CN104147616A - Application of dsRNA or modification thereof in preparation of tumor inhibitor - Google Patents
Application of dsRNA or modification thereof in preparation of tumor inhibitor Download PDFInfo
- Publication number
- CN104147616A CN104147616A CN201410383877.3A CN201410383877A CN104147616A CN 104147616 A CN104147616 A CN 104147616A CN 201410383877 A CN201410383877 A CN 201410383877A CN 104147616 A CN104147616 A CN 104147616A
- Authority
- CN
- China
- Prior art keywords
- dsrna21
- ome
- tumor
- stranded rna
- double
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses an application of a dsRNA (Double-stranded RNA) or a modification thereof in preparation of a tumor inhibitor. According to the application, the sequence of one strand of the dsRNA is SEQ ID No. 1 in the sequence table, and the sequence of the other strand of the dsRNA is SEQ ID No. 2 in the sequence table; the modification of the dsRNA is the dsRNA modification obtained by being modified through the steps of A1), A2) or A3) as follows: A1) modifying 2'-OH of the ribose of the dsRNA; A2) modifying the phosphate diester bond, used for being connected with the ribotide, of the dsRNA; A3) modifying the cholesterol connected with the 5' end of the ribose of the dsRNA. Experimental results show that the 2'-OMe-dsRNA21 or the modification thereof can effectively inhibit tumor and tumor cells.
Description
Technical field
The present invention relates to biological technical field double center chain RNA or the application of its trim in preparing tumor inhibitor.
Background technology
RNA disturbs (RNA interference, RNAi) be the sequence-specific especially effectively PTGS phenomenon (Fire inducing with the short dsrna (dsRNA) of target-gene sequence homology on a kind of molecular biology, 1998), its mechanism is by hindering the translation of specific gene or transcribing inhibition of gene expression.While importing the double-stranded RNA with endogenous mRNA coding region homology in cell, there is degraded and cause gene expression reticent in this mRNA.RNAi is the distinctive a kind of gene silencing mechanism of eukaryotic cell, and determining cell fate, cell differentiation direction and retain etc., aspect plays a part very important.Because RNAi has any ability that causes that disease or disease related protein are expressed of locking, and RNAi technology specificity is high, and rapidly, side reaction is little in effect, in reticent target gene effectively, the regulator control system of cell itself is not affected.RNAi is very rapid in infectious disease and the development of malignant tumor field of gene as a kind of efficient sequence-specific gene knochout technique at present.
Small nucleic acid (miRNA) is a kind of endogenous, little RNA of endogenous non-coding that comprises 21～25 nucleotide of wide expression in vivo, is one of material causing RNA interference phenomenon immediate cause.MiRNA is by the single stranded RNA precursor of approximately 70～90 base sizes with hairpin structure through generating after Dicer enzyme processing, and high conservative on evolving, is suppressed regulate gene expression and do not affected the stability of transcript by translation.Each miRNA can have a plurality of regulation and control (target) gene, and several miRNA also can regulate same gene, and by inference, miRNA is regulating the gene of one of trichotomy.MiRNA regulates important physiology and the pathological process of body, at cell differentiation, in biological development and disease development process, plays a great role, and has very strong tissue specificity, has caused the concern of increasing research worker.
(cyclin dependent kinase 4, CDK4) as a kind of important cyclin for Cyclin dependent kinase 4.Research shows that tumor cell malignant proliferation is mainly that imbalance due to cell cycle causes, Cyclin D-CDK4/CDK6 be cell cycle regulation by G1 the transition key factor to the S phase.Oneself is proved to be a kind of oncogene CDK4 gene, closely related with generation, development and the patient's of tumor prognosis.In kinds of tumor cells, all find to be attended by overexpression and the overactivity phenomenon of CDK4 in as gastric cancer, breast carcinoma, nonsmall-cell lung cancer, carcinoma of endometrium, hepatocarcinoma and cancerous issue, so CDK4 can be as a potential target spot in therapy of tumor.
In addition the G1 phase is that the unique energy of proliferative cell is accepted the propagation of importing into from the external world or the period of suppressing proliferation signal, acts on G1 phase or G1/S and has a common boundary the phase, and active cell cycle and the synthetic cyclin D of promotion DNA are indexs more responsive than other cyclins.
Summary of the invention
Technical problem to be solved by this invention is inhibition tumor cell and/or suppress tumor how.Described inhibition tumor cell can be inhibition tumor cell propagation, and described inhibition tumor can be the generation that suppresses tumor and/or the growth that suppresses tumor.
For solving the problems of the technologies described above, first the present invention provides a kind of double-stranded RNA or the application of its trim in preparing tumor inhibitor or inhibiting tumour cells agent, described double-stranded RNA, its name is called dsRNA21, a chain of described dsRNA21 from 5 ' end to 3 ' end nucleotides sequence classify SEQ ID No.1 sequence table as, another of described dsRNA21 chain from 3 ' end to 5 ' end nucleotides sequence classify SEQ ID No.2 sequence table as.
Wherein, SEQ ID No.1 is comprised of 21 ribonucleotides, SEQ ID No.2 is comprised of 21 ribonucleotides, and the 1-19 position ribonucleotide of SEQ ID No.1 and the 3-21 position ribonucleotide reverse complemental of SEQ ID No.2, by the double-stranded RNA called after dsRNA21 of the two formation.
In above-mentioned application, described trim specifically can be modifies to described dsRNA21 the double-stranded RNA trim obtaining, and its name is called dsRNA21-mimic.In described double-stranded RNA trim, various method of modifying all can be selected, and comprise one or more the combination etc. being selected from ribose modification, base modification and phosphoric acid backbone modification.As can to as described in dsRNA21 carry out following A 1) A2) or A3) modification obtain as described in double-stranded RNA trim:
A1) 2 of the ribose of described dsRNA21 '-OH is modified;
A2) phosphodiester bond of the connection nucleotide of described dsRNA21 is modified;
A3) 5 of the ribose of described dsRNA21 ' end is connected to the modification of cholesterol.
In above-mentioned application, the described phosphodiester bond to the connection nucleotide of described dsRNA21 is modified to the oxygen of described phosphodiester bond is replaced with sulfur; Described 2 of the ribose of described dsRNA21 '-OH is modified to described 2 '-OH is replaced or described 2 '-OH is carried out to deoxidation modification with methoxyl group or fluorine.
