, Cdc25, GRB2, protein kinase SRC, factors ribosylation of ADP (ARF), phospholipase D, AKAP95, p68, Aurora B, CDK1, Eg7, histone H3, PKAc, CD80, PI3 kinase, WASP, Arp2, Arp3, p34, p20, PP2A, angiotensin, conversion enzyme angiotensin, protease-activated receptor 1, protease-activated receptor 4, Ras, RAF-I, PLCp, PLCy, COX-I, G-protein coupled receptors, phospholipase A2, IP3, SUMO1, SUMO 2/3, ubiquitin, Ran, Ran-GAP, Ran-GEF, p53, glucocorticoids, glucocorticoid receptor, components of the SWI / SNF complex, RanBPl, RanBP2, importines, exportins, RCCl, c D40, ligand CD40, p38, DCKa, IKKp, NFKB, TRAF2 , TRAF3, TRAF5, TRAF6, IL-4, IL-4 receptor, CDK5, AP-I transcription factor, CD45, CD4, T-cell receptors, MAP kinase, nervi growth factor bear, nerve growth factor receptor, c-Jun, c-Fos, Jun kinase, GRB2, SOS-I, ERK-I, ERK, JAK2, STAT4, IL-12, IL-12 receptor, nitric oxide synthase , TYK2, IFNy, elastase, IL-8, epithelins, IL-2, IL-2 receptor, CD28, SMAd 3, SMAD4, TGFp or TGFp receptor; any pathway of cell cycle regulation, signaling or differentiation, including, but not limited to, those involving TNF, protein kinase SRC, Cdc2, cyclin B, Grb2, Sos-1, SHC, p68, Aurora kinases, protein kinase A, protein kinase C, Eg7, p53, cyclins, cyclin-dependent kinases, neural growth factor, epidermal growth factor, retinoblastoma protein, ATF-2, ATM, ATR, AKT, CHK1, CHK2, 14-3-3, WEE1, CDC25 CDC6, Origin Recognition Complex Proteins, pl5, pl6, p27, p21, ABL, c-ABL, SMAD, ubiquitin, SUMO, heat shock proteins, Wnt, GSK- 3, angiotensin, p73 any PPAR, TGFa, TGFp, p300, MDM2, GADD45, Notch, cdc34, BRCA-I, BRCA-2, SKP1, the proteasome, CULI, E2F, pi 07, steroid hormones, steroid hormone receptors, kBa, kBp, Sin3A, heat shock proteins, Ras, Rho, ERK, IKK, PI3 kinase, Bcl-2, Bax, PCNA, MAP kinases, dynein, RhoA, PKAc, cyclin AMP, FAK, PIP2, PIP3, integrins, thrombopoietin, Fas, Fas ligand, PLK3, MEK, JAK, STAT, acetylcholine, paxiline calcineurin, p38, importines, exportins, Ran, Rad50, Rad51, DNA-polymerase, RNA-polymerase, Ran-GAP, Ran-GEF, NuMA , Tpx2, RCCl, Son ic Hedgehog, Crml, Patched (Ptc-1), m Pf, CaM kinases, tubulin, actin, kinetochore associated proteins, centromere binding proteins, telomerase, TERT, PP2A, c-MYC, insulin, T cell receptors, B-cell receptors, CBP, 1KB, NFKB, RACl, RAFl, EPO, diacylglycerol, c-Jun, c-Fos, Jun kinase, hypoxia inducible factors, GATA4, p-catenin, a-catenin, calcium, arrestin, survivin , caspases, procaspases, CREB, CREM, cadherins, PECAM, corticosteroids, colony stimulating factors, calpains, adenyl cyclase, growth factors, nitric oxide, transmembrane receptors, retinoids, G proteins, ion channels, transcriptional activators, transcriptional coactivators, repressors transcriptional, interleukins, vitamins, interferons, transcriptional corepressors, the nuclear pore, nitrogen, toxins, proteolysis or phosphorylation; or any metabolic pathway, including but not limited to, those involving amino acid biosynthesis, fatty acid oxidation, neurotransmitter biosynthesis and other cellular signaling molecules, polyamine biosynthesis, lipid and sphingolipid biosynthesis, catabolism of amino acids and nutrients, nucleotide synthesis, eicosanoids, electronic transport reactions, ER-associated degradation, glycolysis, fibrinolysis, ketone body formation, phagosome formation, cholesterol metabolism, uptake regulation of food, energy homeostasis, prothrombin activation, synthesis of lactose and other sugars, resistance to multiple drugs, phosphatidylcholine biosynthesis, proteasome, amyloid precursor protein, Rab GTPases, starch synthesis, glycosylation , the synthesis of phosphoglycerides, vitamins, the citric acid cycle, the IGF-I receptor, the cycle of urea, gallbladder transport or rescue routes. It is further contemplated that the nucleic acid molecules of the disclosure can be used in diagnostic and therapeutic methods with respect to any of the above pathways or factors. Thus, in some embodiments of the invention, a miRNA inhibits, eliminates, activates, induces, increases, or otherwise modulates one or more of the above pathways or factors is contemplated as part of the methods of the invention. Nucleic acid can be used in the disclosure to diagnose a disease or condition based on the relationship of that miRNA to any of the pathways described above.

Other tests

[0197] In addition to the use of matrices and microarrays, it is contemplated that a number of difference assays could be employed to analyze miRNAs, their activities, and their effects. Such assays include, but are not limited to, RT-PCR, in situ hybridization, Hybridization Protection Assay (HPA) (GenProbe), Branched DNA Assay (bDNA) (Collins, ML et al. (1997). Nucleic Acids Research 25: 2979-2984), rolling circle amplification (RCA), single molecule hybridization detection (US Genomics), Invader assay (ThirdWave Technologies) and Bridge Litigation Assay (Qiagen). Such methods are contemplated to be usable in the context of matrices as well as in the context of diagnostic assays.

Therapeutic and diagnostic applications

[0198] miRNAs affecting phenotypic traits provide intervention points for therapeutic applications as well as diagnostic applications (screening for the presence or absence of a particular miRNA). Specifically, it is contemplated that the RNA molecules of the present invention can be used to treat any of the diseases or conditions discussed in the preceding section. Furthermore, any of the methods described above can also be employed with respect to therapeutic aspects of the invention and diagnostic aspects of the disclosure. For example, methods with respect to miRNA detection or screening can also be used in a diagnostic setting. In therapeutic applications, an effective amount of the miRNAs of the present invention is administered to a cell, which may or may not be in an animal. In some embodiments, a therapeutically effective amount of the miRNAs of the present invention is administered to an individual for the treatment of TEM-associated cancer. In the disclosure, in some embodiments, a therapeutically effective amount of the miRNAs of the present invention is administered to an individual for the treatment of a TEM-associated disease or condition. The term "effective amount" as used herein is defined as the amount of the molecules of the present invention that are necessary to result in the desired physiological change in the cell or tissue to which it is administered. The term "therapeutically effective amount" as used herein is defined as the amount of the molecules of the present invention that achieves a desired effect with respect to TEM-associated cancer as defined herein above. A person skilled in the art readily recognizes that in many cases the molecules may not provide a cure, but may provide partial benefit, such as relief or improvement of at least one symptom. In some embodiments, a physiological change that has some benefit it is also considered therapeutically beneficial. Thus, in some embodiments, an amount of molecules that provides a physiological change is considered an "effective amount" or a "therapeutically effective amount".

[0199] In some embodiments, a molecule has a sequence that corresponds to the miRNA sequence of that particular animal, as opposed to another animal. Thus, in some embodiments, a human sequence is used as an RNA molecule of the present invention. In in vivo experiments, a miRNA sequence used in a test animal may differ from a corresponding human sequence. In this case, a miRNA that differs from the human sequence can be used to demonstrate the therapeutic effect in the animal. The results obtained with this sequence evaluated in an animal can be extrapolated expected results in humans with a corresponding miRNA molecule.

Methods of administration and formulations

[0200] The nucleic acid molecules of the invention can be administered to a subject alone or in the form of a pharmaceutical composition for the treatment of a condition or disease. Pharmaceutical compositions can be formulated in a conventional manner using one or more physiologically acceptable carriers, diluents, excipients, or auxiliaries that facilitate miRNA processing into preparations that can be used pharmaceutically. The appropriate formulation depends on the chosen route of administration. For topical administration, the miRNAs of the invention can be formulated as solutions, gels, ointments, creams, suspensions, etc. as well known in the art. Systemic formulations include those designed for administration by injection, eg, subcutaneous, intravenous, intramuscular, intrathecal, or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral, or pulmonary administration. For injection, the nucleic acids of the invention can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or a physiological saline buffer. The solution may contain formulation agents such as suspending, stabilizing, and / or dispersing agents. Alternatively, the nucleic acid molecules may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water, before use. For transmucosal administration, penetrants appropriate to the barrier to be penetrated are used in the formulation. Such penetrants are generally known in the art. For oral administration, nucleic acids can be easily formulated by combining the molecules with pharmaceutically acceptable carriers well known in the art. Such carriers allow the nucleic acids of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, aqueous suspensions, suspensions, and the like, for oral ingestion by a patient to be treated. For oral solid formulations such as, for example, powders, capsules, and tablets, suitable excipients include fillers such as sugars, for example, lactose, sucrose, mannitol, and sorbitol; cellulose preparations such as corn starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropyl methyl cellulose, sodium carboxymethyl cellulose and / or polyvinylpyrrolidone (PVP); granulating agents; and binding agents. If desired, disintegrating agents may be added, such as cross-linked polyvinylpyrrolidone, agar or alginic acid, or a derived salt such as sodium alginate. If desired, solid dosage forms can be sugar coated or enteric coated using standard techniques. For oral liquid preparations such as, for example, suspensions, elixirs, and solutions, suitable carriers, excipients, or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents, and the like can be added. For oral administration, the molecules can take the form of tablets, lozenges, etc. conventionally formulated. For administration by inhalation, the molecules for use according to the present invention are conveniently administered in the form of a pressurized pack aerosol or a nebulizer, with the use of a suitable propellant, for example dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dosing unit can be determined by providing a valve to deliver a dosed amount. Capsules and gelatin cartridges for use in an inhaler or insufflator can be formulated with a powdered mixture of the nucleic acids and a suitable powdered base such as lactose or starch. RNA molecules can also be formulated into rectal or vaginal compositions such as suppositories or retention enemas, for example, with conventional suppository bases such as cocoa butter or other glycerides.

[0201] In addition to the previously described formulations, the molecules can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (eg, subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the molecules can be formulated with suitable polymeric or hydrophobic materials (eg, as an emulsion in an acceptable oil) or ion exchange resins, or as poorly soluble derivatives, eg, as a poorly soluble salt. Alternatively, other pharmaceutical delivery systems can be employed.

[0202] Liposomes and emulsions are well known examples of delivery vehicles that can be used to deliver nucleic acids of the invention.

[0203] A nucleic acid of the invention can be administered in combination with a carrier or lipid to increase cell uptake. For example, the oligonucleotide can be administered in combination with a cationic lipid. Examples of cationic lipids include, but are not limited to, lipofectin, DOTMA, DOPe, and DOTAP. Publication of WO0071096 describes different formulations, such as a formulation of DOTAP: cholesterol or cholesterol derivatives that can be used effectively for gene therapy. Other descriptions also discuss different lipid or liposomal formulations, including nanoparticles and methods of administration; These include, but are not limited to, US Patent Publication.

20030203865, 20020150626, 20030032615 and 20040048787. Methods used to form particles are also described in US Patent Nos. 5,844,107, 5,877,302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972,900. Nucleic acids can also be administered in combination with a cationic amine such as poly-L-lysine.