In one embodiment of the invention, described double-stranded RNA trim is 2 '-OH of all cytidylic acids in chain shown in the SEQ ID No.2 of described dsRNA21 to be all substituted by chain shown in methoxyl group and SEQ ID No.1 modify the trim obtaining, and its name is called 2 '-OMe-dsRNA21.
In above-mentioned application, described inhibiting tumour cells agent can be the product (as medicine) of inhibition tumor cell propagation and/or promotes the product (as medicine or vaccine) of apoptosis of tumor cells, and described tumor inhibitor can be the product (as medicine or vaccine) that suppresses tumorigenic product (as medicine or vaccine) and/or suppress tumor growth.
In above-mentioned application, described tumor can be nasopharyngeal carcinoma, intestinal cancer, cervical cancer, hepatocarcinoma, gastric cancer, breast carcinoma, pulmonary carcinoma, nonsmall-cell lung cancer or carcinoma of endometrium.
In above-mentioned application, described inhibition tumor cell propagation can be the G1 phase of inhibition tumor cell propagation.
For solving the problems of the technologies described above, the present invention also provides the biomaterial relevant to the dsRNA21 application in preparing tumor inhibitor or inhibiting tumour cells agent.
In the application of the biomaterial relevant to dsRNA21 provided by the present invention in preparing tumor inhibitor or inhibiting tumour cells agent, described biomaterial is following B1)-B12) in any:
B1) the encode DNA molecular of described dsRNA21;
B2) contain B1) expression cassette of described DNA molecular;
B3) contain B1) recombinant vector of described DNA molecular;
B4) contain B2) recombinant vector of described expression cassette;
B5) contain B1) recombinant microorganism of described DNA molecular;
B6) contain B2) recombinant microorganism of described expression cassette;
B7) contain B3) recombinant microorganism of described recombinant vector;
B8) contain B4) recombinant microorganism of described recombinant vector;
B9) contain B1) transgenetic animal cell of described DNA molecular system;
B10) contain B2) transgenetic animal cell of described expression cassette system;
B11) contain B3) transgenetic animal cell of described recombinant vector system;
B12) contain B4) transgenetic animal cell of described recombinant vector system.
In the application of the above-mentioned biomaterial relevant to dsRNA21 in preparing tumor inhibitor or inhibiting tumour cells agent, described tumor can be intestinal cancer, nasopharyngeal carcinoma, cervical cancer, hepatocarcinoma, gastric cancer, breast carcinoma, pulmonary carcinoma, nonsmall-cell lung cancer or carcinoma of endometrium.
In the application of the above-mentioned biomaterial relevant to dsRNA21 in preparing tumor inhibitor or inhibiting tumour cells agent, B2) expression cassette (dsRNA21 expression cassette) of the described DNA molecular that contains the dsRNA21 that encodes refers to the DNA that can express dsRNA21 in host cell, this DNA not only can comprise the promoter that startup dsRNA21 transcribes, and also can comprise and stop the terminator that dsRNA21 transcribes.Further, described expression cassette also can comprise enhancer sequence.
The recombinant vector that available existing expression vector establishment contains described dsRNA21 expression cassette.
In the application of the above-mentioned biomaterial relevant to dsRNA21 in preparing tumor inhibitor or inhibiting tumour cells agent, described carrier can be plasmid, glutinous grain, phage or viral vector.
In the application of the above-mentioned biomaterial relevant to dsRNA21 in preparing tumor inhibitor or inhibiting tumour cells agent, B5)-B8) described microorganism can be yeast, antibacterial, algae or fungus.
In the application of the above-mentioned biomaterial relevant to dsRNA21 in preparing tumor inhibitor or inhibiting tumour cells agent, B9)-B12) described transgenetic animal cell system does not comprise propagating materials.
In the application of the above-mentioned biomaterial relevant to dsRNA21 in preparing tumor inhibitor or inhibiting tumour cells agent, described tumor inhibitor can be the inhibitor that suppresses tumorigenic inhibitor and/or suppress tumor growth.
In the application of the above-mentioned biomaterial relevant to dsRNA21 in preparing tumor inhibitor or inhibiting tumour cells agent, described inhibiting tumour cells agent is the product of inhibition tumor cell propagation and/or the product that promotes apoptosis of tumor cells.
In above-mentioned application, described inhibition tumor cell propagation can be the G1 phase of inhibition tumor cell propagation.
Following M1) or M2) purposes, also belongs to protection scope of the present invention:
M1) described dsRNA21 or the described dsRNA21-mimic application in preparing inhibition tumor cell cyclin D expression reagent;
M2) described dsRNA21 or the described dsRNA21-mimic application in preparing inhibition tumor cell Cyclin dependent kinase 4 expression reagent.
In such use, described tumor can be intestinal cancer, nasopharyngeal carcinoma, cervical cancer, hepatocarcinoma, gastric cancer, breast carcinoma, pulmonary carcinoma, nonsmall-cell lung cancer or carcinoma of endometrium.
In such use, described Cyclin D1 can be cyclinD3.
Following M3) or M4) purposes, also belongs to protection scope of the present invention:
M3) the above-mentioned biomaterial B1)-B12) application in preparing inhibition tumor cell cyclin D expression reagent;
M4) the above-mentioned biomaterial B1)-B12) application in preparing inhibition tumor cell Cyclin dependent kinase 4 expression reagent.
In such use, described tumor can be intestinal cancer, nasopharyngeal carcinoma, cervical cancer, hepatocarcinoma, gastric cancer, breast carcinoma, pulmonary carcinoma, nonsmall-cell lung cancer or carcinoma of endometrium.
In such use, described Cyclin D1 can be cyclinD3.
For solving the problems of the technologies described above, the present invention also provides the product (as medicine or vaccine) that treats and/or prevents tumor.
The product (as medicine or vaccine) that treats and/or prevents tumor provided by the present invention, its active component is described dsRNA21 or described dsRNA21-mimic or above-mentioned biomaterial B1)-B12) in any.
In the above-mentioned product (as medicine or vaccine) that treats and/or prevents tumor, described in treat and/or prevent tumor product can be the medicine that treats and/or prevents tumor, the dosage form of described medicine can be injectable powder.
In the above-mentioned product (as medicine or vaccine) that treats and/or prevents tumor, described tumor is intestinal cancer, nasopharyngeal carcinoma, cervical cancer, hepatocarcinoma, gastric cancer, breast carcinoma, pulmonary carcinoma, nonsmall-cell lung cancer or carcinoma of endometrium.
In the above-mentioned product (as medicine or vaccine) that treats and/or prevents tumor, described medicine can also comprise other pharmaceutically acceptable carrier." pharmaceutically acceptable carrier " used herein should with medicine of the present invention in double stranded rna molecule compatible.Described " pharmaceutically acceptable carrier " refers to transfection reagent in body, as polymine (PEI), and jetPEI (L-PEI), liposome, transferrins, folic acid, nano-emulsion, nanoparticle etc.Other examples that can be used as some materials of pharmaceutically acceptable carrier or its component are freeze drying protectant saccharides, as lactose, dextrose plus saccharose; Starch, as corn starch and potato starch; Tragakanta powder; Fructus Hordei Germinatus; Gelatin; Talcum; Kollag, as stearic acid and magnesium stearate; Calcium sulfate; Vegetable oil, as Oleum Arachidis hypogaeae semen, Oleum Gossypii semen, Oleum sesami, olive oil, Semen Maydis oil and cupu oil; Polyhydric alcohol, as glycerol, mannitol; Alginic acid; Emulsifying agent, as Tween; Phospholipid, as lecithin, soybean phospholipid, PHOSPHATIDYL ETHANOLAMINE, phosphatidyl glycerol, phosphatidylinositols, Phosphatidylserine, stearmide; Cholesterol; Macromolecular polymer, as polymine, chitosan, hyaluronic acid; Wetting agent, as sodium lauryl sulfate; Coloring agent; Flavoring agent; Tablet agent, stabilizing agent; Antioxidant; Antiseptic; Apirogen water; Deng oozing saline solution; With phosphate buffer etc.; Normal saline, glycerol and phosphate buffered saline (PBS).
In the above-mentioned product (as medicine or vaccine) that treats and/or prevents tumor, described injectable powder can normal saline or etc. to ooze D/W be solvent.
In the above-mentioned product (as medicine or vaccine) that treats and/or prevents tumor, described injectable powder can mannitol be freeze drying protectant.
The preparation method of above-mentioned injectable powder, also belongs to protection scope of the present invention.
The preparation method of above-mentioned injectable powder, comprises preparation of samples, pre-freeze, primary drying (sublimation drying), redrying (adsorption stripping and dry) and sealing preservation five steps.
Experimental result demonstration, the application's dsRNA21 or its trim can significantly suppress the propagation of nasopharyngeal carcinoma cell: nasopharyngeal carcinoma cell is when 2 '-OMe-dsRNA21 processes 48h, and 2 '-OMe-dsRNA21 has suppressed 27.7% nasopharyngeal carcinoma cell propagation; When 2 '-OMe-dsRNA21 processes 72h, 2 '-OMe-dsRNA21 has suppressed 33.7% nasopharyngeal carcinoma cell propagation; When 2 '-OMe-dsRNA21 processes 96h, 2 '-OMe-dsRNA21 has suppressed 30.7% nasopharyngeal carcinoma cell propagation; When 2 '-OMe-dsRNA21 processes 10 days, clone's number of nasopharyngeal carcinoma cell is 320 ± 13, and clone's number of the nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC is 147 ± 14.
The application's dsRNA21 or its trim can suppress the transition of cell from the G1 phase to the S phase: the percentage ratio that contains Edu cell the S phase nasopharyngeal carcinoma cell of processing through 2 '-OMe-dsRNA21 is 21.94 ± 3.08%, the percentage ratio that contains Edu cell in the S phase nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC is 37.5 ± 4.49%, the key factor CDK4 gene of cell cycle regulation is expressed as 74.3% of expression in the nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC in the nasopharyngeal carcinoma cell through 2 '-OMe-dsRNA21 processes, CCND3 gene is expressed as 60.8% of expression in the nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC in the nasopharyngeal carcinoma cell through 2 '-OMe-dsRNA21 processes.
The average weight that the application's dsRNA21 or its trim can suppress the increase of tumor weight, gross tumor volume: NC group nude mice tumor is 0.043g ± 0.015g, and the average weight of dsRNA21 group nude mice tumor is 0.023g ± 0.0084g; Injection is in the time of two days, and the average external volume of NC group nude mice tumor is 30.74mm
3, the average external volume of dsRNA21 group nude mice tumor is 20.53mm
3; Injection is in the time of four days, and the average external volume of NC group nude mice tumor is 37.74mm
3, the average external volume of dsRNA21 group nude mice tumor is 30.41mm
3; Injection is in the time of six days, and the average external volume of NC group nude mice tumor is 65.20mm
3, the average external volume of dsRNA21 group nude mice tumor is 45.27mm
3; Injection is in the time of eight days, and the average external volume of NC group nude mice tumor is 75.21mm
3, the average external volume of dsRNA21 group nude mice tumor is 51.94mm
3; Injection is in the time of ten days, and the average external volume of NC group nude mice tumor is 93.97mm
3, the average external volume of dsRNA21 group nude mice tumor is 73.05mm
3.
Experiment shows, the application's 2 '-OMe-dsRNA21 or its trim can effectively suppress tumor and tumor cell.
Accompanying drawing explanation
Fig. 1 is the nasopharyngeal carcinoma cell number of processing through 2 '-OMe-dsRNA21 and 2 '-OMe-NC respectively.Wherein, dsRNA21 represents 2 '-OMe-dsRNA21, and miR-NC represents 2 '-OMe-NC, and figure A is that nasopharyngeal carcinoma cell is being processed 96 hour cell number situations of change through 2 '-OMe-dsRNA21 and 2 '-OMe-NC respectively; Figure B is that nasopharyngeal carcinoma cell is being processed the change curve of 96h inner cell number through 2 '-OMe-dsRNA21 and 2 '-OMe-NC; Figure C is that nasopharyngeal carcinoma cell is being processed respectively the outside drawing of 72 hours through 2 '-OMe-dsRNA21 and 2 '-OMe-NC; Figure D is that nasopharyngeal carcinoma cell is being processed the number of cells after 10 days through 2 '-OMe-dsRNA21 and 2 '-OMe-NC.