[0204] Nucleic acids can also be conjugated to a chemical moiety, such as transferrin and cholesteryl. Furthermore, oligonucleotides can be targeted to certain organs or tissues by attaching specific chemical groups to the oligonucleotide. For example, binding of the oligonucleotide to a suitable matrix of mannose residues will direct the oligonucleotide to the liver. Other targeted ligands are described in Liu B., Brief Funct. Genomic Proteomic 6: 112-119, 2007. Additional examples are carbohydrate sugars such as galactose, N-acetylgalactosamine, mannose; vitamins such as folates; small molecules, including naproxen, ibuprofen, or other known protein-binding molecules, cyclodextrin, which targets the transferrin receptor, also called modified transfer cyclodextrin (Hu-Lieskovan et al., 2005), PEI (PEG- PEI targeting RGD, Schiffelers et al. 2004), anisamide, RGD peptide or RGD mimetics, polyarginine, single-chain anti-TfR / TfRscFv antibody fragment, annexin A5 (targeting membranes that expose phosphatidylserine, Garnier B. et al., Bioconjug Chem., 2009, 11: 2114-22), WO 2009/126933, which describes compositions and methods for site-specific administration of nucleic acids by combining them with targeted ligands and endosomolytic components. Targeted ligands that are preferably suitable are tumor-associated cell surface proteins, more preferably prostate tumor associated cell surface proteins. Nucleic acid targeting can also be performed using aptamer technology as described in WO2005 / 111238. Furthermore, additional lipid fractions, such as PEG lipids, cholesterol, endosomolytic auxiliary lipids or peptides (WO2009 / 046220) or the general morphology of the generated nanoparticles (characterized by the charge and particle size) with respect to the mentioned administration vehicles above they may confer targeting specificity to either cancer cells and / or the tumor vasculature.

[0205] Additionally, the molecules can be administered using an extended release system, such as semipermeable matrices of solid polymers containing the therapeutic agent. Several of the extended release materials have been established and are well known to those skilled in the art. Prolonged-release capsules can, depending on their chemical nature, release the molecules for a few weeks to more than 100 days. Depending on the chemical nature and biological stability of the chimeric molecules, additional strategies can be employed for the stabilization of the molecules.

[0206] Alternatively, the molecules can be administered using a coordination chemistry-based delivery system as described in WO2007011217.

[0207] Nucleic acids can be included in any of the formulations described above as free acids or bases or as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are those salts that substantially retain the biological activity of free bases and that are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous solvents and other protic solvents than are the corresponding free base forms.

[0208] The pharmaceutical compositions of the present invention comprise an effective amount of one or more miRNA molecules dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases "pharmaceutically or pharmacologically acceptable (s)" refer to molecular entities and compositions that do not or do not produce adverse, allergic or other acceptable adverse reactions when administered to an animal, such as, for example, a human, as appropriate . Whether certain adverse effects are acceptable is determined based on the severity of the disease. The preparation of a pharmaceutical composition containing at least one chimeric polypeptide or an additional active substance will be known to those skilled in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th ed. Mack Printing Company, 1990. In addition, for administration to animals (eg, humans), it will be understood that the preparations must meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biological Standards.

[0209] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (eg, antibacterial agents, antifungal agents), isotonic agents, retarding agents absorption, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrating agents, lubricants, sweetening agents, flavoring agents, colorants, similar materials, and combinations thereof, as would be known to one skilled in the art (see, for example, Remington's Pharmaceutical Sciences , 18th Ed. Mack Printing Company, 1990, pp. 1289-1329). Except insofar as any conventional carrier is incompatible with the active substance, its use in pharmaceutical or therapeutic compositions is contemplated.

[0210] miRNAs can comprise different types of carriers depending on whether they are to be administered in solid, liquid or aerosol form and whether they need to be sterile for such routes of administration as injection. The present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, rectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctivally, intravesicularly, mucosally, intrapericardially, via intraumbilical, intraocularly, orally, topically, locally, inhalation (eg, aerosol inhalation), injection, infusion, continuous infusion, localized infusion by bathing target cells directly, through a catheter, to through washing, in creams, in lipid compositions (for example, liposomes), or by another method or any combination of the above as a person skilled in the mat would know eria (see, for example, Remington's Pharmaceutical Sciences, 18th ed. Mack Printing Company, 1990).

[0211] The actual dosage amount of a composition of the present invention administered to an animal or a patient can be determined by physical and physiological factors such as body weight, severity of the condition, type of disease being treated , preceding or concurrent therapeutic interventions, the patient's idiopathy and the route of administration. The professional responsible for administration will determine, in any case, the concentration of the active substance (s) in a composition and the appropriate dose (s) for the individual subject.

[0212] In certain embodiments, the pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, an active compound may comprise from about 2% to about 75% by weight of the unit, or from about 25% to about 60%, for example, or from 2% to 75%. % of unit weight or 25% to 60%, for example, and any included drift ranges. In other non-limiting examples, a dose may also comprise less than 1 microgram / kg / body weight, or 1 microgram / kg / body weight, starting at 5 microgram / kg / body weight, 10 microgram / kg / body weight, 50 microgram / kg / body weight, 100 microgram / kg / body weight, 200 microgram / kg / body weight, 350 microgram / kg / body weight, 500 microgram / kg / body weight, 1 milligram / kg / body weight, 5 milligram / kg / body weight, 10 milligram / kg / body weight, 50 milligram / kg / body weight, 100 milligram / kg / body weight, 200 milligram / kg / body weight, 350 milligram / kg / body weight, or 500 milligram / kg / body weight, up to 1000 milligram / kg / body weight or more per administration, and any derivable range included. In non-limiting examples of a range derived from the numbers listed here, a range of 5 mg / kg / body weight to 100 mg / kg / body weight, from 5 microgram / kg / body weight to 500 milligram / kg / can be administered. body weight, etc., based on the numbers previously described.

[0213] In either case, the composition may comprise different antioxidants to delay the oxidation of one or more components. Additionally, prevention of the action of microorganisms can be accomplished by preservatives such as various antibacterial and antifungal agents, including, but not limited to, parabens (eg, methyl parabens, propyl parabens), chlorobutanol, phenol, sorbic acid, thimerosal, or combinations thereof.

[0214] The molecules can be formulated in a composition in the form of a free, neutral or saline base. Pharmaceutically acceptable salts include acid addition salts, for example, those formed with free amino groups of a proteinaceous composition or formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acids. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.

[0215] In embodiments where the composition is in a liquid form, a carrier may be a solvent or dispersion medium comprising, but not limited to, water, ethanol, polyol (eg, glycerol, propylene glycol, liquid polyethylene glycol , etc.), lipids (eg triglycerides, vegetable oils, liposomes) and combinations thereof. Proper fluidity can be maintained, for example, through the use of a coating, such as lecithin; by maintaining the required particle size by dispersion in carriers such as, for example, liquid polyol or lipids; through the use of surfactants such as, for example, hydroxypropylcellulose; or combinations derived from such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride, or combinations thereof.

[0216] In other embodiments, nasal drops, solutions or sprays, sprays or inhalants can be used in the present invention. Such compositions are generally designed to be compatible with the type of target tissue. In a non-limiting example, nasal solutions are normally aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in preferred embodiments, aqueous nasal solutions are typically isotonic or lightly buffered to maintain a pH of about 5.5 to about 6.5.

In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, appropriate drugs or drug stabilizers, may be included in the formulation if necessary. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.

In certain embodiments, the molecules are prepared for administration by routes such as oral ingestion. In these embodiments, the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (eg, hard or soft gelatin coated capsules), prolonged release formulations, oral compositions, lozenges, elixirs, suspensions, syrups, wafers or combinations thereof. Oral compositions can be incorporated directly into the diet food. Preferred carriers for oral administration comprise inert diluents, assimilable edible carriers, or combinations thereof. In other aspects of the invention, the oral composition can be prepared as a syrup or elixir. A syrup or elixir, and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a colorant, a preservative, or combinations thereof.

[0217] In certain preferred embodiments, an oral composition may comprise one or more binders, excipients, disintegrating agents, lubricants, flavoring agents, and combinations thereof. In certain embodiments, a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin, or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, saccharin sodium, cellulose, magnesium carbonate, or combinations thereof; a disintegrating agent, such as, for example, cornstarch, potato starch, alginic acid, or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin, or combinations thereof; a flavoring agent, such as, for example, mint, wintergreen oil, cherry flavoring, orange flavoring, etc. or combinations of the aforementioned. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For example, tablets, pills, or capsules can be coated with shellac, sugar, or both.

[0218] The composition must be stable under production and storage conditions and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be minimally maintained at a safe level, eg, less than 0.5 ng / mg protein.

[0219] In particular embodiments, prolonged absorption of an injectable composition can be accomplished through the use in the compositions of agents that delay absorption, such as, for example, aluminum monostearate, gelatin, or combinations thereof. .

[0220] Any of the above-mentioned embodiments with respect to administration or transport to cells can also be employed with respect to implementation of administration of medicinal compounds discussed in this section.

Effective dosages

[0221] The molecules of the invention will generally be used in an amount effective to achieve the intended purpose. For use to treat or prevent disease, the molecules of the invention, or the pharmaceutical compositions thereof, are administered or applied in a therapeutically effective amount. A therapeutically effective amount is an amount effective to improve or prevent symptoms or prolong survival of the patient being treated. Determination of a therapeutically effective amount is within the capabilities of those skilled in the art, especially in light of the detailed description provided herein.

[0222] For systemic administration, a therapeutically effective dose can be estimated initially from in vitro tests. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the EC50 determined in cell culture. Such information can be used to determine useful human doses more precisely.

[0223] Initial dosages can also be estimated from in vivo data, eg, animal models, using techniques well known in the art. A person skilled in the art could easily optimize administration to humans based on animal data.

[0224] The dosage amount and interval can be individually adjusted to provide plasma levels of the molecules that are sufficient to maintain the therapeutic effect. Usual patient dosages for administration by injection range from 0.01 to 0.1 mg / kg / day or 0.1 to 5 mg / kg / day, preferably 0.5 to 1 mg / kg / day or plus. Therapeutically effective serum levels can be achieved by administering multiple doses each day.

[0225] In cases of local administration or selective uptake, the effective local concentration of proteins may not be related to plasma concentration. A person skilled in the art will be able to optimize therapeutically effective local dosages without undue experimentation.

[0226] The amount of molecules administered will, of course, be dependent on the subject being treated, the subject's weight, the severity of the condition, the manner of administration, and the decision of the prescribing physician.

[0227] Therapy can be repeated intermittently while symptoms are detectable or even when they are not detectable. The therapy can be provided alone or in combination with other drugs or treatment (including surgery).

Toxicity

[0228] Preferably, a therapeutically effective dose of the molecules described herein will provide a therapeutic benefit without causing substantial toxicity. The toxicity of the molecules described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, by determining the LD50 (the lethal dose for 50% of the population) or the LD100 (the lethal dose for the 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. Proteins showing high therapeutic indices are preferred. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is non-toxic for use in humans. The dosage of the proteins described herein is preferably within a range of circulating concentrations that includes the effective dose with little or no toxicity. The dosage may vary within this range depending on the dosage form used and the route of administration used. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, for example, Fingl et al, 1975, in: The Pharmacological Basis of Therapeutics, Ch.l, p.l).

Hanging groups

[0229] A "pendant group" can be attached or conjugated to the nucleic acid. Hanging groups can increase cellular uptake of nucleic acid. Hanging groups can be attached to any portion of the nucleic acid, but are commonly attached to the end or ends of the oligonucleotide chain. Examples of pendant groups include, but are not limited to: acridine derivatives (ie, 2-methoxy-6-chloro-9-aminoacridine); crosslinking agents such as psoralen, azidofenacil, proflavin and azidoproflavin derivatives; artificial endonucleases; metal complexes such as EDTA-Fe (II), o-phenanthroline-Cu (I) and porphyrin-Fe (II); alkylating fractions; nucleases such as staphylococcal amino-1-hexanol nuclease and alkaline phosphatase; terminal transferases; abzymes; cholesteryl fractions; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; Not me; mercapto groups; radioactive labels; non-radioactive labels such as dyes; and polylysine or other polyamines. In one example, the nucleic acid is conjugated to a carbohydrate, sulfated carbohydrate, or glycan.