The cell of Fig. 2 for containing Edu in the S phase nasopharyngeal carcinoma cell of processing through 2 '-OMe-dsRNA21 and 2 '-OMe-NC.Wherein, NC represents 2 '-OMe-NC, and dsRNA21 represents 2 '-OMe-dsRNA21.Left figure is the cell of the Edu positive in the nasopharyngeal carcinoma cell processed of 2 '-OMe-dsRNA21 or 2 ' under Laser Scanning Confocal Microscope-OMe-NC; Right figure is the percentage ratio that the cell that contains Edu in the nasopharyngeal carcinoma cell processed of statistical computation 2 '-OMe-dsRNA21 or 2 '-OMe-NC accounts for total cell.
Fig. 3 is the expression of CCND3 and CDK4 in the nasopharyngeal carcinoma cell of processing through 2 '-OMe-dsRNA21 and 2 '-OMe-NC.Wherein, figure A is the agarose gel electrophoresis testing result of CCND3 and CDK4, and figure B is the real time fluorescent quantitative testing result of CCND3 and CDK4, and Cyclin D3 represents CCND3, and dsRNA21 represents 2 '-OMe-dsRNA21, and miR-NC represents 2 '-OMe-NC.
Fig. 4 is nude mice tumor weight, volume and the outward appearance of processing through 2 '-OMe-dsRNA21 and 2 '-OMe-NC respectively.Wherein, the gross tumor volume that figure A is nude mice, " D " expression in figure A " my god ", " MM
3" expression " cubic millimeter "; Figure B is the tumor weight of (the 10th day of experiment) two days later nude mice of the 5th injection; Figure C is the appearance of tumors of (the 10th day of experiment) two days later nude mice of the 5th injection.DsRNA21 represents 2 '-OMe-dsRNA21, and NC represents 2 '-OMe-NC.
The specific embodiment
Below in conjunction with the specific embodiment, the present invention is further described in detail, the embodiment providing is only in order to illustrate the present invention, rather than in order to limit the scope of the invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
BALB/C nude mice in following embodiment is Guangdong Province's Experimental Animal Center product.
Nasopharyngeal carcinoma cell in following embodiment is Nasopharyngeal Carcinoma Cell Line (CNE cell line), and CNE cell is Kunming cell bank product, and deposit number is KCB 86019YJ.
The preparation of embodiment 1,2 '-OMe-dsRNA21
A chain of dsRNA21 from 5 ' end to 3 ' end nucleotides sequence classify SEQ ID No.1 sequence table as, another of described dsRNA21 chain from 3 ' end to 5 ' end nucleotides sequence classify SEQ ID No.2 sequence table as.Wherein, SEQ ID No.1 is comprised of 21 ribonucleotides, SEQ ID No.2 is comprised of 21 ribonucleotides, and the 1-19 position ribonucleotide of SEQ ID No.1 and the 3-21 position ribonucleotide reverse complemental of SEQ ID No.2, by the double-stranded RNA called after dsRNA21 of the two formation.The present invention selects random double-stranded RNA as negative control, the name of this random double-stranded RNA is called NC, a chain of NC from 5 ' end to 3 ' end nucleotides sequence classify SEQ ID No.3 sequence table as, a chain of NC from 3 ' end to 5 ' end nucleotides sequence classify SEQ ID No.4 sequence table as.2 '-OH of all cytidylic acids in chain shown in the SEQ ID No.2 of dsRNA21 is all substituted by trim called after 2 '-OMe-dsRNA21 that chain shown in methoxyl group and SEQ ID No.1 is modified the dsRNA21 obtaining.2 '-OH of all cytidylic acids in chain shown in the SEQ ID No.4 of NC is all substituted by trim called after 2 '-OMe-NC that chain shown in methoxyl group and SEQ ID No.3 is modified the NC obtaining.
2 '-OMe-dsRNA21 and 2 '-OMe-NC entrusts synthetic (the Wincott F of Shanghai lucky agate (GenePharma) Pharmaceutical Technology Inc., DiRenzo A, Shaffer C, GrimmS, Tracz D, Workman C, Sweedler D, Gonzalez C, Scaringe S and Usman N.Synthesis, deprotection, analysis and purification of RNA and ribozymes.Nucleic Acids Res.1995,23:2677-84).
The impact of embodiment 2,2 '-OMe-dsRNA21 on tumor cell proliferation
In triplicate, the method for each experiment is as follows in experiment:
2 '-OMe-dsRNA21 the powder dissolution that embodiment 1 is obtained is in the sterilized water without RNA enzyme, and making its final concentration is 20pmol/L, obtains 2 '-OMe-dsRNA21 solution.Get respectively the lipofectamine 2000 (Invitrogen) of this 2 '-OMe-dsRNA21 solution of 5 μ L and 5 μ L, it is diluted in respectively in the serum-free medium (Opti-MEM) of 245 μ L, obtain respectively 2 '-OMe-dsRNA21 serum-free medium and lipofectamine 2000 serum-free mediums, lipofectamine 2000 serum-free mediums are at room temperature hatched 5 minutes, then 2 '-OMe-dsRNA21 serum-free medium is mixed with lipofectamine 2000 serum-free mediums, obtain 2 '-OMe-dsRNA21-liposome complex culture fluid 500 μ L, and by this 2 '-OMe-dsRNA21-liposome complex culture fluid standing 20 minutes in room temperature.
With DMEM fluid medium (the 10%FBS-DMEM fluid medium containing 10% hyclone, GIBCO product) cultivate nasopharyngeal carcinoma cell (CNE, Kunming cell bank, deposit number is KCB 86019YJ), the nasopharyngeal carcinoma cell culture fluid of collection in exponential phase, with the above-mentioned DMEM fluid medium that contains 10% hyclone, adjust cell concentration in the nasopharyngeal carcinoma cell culture fluid in exponential phase, making final concentration of cells is 30000/mL, obtain diluting nasopharyngeal carcinoma cell culture fluid, in 6 orifice plates, add respectively 100 μ L should dilute nasopharyngeal carcinoma cell culture fluid, making cell content in every hole is 3000, and with the above-mentioned DMEM fluid medium that contains 10% hyclone, the volume of culture fluid in every hole is mended to 2mL, obtain 6 orifice plates that contain nasopharyngeal carcinoma cell liquid.6 orifice plates that this is contained to nasopharyngeal carcinoma cell liquid are placed in containing 5%CO
2the incubator of 37 ℃ in cultivate 12 hours, make cell attachment.
In every hole of 6 orifice plates after above-mentioned cell attachment, add the above-mentioned 2 '-OMe-dsRNA21-liposome complex culture fluid of 500 μ L and 1500 μ L serum-free DMEM culture medium (Opti-MEM) to carry out transfection respectively, obtain 2 '-OMe-dsRNA21 cell culture fluid.2 '-OMe-dsRNA21 cell culture fluid is placed in containing 5%CO
2the incubator of 37 ℃ in cultivate after 6 hours, culture medium is replaced by 10%FBS-DMEM fluid medium, under normal condition, continue cultivates, within every 3 days in incubation, transfection is once according to the method described above, cultivate after 10 days, obtain the nasopharyngeal carcinoma cell of processing through 2 '-OMe-dsRNA21.
According to the method described above, 2 '-OMe-dsRNA21 replaces with 2 '-OMe-NC, and all the other steps are constant, obtains the nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC.
By the nasopharyngeal carcinoma cell of processing through 2 '-OMe-dsRNA21 with through the nasopharyngeal carcinoma cell of 2 '-OMe-NC processing, with cold methanol, fix respectively, and use respectively violet staining, then with Gel-Pro enumerator, to nasopharyngeal carcinoma cell clone's number of processing through 2 '-OMe-dsRNA21 with through the nasopharyngeal carcinoma cell clone number of 2 '-OMe-NC processing, count respectively, calculate nasopharyngeal carcinoma cell proliferation inhibition rate (the nasopharyngeal carcinoma cell clone number that nasopharyngeal carcinoma cell proliferation inhibition rate=(the nasopharyngeal carcinoma cell clone number that nasopharyngeal carcinoma cell clone number-2 '-OMe-dsRNA21 that 2 '-OMe-NC processes processes)/2 '-OMe-NC processes), result as shown in Figure 1.
Result demonstration, nasopharyngeal carcinoma cell is when 2 '-OMe-dsRNA21 processes 48h, and 2 '-OMe-dsRNA21 has suppressed 27.7% nasopharyngeal carcinoma cell propagation; When 2 '-OMe-dsRNA21 processes 72h, 2 '-OMe-dsRNA21 has suppressed 33.7% nasopharyngeal carcinoma cell propagation; When 2 '-OMe-dsRNA21 processes 96h, 2 '-OMe-dsRNA21 has suppressed 30.7% nasopharyngeal carcinoma cell propagation; When 2 '-OMe-dsRNA21 processes 10 days, clone's number of nasopharyngeal carcinoma cell is 147 ± 14, and clone's number of the nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC is 320 ± 13, and 2 '-OMe-dsRNA21 has suppressed 54.1% nasopharyngeal carcinoma cell propagation.Show to compare with the nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC, clone's number of the nasopharyngeal carcinoma cell of processing through 2 '-OMe-dsRNA21 obviously reduces, and illustrates that 2 '-OMe-dsRNA21 can significantly suppress the propagation of nasopharyngeal carcinoma cell.
The impact of embodiment 3,2 '-OMe-dsRNA21 cell cycle
In triplicate, the method for each experiment is as follows in experiment:
With the DMEM fluid medium (10%FBS-DMEM fluid medium, GIBCO product) containing 10% hyclone, cultivate nasopharyngeal carcinoma cell and cultivate 18 hours, obtain DMEM cell culture fluid.DMEM cell culture fluid is centrifugal under 4 ℃ 5000 revs/min, obtain nasopharyngeal carcinoma cell.With the resuspended nasopharyngeal carcinoma cell of DMEM fluid medium containing 10% hyclone that does not add penicillin and streptomycin, with liquid-transfering gun piping and druming evenly, obtain nasopharyngeal carcinoma cell FBS-DMEM culture fluid.With the DMEM fluid medium containing 10% hyclone that does not add penicillin and streptomycin, adjust cell concentration in nasopharyngeal carcinoma cell culture fluid, obtaining cell concentration is 2,000, the nasopharyngeal carcinoma cell Cell sap of 000 cell/mL, this Cell sap is divided and planted in 6 orifice plates, every hole 100 μ L, i.e. every Kong Zhonghan 200,000 nasopharyngeal carcinoma cell, obtains 6 orifice plates that contain nasopharyngeal carcinoma cell liquid.
Get respectively lipofectamine 2000 (Invitrogen) 5 μ L, in embodiment 22 '-OMe-dsRNA21 solution 10 μ L, be diluted in respectively in 250 μ L serum-free mediums (Opti-MEM), obtain respectively 2 '-OMe-dsRNA21 serum-free medium and lipofectamine 2000 serum-free mediums, lipofectamine 2000 serum-free mediums are at room temperature hatched 5 minutes, then 2 '-OMe-dsRNA21 serum-free medium is mixed with lipofectamine 2000 serum-free mediums, obtain 2 '-OMe-dsRNA21-liposome complex culture fluid.By 2 '-OMe-dsRNA21-liposome complex culture fluid standing 20 minutes in room temperature.The ratio that is 1:3 according to volume ratio by the DMEM culture fluid of above-mentioned 2 '-OMe-dsRNA21-liposome complex culture fluid and serum-free is got 2mL after mixing, and is added in 6 orifice plates of above-mentioned nasopharyngeal carcinoma cell liquid, obtains 2 '-OMe-dsRNA21 cell culture fluid.By 2 '-OMe-dsRNA21 cell culture fluid on Tissue Culture Plate at 5%CO
2in the incubator of 37 ℃, cultivate 6 hours, obtain 2 '-OMe-dsRNA21 transfectional cell liquid, 2 '-OMe-dsRNA21 transfectional cell liquid is centrifugal under 4 ℃ 5000 revs/min, obtain the cell after 2 '-OMe-dsRNA21 transfection, by the resuspended nasopharyngeal carcinoma cell of DMEM culture medium containing 10% hyclone for the cell after 2 '-OMe-dsRNA21 transfection, with liquid-transfering gun piping and druming evenly, obtain the cell culture fluid of 2 '-OMe-dsRNA21 transfection, by the cell culture fluid of 2 '-OMe-dsRNA21 transfection in containing 5%CO
2the incubator of 37 ℃ in continue to cultivate 48 hours, obtain 2 '-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM culture fluid.