Sequence identity

[0230] "Sequence identity" is defined herein as a relationship between two or more nucleic acid sequences (nucleotide, polynucleotide, RNA, DNA), as determined by sequence comparison. In the art, "identity" also means the degree of sequence relationship between nucleic acid sequences, as the case may be, as determined by the match between the chains of such sequences.

[0231] In a preferred embodiment, identity also means percent identity and can be calculated by the number of equal nucleotides between the subject sequence and the test sequence, divided by the total length of the test sequence and multiplied by 100 .

[0232] "Identity" and "similarity" can be easily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M. and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H. and Lipman, D., SIa M J. Applied Math., 48: 1073 (1988).

[0233] Preferred methods for determining identity are designed to provide the largest match between the sequences evaluated. The methods for determining identity and similarity are coded in publicly available computer programs. Preferred software methods for determining identity and similarity between two sequences include, for example, the GCG program package (Devereux, J. et al., Nucleic Acids Research 12 (1): 387 (1984)), BestFit , BLASTP, BLASTN and FASTA (Altschul, SF et al., J. Mol. Biol. 215: 403-410 (1990). The BLa St X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, MD 20894; Altschul, S. et al., J. Mol. Biol.

215: 403-410 (1990). The well-known Smith Waterman algorithm can also be used to determine identity.

[0234] Preferred parameters for nucleic acid comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970); Comparison matrix: matches = 10; discrepancy = 0; space penalty: 50; gap length penalty: 3. Available as the Gap program from the Genetics Computer Group, located in Madison, Wis. The default parameters for nucleic acid comparisons are given above.

[0235] In this document and in its claims, the verb "to comprise" and its conjugations are used in their non-limiting sense to mean that the articles that follow the word are included, but the articles not specifically mentioned are not excluded. Furthermore, the verb "consist" may be replaced by "consist essentially of" with the meaning that a miRNA molecule, an equivalent or a source thereof, or a composition as defined herein may comprise component (s ) additional to those specifically identified, where said additional component (s) do not alter the unique feature of the invention. Furthermore, the reference to an element by the indefinite article "one" or "one" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. Therefore, the indefinite article "a" or "a" normally means "at least one".

Description of the figures

[0236]

Figure 1. Flow diagram of the screening protocol for TEM inversion and overview of the results obtained from one of the plates of the lentivirus-based microRNA expression library (ITM0081-0160). A, Lentivirus stock (1.0 ul; MOI = 3 to 300) was added to TSUpr1-pEcad-Luc cells for 24 hours. Two days after infection (day 4), selection was applied with puromycin and, six days after infection (day 8), luciferase activity was measured. B, Background corrected lucilla / Renilla luciferase ratios were set against lentiviral MOI. The four miRs with signals significantly above the background (FLuc / RLuc ratio> mean 2 x standard deviation) are surrounded. The four control values represent FLuc / RLuc ratios induced by miR-141 and miR-200c, which were supplied in separate tubes (both in duplicate).

Figure 2: Overview of the expression vector pEcad-Luc / Rluc. The CDH1 gene promoter (GenBank L34545, position -294 to 44), which contains all three E boxes, was obtained by PCR amplification using human genomic DNA as a template. The CDH1 promoter fragment was cloned upstream of the firefly luciferase gene in vector pGL2-basic (Promega). The Renilla luciferase cassette driven by an HSV-Tk promoter was obtained from the vector pRL-TK (Promega) and the zeocin antibiotic resistance cassette driven by an SV40 promoter from the vector pVgRXR (Invitrogen). Renilla luciferase and Zeocina® cassettes were cloned into the pGL2-basic vector at the indicated locations.

Figure 3: Characterization of models of tumor cell lines. Total RNA was isolated from cultures of confluent cell lines at 70-80% and the expression of CDH1 and vimentin was analyzed by qPCR. Relative expression values were plotted, and cells with high CDH1 / low VIM and low CDH1 / high VIM were designated epithelial and mesenchymal, respectively.

Figure 4: TME induction using synthetic miRNA mimetics. A, TSUpr1-pEcad-Luc cells were transiently transfected with 20 to 60 nM of synthetic miR mimetics (Ambion or Dharmacon; see Table 7 for details). Four days after transfection, Luc and RLuc activity were measured, and the Luc / RLuc ratios were normalized with respect to cells transfected with the negative control (NC). B, Cells were transfected and treated as described in Figure 4A. Total RNA was isolated and used for qPCR analysis of miRNA and genes. Expression levels of CDH1 and CDH2 are shown, normalized with respect to the constitutive gene HPRT, as a percentage of cells transfected with the NC. C, Different parental tumor cell lines were transfected with miR-200c and miR-520f mimetics and other miR mimetics and CDH1 expression was analyzed (as described in Fig. 4B).

Figure 5: Creation of doxycycline inducible miRNA expression systems. A, miR-200c and miR-520f precursors were isolated from the integrated provirus in TSUpr1 cells infected with pCDH-lentivirus (in miR screening experiments) by restriction enzyme digestion. MiR precursors were cloned into the NheI / EagI sites of the inducible miR expression vector pmRi-ZsGreen1 (Clontech PT5049-1). The miR-520f expression vector map is shown. B, PC3 cells (ATCC # CRL-1435) were transfected with the pTet-on-advanced vector (Clontech PT3899-5), and selected in medium with G418 (300 ug / ml). Cells were transiently transfected with pTRE-Luc reporter vector, treated with 0, 0.1, and 1.0 ug / ml doxycycline (DOX, Sigma D9891) for 2 days, and then Luc activation was analyzed. C, PC3-Tet-on cells (clone 8) were then transfected with the pmRi-ZsGreen1-miR-200c or miR-520f vector and selected in medium with puromycin (5 ug / ml). MiRNA induction and gene expression in stable PC3-mRi-ZsGreen-miR-X clones were evaluated. Cells were treated with 0 and 1.0 ug / ml DOX for 4 days, total RNA was isolated and miRNA and gene expression were analyzed by qPCR (Table 8).

Figure 6: influence of miRNAs on tumor cell invasion. A, fifty thousand (PC3) or forty thousand (TSUpr1) cells were seeded in Biocoat Matrigel Invasion chambers, 8 microns (BD 354480), in medium without serum. The invasion chamber was placed in a well of 24 containing medium with 10% fetal calf serum as a chemoattractant. As a control, the same number of cells were plated onto the surface of a 24-well culture plate. After 48 hours of incubation, the cells in the invasion chamber were removed by aspiration and cleaning the internal compartment with a swab. The invasion chamber was then placed in CellTiter-GLO cell viability reagent (CTG, Promega-G7571) and incubated for 15 minutes. CTG activity was measured on a Victor3 luminometer. B, Cell invasion assays were performed with PC3-mRi-ZsGreen1-miR-X cells that were pretreated for 2 days with 1 ug / ml DOX. In addition, PC3 cells infected with the miR-200c and miR-520f lentiviruses (MOI = 30) and selected in puromycin for 4 days were used. The percent cell invasion was calculated as the CTG activity at the bottom of the membrane divided by the total CTG activity (from cells grown on the surface of a 24-well culture plate). Inhibition of cell invasion by a specific miRNA was calculated by dividing the percentage of cell invasion against untreated (-DOX) or control (empty vector virus) cells. C, Relative levels of microRNA expression in parallel cultures were determined by hairpin RT-qPCR. D, Cell invasion assays were performed with TSUpr-pEcad cells that were infected with lentivirus (MOI = 30) with empty vector, miR-124-1 precursor, miR-181a-1, miR-200c, miR-206, miR -518b, miR-520f or miR-524, and selected on puromycin for 4 days. Cell invasion was calculated as described in Figure 6B.

Examples

Example 1

Material and methods

Generation of the miRNAs encoding the lentiviral library

[0237] Human miRNAs were selected both from the public miRNA repository (www.mirbase.org) and from proprietary small RNA deep sequencing data (see WO 2007/081204). The miRNA sequences were amplified from their genomic location with amplicons containing the full length pre-miRNA hairpin and a flanking sequence on both sides of 50-150 base pairs. Primers for amplicons were designed using Primer3 software (www.geneious.com). If the primer design program could not find appropriate primers on the designated sequences, the requirements for the flanking sequences were adjusted to 0-200 base pairs. The designed primers were supplemented with a 5 'GCGC overhang and a restriction site for directional cloning. By default, the primer upstream of the miRNA was supplemented with a BamHI restriction site (GGATCC) and the primer downstream of the miRNA was supplemented with an EcoRI restriction site (GAATTC). Amplicon primers with internal BamHI or EcoRI restriction sites (i.e., occurring in the genomic sequence) were supplemented with either a BglII site (AGATCT) or an XbaI site (TCTAGA), respectively. MiRNAs were amplified using the above mentioned primers from human genomic DNA from a single individual in the following PCR reaction:

constituent concentration supplier volume / cat. no.

10X 1 pl buffer Stratagene / 600159

dNTP 10 mM each 0.2 pl GE Healthcare / 27-18 (5-8) 0-04

primer dir. 10 uM 0.2 pl IDT (Integrated DNA Technologies) primer inv. 10 uM 0.2 pl ""

GDNA 100 ng / uL 0.1 pl private source

DNA pol. Pfu 2.5 U / uL 0.1 pl Stratagene / 600159

H2O N / A 8.2 pl N / A

temp (° C) cycle time

95 2 min

95 15 s 40

59 * 15s 40 * -0.1 ° C / cycle

72 90 s 40

72 15 min

4 co

[0238] All miRNA loci were amplified in separate 10 pl PCR reactions. Products were purified using the Qiagen PCR Clean-Up Buffer Set and Whatman Unifilter GF / C Filter Plates (Cat # 7700-1101). DNA was eluted with 17 pl H ² O per well. The separated eluates were used in the following restriction reaction:

constituent concentration supplier volume / cat. no.

buffer E 10X 2 pl Promega / R005A

EcoRI * 12 U / pl 0.1 pl Promega / R6017

BamHI * 10 U / pl 0.1 pl Promega / R6025

eluate N / A 16 pl N / A

H2O N / A 1.8 pl N / A

* Amplicons with internal restriction sites for EcoRI or BamHI were cut in place with Xbal or BglII, respectively. The EcoRI + BglII reaction was performed with Promega D buffer. The BamHI + XbaI reaction was performed with Promega E buffer.

[0239] Restriction for 2 hours at 37 ° C. The separated 20 pl restriction reactions were purified using the Qiagen PCR Clean-Up buffer set and Whatman Unifilter GF / C filter plates (cat # 7700-1101). DNA was eluted with 20 µl H ² O per well. The separated eluates were used in the following ligation reaction:

constituent concentration supplier volume / cat. no.

10X 2 pl buffer Promega / C1263

T4 DNA ligase 1-3 U / pl 0.2 pl Promega / M1804

restricted pCDH * 1 ng / pl 7.8 pl System Biosciences / CD510B-1 eluate N / A 10 pl N / A

Ligation overnight at 4 ° C.

* For directional cloning, pCDH was cut with both EcoRI and BamHI. An alternative construct called pCDH- was prepared with inverted EcoRI and BamHI restriction sites so that amplicons with BamHI 5'and EcoRI 3 'were cloned in the appropriate direction. Amplicons with an internal EcoRI site were cut with XbaI and ligated into a pCDH vector that was restricted with XbaI and BamHI.

[0240] The resulting ligands were separately transformed into bacteria (Promega Single Step (KRX) competent cells, cat. No. L3002). 50 µl of competent cells were diluted with 950 µl of Transformation Buffer II (10mM MOPS, 75mM CaCl ^2, 10mM RbCl, 15% glycerol, filter sterilized). For 20 µl of ligation, 20 µl of diluted competent cells were added. The mixture was incubated for 15 minutes on ice, heat shocked at 37 ° C for 30 seconds and placed back on ice. After 2 minutes, the transformed bacteria were reconstituted in 150 µl of lysogeny broth (LB). Bacteria were allowed to recover for 20 minutes at 37 ° C after which they were plated separately on LB-agar plates containing ampicillin (50 ug / ml) and cultured overnight at 37 ° C.