According to the method described above, 2 '-OMe-dsRNA21 is replaced with to 2 '-OMe-NC, other operating procedures are constant, obtain 2 '-OMe-NC nasopharyngeal carcinoma cell FBS-DMEM culture fluid.
After 48 hours, respectively with the nasopharyngeal carcinoma cell in synchronous nasopharyngeal carcinoma cell and the 2 '-OMe-NC nasopharyngeal carcinoma cell FBS-DMEM culture fluid processed in 2 '-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM culture fluid of hydroxyurea, make nasopharyngeal carcinoma cell in the G1 phase, other operations are all carried out according to Click-iT EdU Alexa Fluor 488 fluorometric reagent boxes (Life Technologies, C10337) description.
Under laser confocal microscope, observe the nasopharyngeal carcinoma cell in nasopharyngeal carcinoma cell and the 2 '-OMe-NC nasopharyngeal carcinoma cell FBS-DMEM culture fluid in 2 '-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM culture fluid, and use imaging software quantitative Analysis, result is as shown in Figure 2.
Result shows, the percentage ratio that contains Edu cell in the S phase nasopharyngeal carcinoma cell of processing through 2 '-OMe-dsRNA21 is 21.94 ± 3.08%, the percentage ratio that contains Edu cell in the S phase nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC is 37.5 ± 4.49%, show to compare with the nasopharyngeal carcinoma cell of transfection 2 '-OMe-NC, the cell that the nasopharyngeal carcinoma cell S phase of transfection 2 '-OMe-dsRNA21 is contained Edu significantly reduces.
The inhibitory action of embodiment 4,2 '-OMe-dsRNA21 to expression of target gene
Get 2 in embodiment 3 '-OMe-dsRNA21 nasopharyngeal carcinoma cell FBS-DMEM culture fluid and 2 '-OMe-NC nasopharyngeal carcinoma cell FBS-DMEM culture fluid, cultivate after 42 hours, collect respectively the nasopharyngeal carcinoma cell of nasopharyngeal carcinoma cell and the 2 '-OMe-NC transfection of 2 '-OMe-dsRNA21 transfection, carry out respectively Cyclin dependent kinase 4 (cyclin dependent kinase 4, CDK4) detection of expression of gene and cyclinD3 (cyclin D3, CCND3) gene.
In triplicate, the step that at every turn repeats experiment is as follows in experiment:
The total RNA that extracts the nasopharyngeal carcinoma cell of 2 '-OMe-dsRNA21 transfection according to the method for TRIzol extraction RNA, obtains containing the total RNA of 2 of DNA '-OMe-dsRNA21.With DNase I (RNase-free) (TaKaRa) at 37 ℃ digestion process contain the total RNA of 2 of DNA '-OMe-dsRNA21 30 minutes, degraded contains the DNA in the total RNA of 2 of DNA '-OMe-dsRNA21, obtains containing the total RNA of 2 of DNA '-OMe-dsRNA21 after DNA degradation.According to the DNase I description of product, again extract the RNA in the total RNA of 2 of DNA '-OMe-dsRNA21 that contains after DNA degradation, obtain the total RNA of 2 '-OMe-dsRNA21.The total RNA of 2 of 1 μ g '-OMe-dsRNA21 is mixed with the 50 μ M Oligo dT (16-18) (Takara company product) of 0.5 μ g, heat 5 minutes, be cooled to rapidly 0 ℃ and obtain.M-MLV reverse transcriptase system by TaKaRa company adds respectively buffer, and hatches 1 hour in 42 ℃, obtains 2 '-OMe-dsRNA21 cDNA.
According to the method described above, the nasopharyngeal carcinoma cell of 2 '-OMe-dsRNA21 transfection is replaced with to the nasopharyngeal carcinoma cell of 2 '-OMe-NC transfection, other steps are constant, obtain 2 '-OMe-NC cDNA.
(primer of CCND3 is CCND3F:TACCCGCCATCCATGATCG to target gene CCND3 for template that the 2 '-OMe-dsRNA21cDNA of take is PCR reaction, CCND3R:AGGCAGTCCACTTCAGTGC) and CDK4 (primer of CDK4 is: CDK4F:CCTACCTTTATATTTGGGGTCCT, CDK4R:GGCCCTGTAATTTAACCAGT) carry out sxemiquantitative PCR detection, internal reference is that (primer of GAPDH is GAPDH: GAPDHF:GGAGCGAGATCCCTCCAAAAT, GAPDHR:GGCTGTTGTCATACTTCTCATGG), after PCR has reacted, PCR product is carried out to agarose gel electrophoresis, result is as shown in A in Fig. 3.Result shows, through 2 '-OMe-dsRNA21 and CDK4 gene and CCND3 gene in the nasopharyngeal carcinoma cell of 2 '-OMe-NC processing, all have expression, the CDK4 gene in the nasopharyngeal carcinoma cell after 2 '-OMe-dsRNA21 processes and the expression of CCND3 gene all decrease.With the negative control group comparison of transfection small nucleic acids, the transfection 2 '-CCND3 of the obvious inhibition tumor cell of OMe-dsRNA21 and expression of CDK4.
To take respectively above-mentioned 2 '-OMe-dsRNA21cDNA and above-mentioned 2 '-OMe-NC cDNA be template, take GAPDH as internal reference (primer of GAPDH is GAPDHF:GGAGCGAGATCCCTCCAAAAT, GAPDHR:
GGCTGTTGTCATACTTCTCATGG), the real time fluorescent quantitative that carries out CDK4 gene and CCND3 gene expression according to Syb test kit operation instruction detects, the primer of CDK4 gene is: CDK4F:CCTACCTTTATATTTGGGGTCCT, CDK4R:GGCCCTGTAATTTAACCAGT, the primer pair of CCND3 gene is: CCND3F:
TACCCGCCATCCATGATCG, CCND3R:AGGCAGTCCACTTCAGTGC, result is as shown in B in Fig. 3.Result shows, in the nasopharyngeal carcinoma cell that 2 '-OMe-dsRNA21 processes the expression of CDK4 gene be CDK4 gene in the nasopharyngeal carcinoma cell of 2 '-OMe-NC processing expression 74.3%, in the nasopharyngeal carcinoma cell that 2 '-OMe-dsRNA21 processes the expression of CCND3 gene be CCND3 gene in the nasopharyngeal carcinoma cell of processing through 2 '-OMe-NC expression 60.8%, show that CDK4 gene in the nasopharyngeal carcinoma cell after 2 '-OMe-dsRNA21 processing and the expression of CCND3 gene all decrease.