[0241] Individual colonies from each plate are picked and subcultured overnight in 400 µl of LB with ampicillin (50 ug / ml). 1 pl of subculture is lysed in 100 pl of water for sequencing purposes. The bacterial lysate is used in the following PCR reaction:

constituent concentration supplier volume / cat. no.

buffer 5X 1 pl private source

dNTP 10 mM each 0.1 pl GE Healthcare / 27-18 (5-8) 0-04

pCDH-dir 10 uM 0.1 pl IDT (Integrated DNA Technologies)

pCDH-inv 10 uM _0.1 pl ""

lysate 1: 100 1 pl N / A

Taq DNA pol unknown 0.02 pl private source

H ² ON / A 2.68 pl N / A

temp (° C) cycle time

95 2 min

95 15 s 40

59 * 15s 40 * -0.1 ° C / cycle

72 90 s 40

72 15 min

4 © or

pCDH-dir CACGCT GTTTT GACCTCCAT AGA

pCDH-inv CACTGACGGGCACCGGAG

(SEQ ID NO: 84-85)

[0242] PCR products were diluted 25X. 1 pl of diluted PCR product was used in the following Sanger sequencing reaction:

constituent concentration supplier volume / cat. no.

buffer N / A 1.9 pl private source

BigDye v3.1 N / A 0.1 pl A B I / 4336921

pCDH-seq 10 uM 0.1 pl IDT (Integrated DNA Technologies)

PCR product 1:25 1 pl N / A

H2O N / A 1.9 nl N / A

temp (° C) cycle time

94 10 s

50 5 s 40

60 2 min 40

10 o

pCDH-seq GACCTCCATAGAAGATTCT AGAGCT AGC

(SEQ ID NO: 86)

[0243] 30 u of precipitation mixture (80% ethanol, 50 mM sodium acetate pH 5.5) was added to each of the sequencing reaction products. The mixtures were vortexed for 10 seconds and They centrifuged at 5000 rcf for 45 minutes at 4 ° C. The supernatant was aspirated and the DNA pellets were washed with 30 µl of ice-cold 80% ethanol and centrifuged at 5000 rcf for 5 min at 4 ° C. The supernatant was aspirated and the DNA pellet was dried on a heat block for 10 minutes. The dry DNA pellet was dissolved in 10 µl of H ² O. The resulting DNA solution was sequenced on an ABI 3730XL DNA Analyzer. The sequences were compared with the expected genomic sequences. The correct clones were added to the library. For the incorrect clones, 4 additional bacterial colonies were chosen and the insert sequence was analyzed.

[0244] Library constructs were subcultured overnight in 50 ml of LB with ampicillin (100 ug / ml) and isolated with the Qiagen QIAfilter Plasmid Midi Kit (cat # 12245) supplemented with the Qiagen EndoFree Plasmid Buffer Set (Cat. No. 19048) per manufacturer's instructions. The DNA was dissolved in the supplied TE buffer and brought to a final concentration of 500 ng / pl.

[0245] We ordered constructs that we were not able to clone ourselves as minigenes from Integrated DNA Technologies. In these cases, the full length hairpin plus 20 flanking base pairs from each site were cloned into our vector as a service by IDT.

[0246] Packaging and virus production was performed by System Biosciences as described in the CD-500B1-CD523-A1 user manual.

Cell culture

[0247] The TSUprl / pEcad-luc / Rluc cell line was generated by stable transfection of the human transitional cell bladder carcinoma cell line TSUpr1 with the expression vector pEcad-Luc / Rluc (Figure 2). A single zeocin resistant clone (clone 1.c.4) was used for all experiments.

[0248] TSUprl / pEcad-luc / Rluc cells were maintained in RPMI-1640 medium (Invitrogen, 31870) supplemented with 10% fetal bovine serum (Sigma, F7524), L-glutamine (Invitrogen 25030-024) and 50 pg / ml zeocin (Invitrogen, R250-01). The cells were kept in a humidified atmosphere at 37 ° C and 5% CO ² . Cells were divided once a week in a 1:20 ratio.

Chemical products

[0249] Polybrene (2 pg / ml; Sigma, H9268) was used to increase the efficiency of infection with the lentiviral particles encoding miRNA. Puromycin (5 pg / ml; Sigma, P8833) was used to select cells expressing the miRNA of interest. Zeocin (50 pg / ml; Invitrogen, R250-01) was used to maintain integration and expression of the Ecad-luc / Rluc transgene.

TME screening protocol:

Day 1: cell seeding

[0250] TSUprl / pEcad-luc / Rluc cells were seeded at a density of 2,500 cells per well in 96-well plates (100 µl total volume per well), in duplicate.

Day 2: lentiviral infection

[0251] Packaged lentiviral constructs were provided as frozen VSV-G pseudotyped viral particles and stored at -80 ° C. Before use, the contents were thawed at room temperature and placed on ice immediately thereafter. A SepraSeal Cap Removal Tool (Fisher Scientific Cat. No .: 50823908) was used to open the tubes and the precipitates were resuspended by pipetting several times. The medium was removed using a multichannel pipette. Gently, 200 µl of fresh medium (+ FBS / glutamine / zeocin) with 2 pg / ml polybrene (Sigma, H9268) was added to the cells. Next, 1.0 µl of undiluted lentiviral particles was added to each well (in duplicate). In each 96-well plate, lentiviral particles encoding miR-141 and miR-200c were added as positive controls.

Day 3: refresh the medium

[0252] Twenty-four hours after the addition of lentivirus, the medium was removed using a multi-channel pipette. Cells were washed once with 0.9% NaCl, 50 µl per well. Subsequently, 100 µl of fresh medium (+ FBS / glutamine / zeocin) was added to each well.

Day 4: selection with puromycin

[0253] The medium was removed using a multichannel pipette. To select the transduced cells, 200 µl of fresh medium with 5 pg / ml puromycin (Sigma, P8833) was added to the cells. Note that the cells did not wash in between.

Day 8: double-luciferase indicator assay (Promega)

[0254] The medium was removed using a multichannel pipette. The cells were then gently washed with 0.9% NaCl (50 µl / well). To prepare cell lysates, Passive Lysis Buffer 1x buffer (Promega, E1980) was added to the cells (20 µl per well) and incubated at room temperature for 20 minutes on a plate shaker. Cell lysates were transferred to 96-well white microtiter plates (Thermo Scientific, 9502887). The activity of the firefly and Renilla luciferases was measured in a Victor3 Multilabel Counter (PerkinElmer), according to the manufacturer's instructions.

Isolation of total RNA

[0255] TSUprl / pEcad-luc / Rluc cells were seeded at a density of 15,000 cells per well in 24-well plates. Lentiviral infection was performed as previously described. Due to the limited number of viral particles, the virus was added with a multiplicity of infection (MOI) of 30, and when possible an MOI of 100. On day 8, total RNA was isolated using the Trizol reagent (200 pl per well) according to the manufacturer's instructions (Invitrogen, 15596-018). The concentration and purity of a Rn was determined on a Nanodrop-1000 spectrophotometer (Thermo Scientific).

RT-PCR in real time

[0256] Two micrograms of total RNA were treated with DNase-I (Invitrogen, 18068-015) and cDNA was synthesized using random hexameric primers and SuperScript II-MMLV reverse transcriptase (Invitrogen, 18064-014). The RT reaction (30 pl) was diluted 4 times in H ² O.

[0257] Gene expression was determined by qPCR SYBR Green, using the SYBR Green PCR mix (Roche, 04707516001) and 2 pl of cDNA as a template. RNA not subjected to reverse transcriptase was used as a negative control for PCR amplification. The gene specific primers are as follows:

E-cadherin direct1 5'-GAAAAGAGAGT GGAAGT G-3 '

inverse1 5'-GT GAAGGGAGAT GT ATT G-3 '

E-cadherin direct2 5'-CAGGTCTCCTCTTGGCTCTG-3 '

inverse2 5'-ACTTTGAATCGGGTGTCGAG-3 '

Direct N-cadherin 5'-GAGGATTAGCCGGAACAACA-3 '

inverse 5'-AACAAATTTCCCCCATCTCC-3 '

SNAIL direct 5'-AGGATCTCCAGGCTCGAAAG-3 '

Inverse 5'-GACATCTGAGTGGGTCTGGA-3 '

SLUG direct 5'-TTCGGACCCACACATTACCT-3 '

Inverse 5'-TTGGAGCAGTTTTTGCACTG-3 '

ZEB1 direct 5'-AT GCGGAAGACAGAAAAT GG-3 '

inverse 5'-GTCACGTTCTTCCGCTTCTC-3 '

ZEB2 direct 5'-CGCTTGACATCACTGAAGGA-3 '

inverse 5'-CTTGCCACACTCTGTGCATT-3 '

Direct P2M 5'-AGCAGAGAATGGAAAGTCAAA-3 '

inverse 5'-TGCTGCTTACATGTCTCG-3 '

(SEQ ID NO: 48-63).

[0258] q-PCR was performed on a LightCycler LC480 instrument (Roche), using the following amplification conditions: 5 min at 95 ° C, followed by 45 cycles of 10 s at 95 ° C, 20 s at 60 ° C, 20 s at 72 ° C. For the E-cadherin 1 primer set, a hybridization temperature of 49 ° C (instead of 60 ° C) was used. The Cp values are determined using LightCycler 480 SW 1.5 software (Roche). Beta-2-microglobulin expression was used for normalization. Relative levels of gene expression were calculated according to the model described by Pfaffl (18).

Fork RT-PCR

[0259] MicroRNA expression was determined by hairpin RT-PCR as described (19). For this, 100 ng of total RNA was backtranscribed using 0.375 pmol of miR-specific hairpin primers (SL):

miR-141:

5 ’-G TC G TA TC C A G TG C A G G G TC C G A G G TA TTC G C A C TG G A TA C G A C

CCATCT-y

miR-200c:

5’-G TC G TATC C AG TG C AG G G TC C G AG G TATTC G C AC TG G ATAC G AC

TCCATC-V

miR-181a-1:

5 ’-GT CGT ATCCAGT GC AGGGTCCG AGGT ATTCGC ACT GG A T ACG AC A

CTCAC-3 ’

miR-124 *:

5 ’-GTCGT ATC C AG T GC AGGGT CCG AGGT A TT CGC AC T G G A T ACG AC

G G CATT-3 ’

miR-518b:

5 GT CGT ATCCAGT GC AGGGTCCG AGGT ATT CGC ACTGG AT ACG ACA

CCTCT-3 ’

miR-520f:

5 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC

AACCCT-3 ’

miR-524-5p:

5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC

GAGAAA-3 ’

miR-524-3p:

5 GTCGTATCCAGTGC AGGGTCCG AGGT ATTCGCACTGG ATACG AC

ACTCCA-3 ’

(SEQ ID NO: 64-71)

[0260] in RT 1x buffer, with 0.25 mM dNTP, 3.33 U /> pl SuperScript II-MMLV reverse transcriptase (invitrogen) and 0.25 U / pl HRP-I RNase Inhibitor (Amersham), for 30 min at 16 ° C, 30 min at 42 ° C and 5 min at 85 ° C. The fork RT products were diluted 2 times in H ² O.