The preparation of embodiment 5,2 '-OMe-dsRNA21 lyophilized injectable powder
1, dosing
Use the water for injection without RNA enzyme to dissolve 2 in embodiment 1 '-OMe-dsRNA21, obtain without 2 of RNA enzyme '-OMe-dsRNA21 solution, this content without 2 '-OMe-dsRNA21 in 2 of RNA enzyme '-OMe-dsRNA21 solution is 2.29 μ g/ μ L; Freeze drying protectant mannitol 4.4g is used without the water for injection of RNA enzyme and dissolved, and with sodium hydroxide solution and hydrochloric acid solution, to regulate its pH be 6-7, benefit injects water to 100mL, obtains frozen-dried protective agent solution; According to 1mL, without 2 of RNA enzyme '-OMe-dsRNA21 solution, mix with the volume ratio of 50mL frozen-dried protective agent solution, obtain 2 '-OMe-dsRNA21 protective agent mixed liquor.
2, lyophilizing
Pre-freeze: above-mentioned 2 '-OMe-dsRNA21 protective agent mixed liquor subpackage is better than in cillin bottle, and precooling spends the night in-80 ℃ of refrigerators.Lyophilization: by 2 of precooling '-OMe-dsRNA21 protective agent mixed liquor evacuation, then lyophilization under lucifuge condition, obtains 2 '-OMe-dsRNA21 lyophilized injectable powder.
According to the method described above, 2 '-OMe-dsRNA21 is replaced with to 2 in embodiment 1 '-OMe-NC, other are all constant, obtain 2 '-OMe-NC lyophilized injectable powder.
By the sealing of 2 '-OMe-dsRNA21 lyophilized injectable powder and 2 '-OMe-NC lyophilized injectable powder, cryopreservation.
The inhibitory action of embodiment 6,2 '-OMe-dsRNA21 to tumor growth
10 of the male BALB/C nude mices of getting 4 week age, at the dorsal part alar part subcutaneous injection 0.1mL of every nude mice nasopharyngeal carcinoma cell suspension, (in nasopharyngeal carcinoma cell suspension, nasopharyngeal carcinoma cell content is 3 * 10 respectively
5individual cell/mL), after 10 days, become tumor, obtain altogether the BALB/C nude mice of 10 subcutaneous formation transplanted tumoies of dorsal part alar part.The BALB/C nude mice of above-mentioned 10 subcutaneous formation transplanted tumoies of dorsal part alar part is divided into two groups at random, 5 every group, is respectively NC group nude mice and dsRNA21 group nude mice.
With the sterilized water 11.3 μ L without RNA enzyme, dissolve 2 '-OMe-dsRNA21 lyophilized injectable powder in 20 μ g embodiment 5, and add transfection reagent jetPEI (Polyplus company product) 1.2 μ L, obtain the mixed solution of 2 '-OMe-dsRNA21 and jetPEI, to adding in the mixed solution of 2 '-OMe-dsRNA21 and jetPEI, it is isopyknic 10% glucose solution of this solution, mix homogeneously, obtaining cumulative volume is 2 of 25 μ l '-OMe-dsRNA21 injection.According to the method described above, 2 in embodiment 5 '-OMe-dsRNA21 lyophilized injectable powder is replaced with to 2 in embodiment 5 '-OMe-NC lyophilized injectable powder, other are all constant, and obtaining cumulative volume is 2 of 25 μ l '-OMe-NC injection.
To NC, organize the above-mentioned 2 '-OMe-NC injection of the transplanting intratumor injection 25 μ l of every nude mice in nude mice, injection was designated as the 0th day of experiment the same day, every nude mice was injected once above-mentioned 2 of 20 μ g2 '-OMe-NC '-OMe-NC injection, the 25 μ l that contain every 1 day, injected altogether 5 times; To dsRNA21, organize the above-mentioned 2 '-OMe-dsRNA21 injection of the transplanting intratumor injection 25 μ l of every nude mice in nude mice, injection was designated as the 0th day of experiment the same day, every nude mice was injected once above-mentioned 2 of 20 μ g2 '-OMe-dsRNA21 '-OMe-dsRNA21 injection, the 25 μ l that contain every 1 day, injected altogether 5 times.Before per injection injection, (the 10th day of experiment) two days later of (i.e. experiment the 0th day, the 2nd day, the 4th day, the 6th day, the 8th day) and the 5th injection measures respectively with vernier caliper measurement the major diameter (L) of tumor and the transverse diameter (S) that NC group nude mice and dsRNA21 organize nude mice, and calculates the approximate volumes of tumor.Computing formula is: V (mm
3)=0.5 * L * S
2.In (the 10th day of experiment) two days later of nude mice the 5th injection of every group, to take out the tumor of every nude mice in every group, and measure gross tumor volume, weighing tumor weight, Taking Pictures recording, result is as shown in Figure 4.
Experimental result demonstration, the average weight of NC group nude mice tumor is 0.043g ± 0.015g, the average weight of dsRNA21 group nude mice tumor is 0.023g ± 0.0084g.Injection is in the time of two days, and the average external volume of NC group nude mice tumor is 30.74mm
3, the average external volume of dsRNA21 group nude mice tumor is 20.53mm
3; Injection is in the time of four days, and the average external volume of NC group nude mice tumor is 37.74mm
3, the average external volume of dsRNA21 group nude mice tumor is 30.41mm
3; Injection is in the time of six days, and the average external volume of NC group nude mice tumor is 65.20mm
3, the average external volume of dsRNA21 group nude mice tumor is 45.27mm
3; Injection is in the time of eight days, and the average external volume of NC group nude mice tumor is 75.21mm
3, the average external volume of dsRNA21 group nude mice tumor is 51.94mm
3; Injection is in the time of ten days, and the average external volume of NC group nude mice tumor is 93.97mm
3, the average external volume of dsRNA21 group nude mice tumor is 73.05mm
3.Result shows, compares with NC group nude mice, and the increase of dsRNA21 group nude mice tumor weight, gross tumor volume is obviously little, and 2 '-OMe-dsRNA21 injection has obviously suppressed the growth of nude mice tumor.