[0261] MicroRNA expression was determined by qPCR SYBR Green, using the PCR mixture (0.5 µl forward primer (25 pmol / µl), 0.5 µl reverse primer (25 pmol / µl), 8 µl of H ² O, 10 pl of PCR mixture SYBR Green 2x, Roche) and 2 pl of hairpin RT product as template. RNA not subjected to RT SL was used as a negative control for PCR amplification. The specific miR primers are as follows:

Direct Primers:

miR-141: 5'-GCCCGCTAACACTGTCTGGTAAAG -3 '

miR-200c: 5'-GCCCGCTAATACTGCCGGGTAATG -3 '

miR-181a-1: 5'-TGCCAGAACATTCAACGCTGTCG-3 '

miR-124 *: 5'-TGCCAGTAAGGCACGCGGTGA-3 '

miR-518b: 5'-TGCCAGCAAAGCGCTCCCCTTTAG-3 '

miR-520f: 5'- GCCCGCAAGTGCTTCCTTTTAGAG-3 '

miR-524-5p: 5'- GCCCGCCTACAAAGGGAAGCACT-3 '

miR-524-3p: 5'-TGCCAGGAAGGCGCTTCCCTTTG-3 '

[0262] A universal reverse primer was used: 5'-GTGCAGGGTCCGAGGT-3 '(SEQ ID NO: 72-80)

[0263] q-PCR was performed on a LightCycler LC480 instrument (Roche), using the following amplification conditions: 5 min at 95 ° C, followed by 45 cycles of 10 s at 95 ° C, 20 s at 60 ° C, 10 s at 72 ° C. Cp values were determined using LightCycler 480 SW 1.5 software (Roche). Expression of U6 siRNA (RNA6-1) was used for normalization (U6 primers (RNU6-1): RT 5'-GTCa Tc CTTGCGCAg G-3 'U6 forward 5'-CGCTTCGGCAGCACATATAC-3' and reverse U6 5'- AGGGGCCATGCTAATCTTCT-3 '(SEQ ID NO: 81-83) Relative levels of miR expression were calculated according to the model described by Pfaffl (18).

DNA sequence analysis

[0264] The sequence of the miRNAs cloned into the lentiviral vectors for matches as described in Table 1 was verified as follows. Total nucleic acids from lentiviral transduced cells were isolated using Trizol reagent, according to the manufacturer's instructions (Invitrogen, 15596-018). Nucleic acid concentration and purity were determined on a Nanodrop-1000 spectrophotometer (Thermo Scientific). Proviral DNA was amplified by PCR, using 500 ng of nucleic acids as input and specific primers of the lentiviral vector pCDH (direct: 5'-CACGCTGTTTTGACCTCCATAGA-3 ', inverse: 5'-CACTGACGGGCACCGGAG-3', (SEQ ID NO: 84 -85)) for 35 cycles at a hybridization temperature of 65 ° C. Amplified products were purified using the Dn Wizard PCR preps purification system (Promega). DNA sequence analysis was performed using 2 pl of purified amplicon, 5 pmole of pCDH-specific primer (5'-GACCTCCATAGAAGATTCTAGAGCTAGC-3 ', (SEQ ID NO: 86)) and the Big Dye Terminator v 1.1 kit (Applied Biosystems ). The products were analyzed in a 3730 DNA Analyzers (Applied Biosystems). Data was collected using Collection Software v3.0 and analyzed using Sequencing Analysis v5.3.1 (Applied Biosystems). The sequence for all cloned miRNAs was correct and is given in Table 4.

Results

Mesenchymal-epithelial transition (TME) microRNA screening

[0265] TEM in tumor cells results from transcriptional reprogramming of the cell. In particular, transcriptional repression of the E-cadherin gene promoter (CDH1) has been shown to trigger the TEM phenotype. The E-cadherin protein is one of the most important cadherin molecules for mediating cell-cell contacts in epithelial cells / tissues. CDH1 is repressed by the binding of transcriptional repressors, SNAI1, SNAI2, TCF3, TW iSt, ZEB1 or ZEB2 (20-23), to three so-called E boxes in the proximal promoter region of CDH1 (24-26). Inhibition of the binding of these repressors to the CDH1 promoter can reverse TEM, also called mesenchymal-epithelial transition (TME), and inhibit tumor cell invasion and tumor progression in animal models (27). We hypothesized that an extensive set of microRNAs is capable of inducing TME, targeting one of the transcriptional repressors associated with TEM. Suppression of TEM-associated transcriptional repressors will result in reactivation of CDH1 gene expression. This CDH1 reactivation can be easily controlled by activating targeted firefly luciferase by the CDH1 promoter. Therefore, we cloned the core element of the CDH1 gene promoter, which contains all three E boxes (24; 25), into an expression vector to direct the expression of firefly luciferase. As an internal control, a Renilla luciferase cassette driven by an HSV-Tk promoter was inserted into the same vector (pEcad-Luc). We have stably transfected the TSUpr1 bladder cancer cell line with this indicator construct. Expression of endogenous CDH1 mRNA in this cell line is undetectable, while several mesenchymal markers are expressed (24; 28).

MicroRNA-induced TME screening: CONFIGURATION

[0266] TSUpr1-pEcad-Luc cells are susceptible to puromycin selection. As a first step in configuring the screening model, we determined the transduction efficiency of TSU cells. TSU cells were infected with a lentivirus that expresses eGFP with different MOIs, and the transduced cells were selected in medium with puromycin. The number of infected cells, and therefore resistant to puromycin, was determined by an MTT cell survival assay. In two independent experiments, we have shown that with an MOI of 8, a transduction efficiency (infected cell MTT + pure / infected cell-pure MTT x 100%) of at least 60% could be achieved. Based on these results, we decided to carry out the pilot infection experiments with an MOI of 3 and 30.

[0267] Recently, the miR-200 and miR-205 family have been shown to regulate TEM by targeting ZEB1 and ZEB2 (13-15). Two miRNAs from the miR-200 family, miR-141 and miR-200c, were selected to configure and optimize our TME detection assay. TSU cells were infected with both miRNA vectors (m O i = 30). Two (day 4) and six (day 8) days after infection, the activity of firefly luciferase directed by an E-cadherin promoter was measured and normalized against the activity of Renilla luciferase controlled by HSV- Tk. On day 8, the FLuc / RLuc ratio was induced more than 2 times by miR-200c, and more than 1.5-times by miR-141 (Figure 1; Table 1). To reduce the 'noise' of uninfected cells (FLuc- and RLuc +), a puromycin selection was applied. The ratios of FLuc / RLuc induced by miR-141 and miR-200c were comparable to those without selection.

[0268] TSU cells were infected with 0.2 microliter of undiluted miR-lentivirus. Two days after infection, a selection with puromycin was applied for 4 days. Luciferase activities were measured six days after infection. The result of the screening of the first 80 microRNAs is shown in figure 1. The four positive 'matches' (FLuc / RLuc> mean 2 x De) were microRNAs known to regulate TEM, that is, miR-141, miR-200c , miR-205 and miR-429. This pilot experiment indicated the validity of the selection system.

Screening for microRNA-induced TME

[0269] Several lentiviral constructs in the miR library have very high titles. Therefore, without dilution of virus stocks prior to infection, high virus MOIs were applied in some cases. The addition of the miR-141 and miR-200c lentiviruses with a high MOI (from 100 to 600) did not have a significant toxicity, while the induction of the FLuc / RLuc ratio slightly improved. Therefore, the entire lentivirus-based microRNA expression library was screened using one microliter of undiluted lentivirus (all in duplicate). After screening the 1120 miR (14 plates, each with 80 miR vectors), 65 positive 'matches' were found (FLuc / RLuc> mean 2 x De). In addition to these 65 miR, an additional 59 miR were selected based on, for example, an increased Luc signal with an increased RLuc signal, leaving the ratio below the threshold. These 124 miR were re-screened in the TSUpr1-pEcad-luc model, after which 30 miR remained with a reproducible positive FLuc / RLuc ratio (26 out of 30 of the group of 65 'matches').

Preliminary validation of TME microRNAs

[0270] To further validate and select relevant miRs for TEM / TME regulation, we studied its effects on endogenous gene expression, ie CDH1 (E-cadherin), CDH2 (N-cadherin), SNAI1 (SNAIL), SNAI2 ( SLUG), ZEB1 (deltaEF1) and ZEB2 (SIP1). TSUpr1-pEcad-luc cells were infected with the 30 miR identified by TME screening (MOI = 30 and 100). Six days after infection, total RNA was isolated and used for qPCR analysis of the aforementioned genes (Table 1). The expected up-regulation of c DH1 (E-cadherin) expression was observed with only a few miRs (n = 10), as was the down-regulation of CDH2 (N-cadherin) expression (n = 8 ). Of those miRs, miR-181a-1, miR-200a, mir-429, and miR-524 resulted in both CDH1 upregulation and CDH2 downregulation. The kinetics of cadherin expression by miR associated with TEM is cadherin dependent. This may explain the inconsistent up and down regulation of both cadherins, at the chosen time point (6 days after the introduction of a miR). The hallmark of TEM or otherwise, TME, is cadherin switching. Therefore, the (relative) ratio of CDH1 / CDH2 expression was used as a measure to study the role of the identified miRs in regulation of TEM. As shown in Table 1, ten miRs (out of 12) have an increased CDH1 / CDH2 ratio (range: 1.85-17.65). The other two miRs induced expression of CDH1 significantly (in line with FLuc induction), but these miRs also substantially (> 2-fold) induced CDH2 expression. Of the 12 miRs that induced endogenous CDH1 expression or induced cadherin switching, all also down-regulated at least one transcriptional repressor of CDH1 at the RNA level.

Conclusions

[0271] In the set of 12 selected miRs, the known TEM-associated miRs (miR-200 and miR-205 family) are present, confirming the specificity of our system. Of the remaining 9 miRs, three miRs (miR-518b, miR-520f and miR-524) belong to the human miR-515 family. In this study, members of the miR-200 family generally down-regulated ZEB2 expression, which was associated with down-regulation of CDH2 expression (on day 8). On the other hand, miR-515 family members generally down-regulated SNAI2 expression, which was associated with up-regulation of CDH1 expression. These remarkable differences may underlie two different mechanisms of TEM regulation by members of the miR-200 and miR-515 family. The expression and function of the 3 members of the miR-515 family has not been studied and reported in publicly available databases and, therefore, provides a first understanding of the role of these miRs in t Em.

Example 2

Materials and methods

Cell culture

[0272] TSUprl / pEcad-luc / Rluc cells (also known as TSUpr1 -pEcad) and PC-3 prostate cancer cell line (ATCC # CRL-1435) were maintained in RPMI-1640 medium (Invitrogen, 31870) , supplemented with 10% fetal bovine serum (Sigma, F7524), L-glutamine (Invitrogen 25030-024) and, for TSUprl / pEcadluc / Rluc, 50 pg / ml zeocin (Invitrogen, R250-01). The cells were kept in a humidified atmosphere at 37 ° C and 5% CO ² .

Generation of an inducible miRNA expression system

[0273] To facilitate long-term and controlled miRNA expression, use was made of the Tet miR-X inducible miRNA expression system (Clontech Inc.). The miRNA precursor was cloned into the 3'UTR of the ZsGreen fluorescent protein transcription unit. MiRNA expression is driven in the vector by the strongly regulated inducible promoter Ptight and the activity of the co-expressed transactivator (Tet-on). In the presence of doxycycline, the Ptight promoter will be activated, resulting in the co-expression of high levels of miRNA and ZsGreen1 protein, with low levels of expression in uninduced cells.

[0274] The miR-200c and miR-520f precursors were amplified by PCR, using proviral DNA from lentivirus-infected TSUpr1 cells as template and universal pCDH forward and reverse vector specific primers (SEQ ID NO: 84-85) . Amplification products were digested with EcoRI / NheI; these sites are from the multiple cloning site of the lentiviral vector pCDH. The digested fragments were cloned into the EcoRI / NheI sites of a modified pEGFP-N3 vector (Clontech # 6080-1), which was obtained by cleavage with BamHI / NotI of the open EGFP reading frame of the vector and closing the vector after filling in of the BamHI and NotI overhangs mediated by a Klenow DNA polymerase. The miR precursor was cleaved from this vector by digestion with EagI / NheI and cloned into the EagI / NheI sites of the pmRi-ZsGreen1 vector (Clontech PT5049-1; Fig. 5A). Appropriate cloning was confirmed by DNA sequence analysis. The transactivator vector pTet-on (Clontech PT3899-5) was transfected into the PC3 prostate cancer cell line (ATCC # CRL-1435). Appropriate pTet-on activity was evaluated in the G418 resistant clones in a pTRE-luciferase-transient indicator assay.

[0275] The pmRi-ZsGreen1-miR-X vectors were then transfected into PC3-Tet-on cells (clone 8), along with a puromycin selection marker. Puromycin resistant colonies were screened and rapidly screened for DOX-inducible ZsGreen1 expression (by measuring fluorescence in 96-well plates on the Victor3 multimeter). ZsGreen1 positive cells were further analyzed for DOX-inducible miRNA expression.

Cell invasion assays

[0276] For cell invasion assays, DOX-inducible PC3-mRi-ZsGreen1-miR-X cells were incubated in the presence of DOX (1 ug / ml) for 2 days, prior to the invasion assay. PC3 and TSUpr1-pEcad cells were transduced with miR-expressing lentiviral particles (MOI = 30), as described in Example 1. The cells Lentiviral transduces were selected with puromycin and passaged 1 time before use. Fifty thousand (PC3) or 40,000 (TSUpr1-pEcad) cells were seeded in Biocoat Matrigel Invasion chambers (8 microns; BD 354480) in serum-free medium (Fig. 6A). The invasion chamber was placed in a well of 24 containing medium with 10% fetal calf serum as a chemoattractant. As a control, the same number of cells was seeded in 24-well culture plates. After 48 hours of incubation, the cells in the invasion chamber were removed by aspiration and cleaning the internal compartment with a swab. The invasion chamber was then placed in CellTiter-GLO cell viability reagent (CTG, Promega-G7571), incubated for 15 minutes, and then analyzed on a Victor3 luminometer. Cell invasion was calculated as the CTG activity at the bottom of the membrane divided by the CTG activity of cells grown in a 24-well plate. Inhibition of cell invasion by a specific miRNA was calculated by dividing the percentage of cell invasion of DOX-treated cells vs. untreated cells, or invasion of transduced cells vs. cells transduced with the empty vector.

RT-PCR in real time

[0277] The same protocol as described under Example 1 was used for RT-PCR of the following genes: vimentin and CDH11 and HPRT. The following primers were used for the respective genes:

Direct HPRT 5'- CTCAACTTTAACTGGAAAGAATGTC -3 '

inverse 5'-TCCTTTTCACCAGCAAGCT -3'Direct feed

5'-GGCTCAGATTCAGGAACAGC-3 '

inverse 5'-GCTTCAACGGCAAAGTTCTC -3 '

CDH11 direct 5'-GGTCTGGAACCAGTTCTTCG -3 '

inverse 5'-GGCATGAATGTTCCCTGATT -3 '

(SEQ ID NO: 112-117)

Results

Validation of TME induction microRNAs

In vitro validation using microRNA mimetics

[0278] To validate the identified microRNAs by screening a lentiviral miRNA expression library, synthetic miRNA mimetics were used. The used synthetic miR mimetics were supplied by Ambion or Dharmacon (Thermo Scientific); see Table 7 for details. The miR-200c mimetics from both companies were compared and showed the same efficacy (ie, CDH1 induction; data not shown). TSUpr1-pEcad-luc / Rluc cells were transiently transfected with 20 to 60 nM of synthetic miR mimetics. Four days after transfection, Luc and RLuc activity were measured and the Luc / RLuc ratios were normalized for cells transfected with negative control (NC) mimetic. Of all the mimetics evaluated, miR-124, 181a, 200c, 206 and miR-520f showed an induction of the Luc / RLuc ratio (Fig. 4A). Except for miR-200c and miR-520f, the other miR mimetics down-regulated RLuc activity and showed cellular toxicity (not shown). Of all these miRs, miR-200c and miR-520f strongly (~ 20-fold) induced endogenous CDH1 expression, while miR-124 * and miR-181a induced CDH1 approximately 2.5-fold (Fig. 4B). MiR-200c, miR-518 and miR-524 down-regulated the expression of c DH2 by more than 30% (Fig. 4B). The efficacy of miR mimetics was further evaluated in several other tumor cell lines with a mesenchymal type phenotype (based on the proportions of CDH1 and vimentin mRNA expression; Figure 3). As in TSUpr1-pEcad-luc / Rluc, miR-200c and miR-520f also induced CDH1 expression in PC3, PANC-1, M iA-PaCa2, MDA-MB-231 and wild type TSUpr1 cells (Fig 4C).

Generation of an inducible miRNA expression system

[0279] Appropriate pTet-on activity was evaluated in G418 resistant clones in a pTRE-luciferase-transient indicator assay. After treatment with doxycycline (DOX) (0.1 and 1.0 ug / ml), clone 8 showed a strong induction of luciferase expression, while Luc activity in uninduced cells (without DOX) did not exceed basal levels (Fig. 5B). As shown in Figure 5C, several clones transfected with pmRi-ZsGreen1-miR-X exhibited DOX-inducible miR-200c or miR-520f expression, which was DOX dose dependent, reaching peak levels at about 1 ug / ml DOX (not shown).

[0280] Endogenous gene expression in cells with inducible expression of miR-200c and miR-520f was analyzed by qPCR. A down regulation of CDH1 was observed, while a down regulation of CDH11 and vimentin was observed repeatedly for both miRs (Table 8). PC3 cells also showed the weakest induction of CDH1 by miR-200c and miR-520f mimetics of all evaluated cell lines. In addition to down-regulation of mesenchymal markers, transcriptional repressors, such as ZEB1, ZEB2 and SNAI2, were also down-regulated, after induction of miR-200c and miR-520f (Table 8). Collectively, these data indicate that, in the inducible miR-200c and miR-520f cell lines, the corresponding miRs, as well as their direct and indirect TEM target genes, can be regulated at the molecular level.

Inhibition of tumor cell invasion

[0281] To study whether the identified miRs also regulate TEM at the cellular level, cell invasion assays were performed using the inducible miR-520f and miR-200c clones as previously generated and miR-expressing lentiviruses. 200c and miR-520f as previously described. All miR-200c and miR-520f clones evaluated, inhibited cell invasion in the range of 48-68% (Fig. 6B). Induction of miRNA expression was determined in parallel cultures and found positive (Fig. 6C). MiR levels did not show a significant correlation with the percentage of invasion. These data indicate that miR-520f, identified in the Luc selection assay as a TME-inducing miRNA, was also able to reverse one of the key cellular biological aspects of TEM, ie cell invasion.

[0282] To confirm the effect of the other members of the miR-515 family, miR-518b and miR-524, on cell invasion it was evaluated in the TSUprl / pEcad-luc / Rluc screening model. TSUpr1-pEcad cells were infected with lentivirus containing miR precursor. The three miRs belonging to the same miR-515 family, miR-518b, miR-520f and miR-524, inhibited cell invasion by 25-53% (Fig. 6D). Expression of the corresponding mature miRNAs was confirmed by hairpin qPCR (as described in Example 1; not shown).

Conclusions

[0283] The three members of the miR-515 family, miR-518b, miR-520f and miR-524, were identified in the TME screen. Mimetics for miR-518b and miR-524 down-regulated the expression of the mesenchymal marker CDH2, while miR-520f mimetics strongly up-regulated the expression of the epithelial marker CDH1 in various cell line models. Cell invasion of PC3 cells through Matrigel was inhibited after induction of miR-520f expression. The anti-invasive effect was also observed when all three miRNAs were expressed in the TSUpr1-pEcad screening model. In fact, miR-200c did not reduce invasion in this model. This indicates the great potency of these three miR-515 members that have anti-invasive activity in various cell and tumor types unlike miR-200c.

Inhibition of metastasis formation in an animal model

[0284] The fact that these three members of the miR-515 family could activate the promoter of the E-cadherin gene in vitro, depending on the activation of the luciferase indicator and the endogenous induction of CDH1 (miR-520f) or the reduction of CDH2 expression (miR-518b and miR-524), and they could all inhibit tumor cell invasion in vitro indicates that these microRNAs are powerful tools to inhibit tumor cell invasion and metastasis in vivo. To confirm the antimetastatic activity of miR-520f, miR-518b and miR-524 in an in vivo setting, an experimental tumor metastasis experiment was established. Male immunodeficient BALB / c nude mice (6-8 weeks) are injected with 0.5 x 106 (200 µl volume) PC3-mRi-ZsGreen1 cells expressing either miR-520f, miR-518b and miR-524, through the caudal (lateral) vein (29). Groups of 6 mice are given drinking water containing DOX (0.2 mg / ml) throughout the experiment, and a control group of mice injected with PC3-mRi-ZsGreen1 cells not treated with DOX expressing either miR -520f, miR-518b and miR-524 receive water without DOX. The mice are checked daily and, if they do not suffer serious problems, they are sacrificed after 2 months. The lungs are the primary site of metastasis, as they contain the first capillary bed to be found by injected cells after injection (30, 31). It is suggested that cells that pass through the pulmonary capillary bed may also metastasize to other organs (30). The number and size of metastases are determined macroscopically (i.e., by visual examination through a dissecting microscope) and microscopically (i.e., by studying the expression of ZsGreen in sections of the lung and other tissues). Based on all available data presented above, it is anticipated that cells that express either miR-520f, miR-518b or miR-524 form less (and less) metastasis in this animal model than cells that do not express these miRNAs. . This proof of concept will pave the way for further preclinical testing of miR-520f, miR-518b, and miR-524 as a drug to treat TEM-associated diseases.

[0285] To further confirm the inhibitory effect of miR-520f, miR-518b and miR-524 on metastasis in vivo, different tumor cell lines, designed with pmRi-ZsGreen1-miR-520f, 518b or 524, are injected orthotopically in nude mice (NOD-SCID or BALB / c nu / nu). At different times after injection of tumor cells, mice receive water with DOX or without DOX. Local invasion and distant metastasis to the lungs and other organs are controlled by in vivo imaging of ZsGreen1 or LUC. Overexpression of miR-520f, miR-518b, or miR-524 (induced by DOX in drinking water) is expected to reduce the number of metastases. In addition, mice orthotopically injected with tumor cells, where miR-520f, miR-518b or miR-524 was activated, are expected to have a median survival rate that will be significantly prolonged compared to that of mice not receiving DOX (en that is, without activation of miR-520f, miR-518b or miR-524 in tumor cells). Animal survival will be defined as survival without serious complications.

Table 1: List of microRNAs identified by TME (luciferase) screening and regulation of endogenous genes associated with TEM. TSUpr1-pEcad-Luc cells were infected with 30 luciferase positive microRNAs (see text). Total RNA was backtranscribed and used for SYBR Green real-time PCR analysis of the genes CDH1 (Ecad), CDH2 (Ncad), SNAI1, SNAI2, ZEB1 and ZEB2. LUC, FLuc / RLuc ratio induction, average of 3 experiments; CDH1, (induction of) endogenous expression of CDH1; Cd H2, (inhibition of) endogenous CDH2 expression; repressor, transcriptional repressors of CDH1 that were down-regulated at least 2-fold, or between 1.3 and 2-fold (underlined). Only data for 12 microRNAs that are of interest for further studies are shown; See text for detailed reasoning for selecting these 12 miRs.

miAR LUC CDH1 CDH2 H1 / CDH2 Repressor miR-124-1 1.76 1.30 2.46 0.53 SNAI2

miR-181a-1 1.59 4.22 0.89 4.74 SNAI2

miR-141 1.95 0.58 0.04 14.45 ZEB2, SNAI1

miR-200a 1.66 2.18 0.67 3.25 ZEB2

miR-200c 2.53 0.71 0.04 17.65 ZEB2, ZEB1

miR-205 1.79 0.39 0.08 4.86 ZEB2

miR-429 1.50 3.39 0.41 8.28 ZEB2

miR-206 1.73 2.24 2.07 1.08 SNAI2

miR-518b 1.62 3.09 1.67 1.85 SNAI2

miR-520f 1.43 12.92 1.16 11.14 SNAI2, ZEB2

miR-524 1.57 1.60 0.45 3.56 ZEB2

2,08

5,17

1,18

4,38

ZEB2miR-200b

2.08

5.17

1.18

4.38

ZEB2

Table 2 miRNA precursor sequences identified in the TME screen (see Table 1). List of miRNA precursor sequences (direction 5 'to 3'). All sequences were obtained from miRBase (version 14: Sept. 2009; www.mirbase.org).

SEQ ID miRNA Precursor Sequence

²² AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUC CAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG

^{2. 3} AUCAAGAUUAGAGGCUCUGCUCUCCGUGUUCACAGCGGACCUUGAU

UUAAUGUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGCGGAGC

CUACGGCUGCACUUGAA

²⁴ UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUA UACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGGCGCCUCC

²⁵ UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGU

UUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCUAUGGC

UAACCAUCAUCUACUCCA

UAACCAUCAUCUACUCCA

^{26 miR-141} CGGCCGGCCCUGGGUCCAUCUUCCAGUACAGUGUUGGAUGGUCU

AAUUGUGAAGCUCCUAACACUGUCUGGUAAAGAUGGCUCCCGGGUG

GGUUC

^{27 miR-200a} CCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCC CAGCUUGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGA CCCGC

²⁸ CCCUCGUCUUACCCAGCAGUGUUUGGGUGCGGUUGGGAGUCUC

UAAUACUGCCGGGUAAUGAUGGAGG

²⁹ AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCC ACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGA AGUUCAGGAGGCAUGGAGCUGACA

³⁰ GCGUCUUACCAGACAUGGUUAGACCUGGCCCUCUGUCUAAUAC

UGUCUGGUAAAACCGUCCAUCCGCUGC

³¹ UGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUAUGGAUU ACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCAAGUG

³² UCAUGCUGUGGCCCUCCAGAGGGAAGCGCUUUCUGUUGUCUGAAAG

AAAACAAAGCGCUCCCCUUUAGAGGUUUACGGUUUGA

³³ UCUCAGGCUGUGACCCUCUAAAGGGAAGCGCUUUCUGUGGU CAGAAAGAAAAGCAAGUGCUUCCUUUUAGAGGGUUACCGUUU GGGA

^{3. 4} UCUCAUGCUGUGACCCUACAAAGGGAAGCACUUUCUCUUGUCCAAA

GGAAAAGAAGGCGCUUCCCUUUGGAGUGUUACGGUUUGAGA

GGAAAAGAAGGCGCUUCCCUUUGGAGUGUUACGGUUUGAGA

^{35 miR-200b} CCAGCUCGGGCAGCCGUGGCCAUCUUACUGGGCAGCAUUGGAUGGA GUCAGGUCUCUAAUACUGCCUGGUAAUGAUÜACGGCGGAGCCCUGC ACG

Table 3 mature sequences of the miRNAs identified in the TME screen (see Table 1). List of mature miRNA sequences (direction 5 'to 3'). All sequences were obtained from miRBase (version 14:

sept. 2009; www.mirbase.org). microRNA EQ I SEQ from mature miRNA hsa-miR-124- 2 uaaggcacgcggugaaugcc hsa-miR-124- 3 cguguucacagcggaccuugau hsa-miR-124-hsa-miR-181a 4 aacauucaacgcugucggugagu

5 accaucgaccguugauuguacc hsa-miR-141 6 uaacacugucugguaaagaugg

7 caucuuccaguacaguguugga hsa-miR-200a 8 uaacacugucugguaacgaugu

9 caucuuaccggacagugcugga hsa-miR-200b 10 uaauacugccugguaaugauga

11 caucuuacugggcagcauugga hsa-miR-200c 12 uaauacugccggguaaugaugga

13 cgucuuacccagcaguguuugg hsa-miR-205 14 uccuucauuccaccggagucug

15 gauuucaguggagugaaguuc

15 gauuucaguggagugaaguuc

16

uaauacugucugguaaaaccgu hsa-miR-429

16

uaauacugucugguaaaaccgu

AGACACCAGCCCAGGACCCGGAGGCCACCCACACCACCGCCGGCCGA TGGGCGTCTTACCAGACATGGTTAGACCTGGCCCTCTGTCTAATACTGT CTGGTAAAACCGTCCATCCGCTGCCTGATCACCGGTTAGAGGAGAGAGC

TGCCTGCCCTGCAGCTCATCAGTGCAAAGCC

GATGACGGCGGAGCCCTGCACGCAGCGACCGGCCGACCCCGT GCAAGGAGGAAAGATGCTACAAGTGGCCCACTTCTGAGATGCGGGCT GCTTCTGGATGACACTGCTTCCCGAGGCCACATGCTTCTTTATATCCC CAT AT GG ATTACTTTGCT ATGGA AT GT A AGG AAGT GT GT GGTTTCGGC AAGTGCCTCCTCGCTGGCCCCAGGGTACCACCCGGAGCACAGGTTTG GTGACCTTCTTC GCAAACAGGGCAAATAAATGCATCTTTATTTTGT GT CCATTTT AACCT GGTCAAGGAAAATTCCAACAGCAACATCAAAAAACCAGTGTTGGAG CAAGAATATGTCATGCTGTGGCCCTCCAGAGGGAAGCGCTTTCTGTT GT CT GA AG AA A AC A AAGCGCT CCCCTTT AG AGGTTTACGGTTT G AG TAAAGCAGCGTTGAAGTTGATGCTGATCTTGGTAATACATTTGCAGA GCGT GCTT ATCAT CAG TGTGTCCATTTAAACCTGGTCAAGGAAGATTCCCACAAAAAATCCAC GGTGCTGGAGCAAGAGGATCTCAGGCTGTGACCCTCTAAAGGGAA GCGCTTTCTGTGGTCAGAAAGAAAAGCAAGTGCTTCCTTTTAGAGG GTTACCGTTTGGGAAAAGCAATGTTGAAGTTGATGCTGATCTTGGT AAAATATTTGCAGAGCGTGCTTATCATCAG CAAACAGGGCCAATAAATGCATCCTCATTTTTGTGTCCATTTTAACCT GGGCAAGGAAAATTCCAACAAAAAACCCAGAGTTCTGGAGCAAGAA GATCTCATGCTGTGACCCTACAAAGGGAAGCACTTTCTCTTGTCCAA AGGAAAAGAAGGCGCTTCCCTTTGGAGTGTTACGGTTTGAGAAAAG CAGCGTTGAGGGGGGCGTGCGTGTAGACCGTGTAGACGCAC CGGGCAGCCGTGGCCATCTT ACTGGGCAGCATTGGATGGAGTCAüüTCTCTAATACTGCCTGGTAAT

GATGACGGCGGAGCCCTGCACGCAGCGACCGGCCGACCCCGT

Table 5 Seed sequences of miRNA identified in the TME screening (see Table 1). List of miRNA seed sequences (direction 5 'to 3'). All sequences were obtained from miRBase (version 14: Sept. 2009; www.mirbase.org). The seed sequence is defined as nucleotides 2-8 (5 'to 3' direction) of the mature miRNA sequence. microRNA mature RNA EQ I uence seed hsa-miR-124-1 miR-124 87 aaggcac hsa-miR-124-2

miR-124 * 88 guguuca hsa-miR-124-3

miR-181a 89 acauuca hsa-miR-181a-1

miR-141

91

aacacug miR-181a * 90 ccaucga hsa-miR-141

miR-141

91

aacacug

miR-141 * 92 aucuucc

miR-200a 93 aacacug hsa-miR-200a

miR-200a * 94 aucuuac miR-200b 95 aauacug hsa-miR-200b

miR-200b * 96 aucuuac miR-200c 97 aauacug hsa-miR-200c

miR-200c * 98 gucuuac miR-205 99 ccuucau hsa-miR-205

miR-205 * 100 auuucag hsa-miR-429 miR-429 101 aauacug hsa-miR-206 miR-206 102 ggaaugu hsa-miR-518b miR-518b 103 aaagcgc

104 agugcuu hsa-miR-520f miR-520f

105 aagugcu miR-524-5p 106 uacaaag hsa-miR-524

miR-524-3p

107

aaggcgc

miR-524-3p

107

aaggcgc

Table 6: miRNA isomiR sequences identified in the screening (see Table 1). These isomiRs have been detected after analysis of 66 human tissue samples using high throughput deep sequencing and only isomiRs representing> 5% of the total number of cloned sequences are listed here, unless otherwise noted.

mature miRNA MiRNA Seed (SEQ ID) IsomiR sequence (SEQ ID) hsa-miR-520f AGUGCUU (104) AAGUGCUUCCUUUUAGAGGGU (118)

AAGUGCU (105) AAGUGCUUCCUUUUAGAGGGUU * 1 (120) CAAGUGCUUCCUUUUAGAGGGU (119) hsa-miR-518b AAAGCGC (103) CAAAGCGCUCCCCUUUAGAGGU (121)

CAAAGCGCUCCCCUUUAGAGG (122) CAAAGCGCUCCCCUUUAGAG (123) hsa-miR-524 AAGGCGC (107) GAAGGCGCUUCCCUUUGGAGUG (124)

GAAGGCGCUUCCCUUUGGAGU (125) UACAAAG (106) CUACAAAGGGAAGCACUUUCU (126)

CUACAAAGGGAAGCACUUUCUC (127) CUACAAAGGGAAGCACUUUC (128) hsa-miR-124- AAGGCAC (87) UAAGGCACGCGGUGAAUGCCAA (129) hsa-miR-124- UAAGGCACGCGGUGAAUGCCA (130) hsa-GACG-GAUC-GA-GAUC

UAAGGCACGCGGUGAAUGCC*3 (132) hsa-miR-206 GGAAUGU (102) UGGAAUGUAAGGAAGUGUGUGG (133)

UAAGGCACGCGGUGAAUGCC * 3 (132) hsa-miR-206 GGAAUGU (102) UGGAAUGUAAGGAAGUGUGUGG (133)

UGGAAUGUAAGGAAGUGUGUGGU (134) UGGAAUGUAAGGAAGUGUGUG (135) hsa-miR-181a ACAUUCA (89) AACAUUCAACGCUGUCGGUGAGUUU (136) AACAUUCAACGCUGUCGGUGAGU (137) AACAUUCAACGCUGUCGGUGAG (138) AACAUUCAACGCUGUCGGUGAGUU (139) AACAUUCAACGCUGUCGG (140) AACAUUCAACGCUGUCGGU (141) AACAUUCAACGCUGUCGGUG (142)

AACAUUCAACGCUGUCGGUGA (143)

AACAUUCAACGCUGUCGGUGA (143)

hsa-miR-141 mir-141 AACACUG (91) UAACACUGUCUGGUAAAGAUGG (144)

UAACACUGUCUGGUAAAGAUG (145) UAACACUGUCUGGUAAAGAUGGC (146) UAACACUGUCUGGUAAAGAU (147)

UAACACUGUCUGGUAAAGA (148)

UAACACUGUCUGGUAAAGA (148)

UAACACUGUCUGGUAAAGAUGGCU (149) hsa-miR-200a AACACUG (93) UAACACUGUCUGGUAACGAUGUU (150

UAACACUGUCUGGUAAAGAUGGCU (149) hsa-miR-200a AACACUG (93) UAACACUGUCUGGUAACGAUGUU (150

UAACACUGUCUGGUAACGAUGU (151) hsa-miR-200b AAUACUG (95) UAAUACUGCCUGGUAAUGAUGAC (152)

UAAUACUGCCUGGUAAUGAUGA (153) AUCUUAC (96) CAUCUUACUGGGCAGCAUUGGA (154)

CAUCUUACUGGGCAGCAUUGG (155) hsa-miR-200c AAUACUG (97) UAAUACUGCCGGGUAAUGAUGGA (156) UAAUACUGCCGGGUAAUGAUGG (157) hsa-miR-205 CCUUCAU (99) UCCUUCAUUCCACCGGAGUC

UCCUUCAUUCCACCGGAGUCUGU (160) hsa-miR-429 mir-429 AAUACUG (101) UAAUACUGUCUGGUAAAACCGU (161)UCCUUCAUUCCACCGGAGUCUG (159)

UCCUUCAUUCCACCGGAGUCUGU (160) hsa-miR-429 mir-429 AAUACUG (101) UAAUACUGUCUGGUAAAACCGU (161)

UAAUACUGUCUGGUAAAACCG (162)

* 1 Sequence annotated in miRBase. Not detected in deep sequencing analysis

* 2 Only 0.9% of the total number of cloned sequences

* 3 Only 0.7% of the total number of cloned sequences _____________________________

Table 7: List of microRNA mimetics used for validation of TME screening results. Suppliers and product codes for all synthetic miR precursors are displayed. All the mimetics listed are double-stranded and each chain is 100% complementary to each other. One chain will be the exact sequence of mature miRNA sequences deposited into miRBase and listed in Table 3. The other chain contains certain modifications.

MiRNA Mimetic Vendor Product Code Mimic Negative Control # 1 ** Dharmac CN-001000-01-05

hsa-miR-200c miRIDIAN Mimic Dharmac C-300646-05-0005

hsa-miR-520f miRIDIAN Mimic Dharmac C-300779-03-0005

hsa-miR-524-5p miRIDIAN Mimic Dharmac C-300806-03-0005

hsa-miR-518b miRIDIAN Mimic Dharmac C-300798-03-0005 precursor hsa-miR-124 Pre-miR Ambion PM10691

precursor hsa-miR-124 * Pre-miR Ambion PM11154

precursor hsa-miR-181a Pre-miR Ambion PM10421

precursor hsa-miR-181a * Pre-miR Ambion PM10381

precursor hsa-miR-200c Pre-miR Ambion PM11714

PM10409precursor hsa-miR-206 Pre-miR Ambion

PM10409

*, Dharmacon is now part of Thermo Fisher Scientific.

** This negative control is based on C. elegans Cel-miR-67 (SEQ ID 163).

Table 8 Gene expression in PC3 cells transfected with inducible microRNAs. PC3-Tet-on cells (clone 8) were stably transfected with pmRi-ZsGreen1-miR-X expression plasmids. The selected clones (see figure 5) were treated with 1 pg / ml DOX for 4 days. Total RNA was isolated and gene expression was studied by qPCR. *, more than 1.5-times; =, without change; n.d., not determined.

PC3-mRi-miR-200c gen PC3-mRi-miR-520f

Reference list

[0286]

1. Tomita, K., van, B.A., van Leenders, G.J., Ruijter, E.T., Jansen, C.F., Bussemakers, M.J. and Schalken, J.A. Cadherin switching in human prostate cancer progression. Cancer Res. 60: 3650-3654 (2000).

2. Umbas, R., Isaacs, W.B., Bringuier, P.P., Schaafsma, H.E., Karthaus, H.F., Oosterhof, G.O., Debruyne, F.M. and Schalken, J.A. Decreased E-cadherin expression is associated with poor prognosis in patients with prostate cancer. Cancer Res. 54: 3929-3933 (1994).

3. Oort van, I., Tomita, K., van, B.A., Bussemakers, M.J., Kiemeney, L.A., Karthaus, H.F., Witjes, J.A. and Schalken, J.A. The prognostic value of E-cadherin and the cadherin-associated molecules alpha-, beta-, gamma-catenin and p120ctn in prostate cancer specific survival: a long-term follow-up study. Prostate. 67: 1432-1438 (2007).

4. Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J. and Garcia, D.H. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumor cells. Nat. Cell Biol. 2: 84-89 (2000).

5. Cano, A., Perez-Moreno, M.A., Rodrigo, I., Locascio, A., Blanco, M.J., del Barrio, M.G., Portillo, F. and Nieto, M.A. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol. 2: 76-83 (2000).

6. Hajra, K.M., Chen, D.Y. and Fearon, E.R. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 62: 1613-1618 (2002).

7. Yang, J., Mani, S.A., Donaher, J.L., Ramaswamy, S., Itzykson, R.A., Come, C., Savagner, P., Gitelman, I., Richardson, A. and Weinberg, R.A. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117: 927-939 (2004).

8. Bussemakers, M.J., Giroldi, L.A., van Bokhoven, A. and Schalken, J.A. Transcriptional regulation of the human E-cadherin gene in human prostate cancer cell lines: characterization of the human E-cadherin gene promoter. Biochem. Biophys. Res. Commun. 203: 1284-1290 (1994).

9. Giroldi, L.A., Bringuier, P.P., de Weijert, M., Jansen, C., van Bokhoven, A. and Schalken, J.A. Role of E boxes in the repression of E-cadherin expression. Biochem. Biophys. Res. Commun. 241: 453-458 (1997).

10. Rodrigo, I., Cato, A.C.B. and Cano, A. Regulation of E-cadherin gene expression during tumor progression: the role of a new Ets-binding site and the E-pal element. Exp. Cell Res. 248: 358-371 (1999).

11. Conacci-Sorrell, M., Simcha, I., Ben Yedidia, T., Blechman, J., Savagner, P. and Ben Ze'ev, A. Autoregulation of E-cadherin expression by cadherin-cadherin interactions: the roles of beta-catenin signaling, Slug, and MAPK. J. Cell Biol. 163: 847-857 (2003).

12. Gregory, P.A., Bracken, C.P., Bert, A.G. and Goodall, G.J. MicroRNAs as regulators of epithelialmesenchymal transition. Cell Cycle. 7: 3112-3118 (2008).

13. Burk, U., Schubert, J., Wellner, U., Schmalhofer, O., Vincan, E., Spaderna, S. and Brabletz, T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. EMBO Rep. 9: 582-589 (2008).

14. Gregory, P.A., Bert, A.G., Paterson, E.L., Barry, S.C., Tsykin, A., Farshid, G., Vadas, M.A., Khew-Goodall, Y. and Goodall, G.J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat. Cell Biol. 10: 593-601 (2008).

15. Park, SM, Gaur, AB, Lengyel, E. and Peter, ME The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 22: 894-907 (2008).

16. Berezikov, E., van, TG, Verheul, M., van de, BJ, van, LL, Vos, J., Verloop, R., van de, WM, Guryev, V., Takada, S., van Zonneveld, AJ, Mano, H., Plasterk, R. and Cuppen, E. Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. Genome Res. 16: 1289-1298 (2006).

17. Lowery, AJ, Miller, N., Devaney, A., McNeill, RE, Davoren, PA, Lemetre, C., Benes, V., Schmidt, S., Blake, J., Ball, G. and Kerin , MJ MicroRNA signatures predict oestrogen receptor, progesterone receptor and HER2 / neu receptor status in breast cancer. Breast Cancer Res. 11: R27 (2009).

18. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res.

29: e45 (2001).

19. Chen, C., Ridzon, DA, Broomer, AJ, Zhou, Z., Lee, DH, Nguyen, JT, Barbisin, M., Xu, NL, Mahuvakar, VR, Andersen, MR, Lao, KQ, Livak , KJ and Guegler, K.J. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33: e179 (2005).

20. Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J. and Garcia, D.H. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumor cells. Nat. Cell Biol. 2: 84-89 (2000).

21. Cano, A., Perez-Moreno, M.A., Rodrigo, I., Locascio, A., Blanco, M.J., del Barrio, M.G., Portillo, F. and Nieto, M.A. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell Biol. 2: 76-83 (2000).

22. Hajra, K.M., Chen, D.Y. and Fearon, E.R. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 62: 1613-1618 (2002).

23. Yang, J., Mani, S.A., Donaher, J.L., Ramaswamy, S., Itzykson, R.A., Come, C., Savagner, P., Gitelman, I., Richardson, A. and Weinberg, R.A. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117: 927-939 (2004).

24. Bussemakers, M.J., Giroldi, L.A., van Bokhoven, A. and Schalken, J.A. Transcriptional regulation of the human E-cadherin gene in human prostate cancer cell lines: characterization of the human E-cadherin gene promoter. Biochem. Biophys. Res. Commun. 203: 1284-1290 (1994).

25. Giroldi, L.A., Bringuier, P.P., de Weijert, M., Jansen, C., van Bokhoven, A. and Schalken, J.A. Role of E boxes in the repression of E-cadherin expression. Biochem. Biophys. Res. Commun. 241: 453-458 (1997).

26. Rodrigo, I., Cato, A.C.B. and Cano, A. Regulation of E-cadherin gene expression during tumor progression: the role of a new Ets-binding site and the E-pal element. Exp. Cell Res. 248: 358-371 (1999).

27. Conacci-Sorrell, M., Simcha, I., Ben Yedidia, T., Blechman, J., Savagner, P. and Ben Ze'ev, A. Autoregulation of E-cadherin expression by cadherin-cadherin interactions: the roles of beta-catenin signaling, Slug, and MAPK. J. Cell Biol. 163: 847-857 (2003).

28. Bussemakers, M.J., van, B.A., Tomita, K., Jansen, C.F. and Schalken, J.A. Complex cadherin expression in human prostate cancer cells. Int. J Cancer. 85: 446-450 (2000).

29. Mohanty, S. and Xu, L. Experimental metastasis assay. J Vis. Exp. 1942 (2010).

30. Rubio, N., Villacampa, M.M., El, H.N. y Blanco, J. Metastatic burden in nude mice organs measured using prostate tumor PC-3 cells expressing the luciferase gene as a quantifiable tumor cell marker. Prostate. 44: 133-143 (2000).

31. Fukuchi, K., Steiniger, S.C., Deryugina, E., LIU, Y., Lowery, C.A., Gloeckner, C., Zhou, B., Kaufmann, G.F., Quigley, J.P. and Janda, K.D. Inhibition of tumor metastasis: functional immune modulation of the CUB domain containing protein 1. Mol. Pharm. 7: 245-253 (2010).

ABBREVIATIONS

[0287]

Claims (8)

1. miRNA-520f or mimetic or isomiR molecule thereof, or source thereof, wherein said source of said miRNA or mimetic or isomiR molecule thereof comprises at least 80 nucleotides and comprises a motif with at least 98 % identity with SEQ ID NO: 1, or composition comprising said miRNA-520f molecule, mimetic or isomiR or source thereof, for use in the treatment, reversal, cure and / or delay of a cancer associated with TEM by inducing a process of TME, wherein said miRNA-520f molecule comprises at least 6 of the 7 nucleotides present in the seed sequence identified as SEQ ID NO: 104 or 105 and / or has at least 80%, 81%, 82%, 83%, 84% , 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 19, 118 and / or 119 and has a length of at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 nucleotides or more. 2. miRNA-520f molecule, or mimetic or isomiR thereof, or source thereof, for use according to claim 1, or composition for use according to claim 1, wherein the TEM-associated cancer is a carcinoma . 3. MiRNA-520f molecule, or mimetic or isomiR thereof or source thereof for use according to claim 1, or composition for use according to claim 1, wherein the TEM associated cancer is bladder cancer or prostate. Composition for use according to any one of claims 1 to 3, further comprising another miRNA, mimetic or isomiR molecule or source thereof selected from: at least one of miRNA-518b and / or miRNA-524. Composition for use according to any one of claims 1 to 4, further comprising another miRNA, mimetic or isomiR molecule or source thereof selected from: at least one of miRNA-124-1, miRNA-206, miRNA- 181a-1, miRNA-141, miRNA-200a, miRNA-200b, miRNA-200c, miRNA-429 and miRNA-205 and / or a source thereof. 6. MiRNA-520f molecule, or mimetic or isomiR thereof, or source thereof, for use according to any of claims 1 to 3, or composition for use according to any of claims 1 to 5, wherein the use is combined with standard TEM-associated cancer treatments. 7. miRNA-520f molecule, or mimetic or isomiR thereof, or source thereof, for use according to claim 6, or composition for use according to claim 6, wherein the standard treatment is chemotherapy or radiotherapy. 8. miRNA-520f molecule, or mimetic or isomiR thereof, or source thereof, for use according to claim 6, or composition for use according to claim 6, wherein the standard treatment is immunotherapy.