Claims (10)
1. double-stranded RNA or its trim application in preparing tumor inhibitor or inhibiting tumour cells agent, a chain-ordering of described double-stranded RNA is SEQ ID No.1 in sequence table, another of described double-stranded RNA chain-ordering is SEQ ID No.2 in sequence table.
2. application according to claim 1, is characterized in that: the trim of described double-stranded RNA is through following A 1) or A2) or A3) modify the double-stranded RNA trim obtain:
A1) 2 of the ribose of described double-stranded RNA '-OH is modified;
A2) phosphodiester bond of the connection nucleotide of described double-stranded RNA is modified;
A3) 5 of the ribose of described double-stranded RNA ' end is connected to the modification of cholesterol.
3. the application of the biomaterial relevant to double-stranded RNA described in claim 1 or 2 in preparing tumor inhibitor or inhibiting tumour cells agent, described biomaterial is following B1)-B12) in any:
B1) DNA molecular of double-stranded RNA described in coding claim 1 or 2;
B2) contain B1) expression cassette of described DNA molecular;
B3) contain B1) recombinant vector of described DNA molecular;
B4) contain B2) recombinant vector of described expression cassette;
B5) contain B1) recombinant microorganism of described DNA molecular;
B6) contain B2) recombinant microorganism of described expression cassette;
B7) contain B3) recombinant microorganism of described recombinant vector;
B8) contain B4) recombinant microorganism of described recombinant vector;
B9) contain B1) transgenetic animal cell of described DNA molecular system;
B10) contain B2) transgenetic animal cell of described expression cassette system;
B11) contain B3) transgenetic animal cell of described recombinant vector system;
B12) contain B4) transgenetic animal cell of described recombinant vector system;
B13) contain B1) transgenic plant cells of described DNA molecular system.
4. according to arbitrary described application in claim 1-3, it is characterized in that: described tumor inhibitor is for suppressing the inhibitor of tumorigenic inhibitor and/or inhibition tumor growth.
5. according to arbitrary described application in claim 1-3, it is characterized in that: described inhibiting tumour cells agent is the product of inhibition tumor cell propagation and/or the product that promotes apoptosis of tumor cells.
Following M1) or purposes M2) 6.:
M1) application of the trim of the double-stranded RNA described in claim 1 or 2 or described double-stranded RNA in preparing inhibition tumor cell cyclin D expression reagent;
M2) application of the trim of the double-stranded RNA described in claim 1 or 2 or described double-stranded RNA in preparing inhibition tumor cell Cyclin dependent kinase 4 expression reagent.
Following M3) or purposes M4) 7.:
M3) application of the biomaterial described in claim 3 in preparing inhibition tumor cell cyclin D expression reagent;
M4) application of the biomaterial described in claim 3 in preparing inhibition tumor cell Cyclin dependent kinase 4 expression reagent.
8. treat and/or prevent the product of tumor, its active component is the trim of the double-stranded RNA described in claim 1 or 2 or described double-stranded RNA.
9. treat and/or prevent the product of tumor, its active component is the biomaterial described in claim 3.
10. product according to claim 8 or claim 9, is characterized in that: described in treat and/or prevent tumor product be the medicine that treats and/or prevents tumor, the dosage form of described medicine is injectable powder.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410383877.3A CN104147616B (en) | 2014-08-06 | 2014-08-06 | The application of double-stranded RNA or its trim in tumor inhibitor is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410383877.3A CN104147616B (en) | 2014-08-06 | 2014-08-06 | The application of double-stranded RNA or its trim in tumor inhibitor is prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104147616A true CN104147616A (en) | 2014-11-19 |
| CN104147616B CN104147616B (en) | 2018-03-02 |
Family
ID=51873375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410383877.3A Active CN104147616B (en) | 2014-08-06 | 2014-08-06 | The application of double-stranded RNA or its trim in tumor inhibitor is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104147616B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104667299A (en) * | 2015-02-28 | 2015-06-03 | 清华大学深圳研究生院 | Application of double-stranded RNA and anti-tumor composition related to double-stranded RNA in preparation of tumor cell inhibitor |
| CN106924757A (en) * | 2015-12-31 | 2017-07-07 | 中国科学院遗传与发育生物学研究所 | MiR-449c-5p and its plan are preparing the application in treating and preventing heart valve disease product like thing |
| CN110302388A (en) * | 2019-06-28 | 2019-10-08 | 浙江大学 | A kind of cholesterol modification microRNA is preparing the application in CamK-A inhibitor |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101555519A (en) * | 2008-04-10 | 2009-10-14 | 上海市肿瘤研究所 | Gene chip and application thereof |
| WO2011028550A1 (en) * | 2009-08-24 | 2011-03-10 | Merck Sharp & Dohme Corp. | Segmented micro rna mimetics |
| CN102140471A (en) * | 2011-01-10 | 2011-08-03 | 清华大学深圳研究生院 | Oligo-nucleic acid for suppressing tumor growth and application thereof |
-
2014
- 2014-08-06 CN CN201410383877.3A patent/CN104147616B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101555519A (en) * | 2008-04-10 | 2009-10-14 | 上海市肿瘤研究所 | Gene chip and application thereof |
| WO2011028550A1 (en) * | 2009-08-24 | 2011-03-10 | Merck Sharp & Dohme Corp. | Segmented micro rna mimetics |
| CN102140471A (en) * | 2011-01-10 | 2011-08-03 | 清华大学深圳研究生院 | Oligo-nucleic acid for suppressing tumor growth and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 付超: ""低氧情况下miR-188-5p以cyclin D1为靶基因抑制CNE细胞增殖"", 《中国硕士学位论文全文数据库（电子期刊）医药卫生科技辑》 * |
| 房锋: ""MiR-188-5p靶向AAC11抑制肝细胞癌生长和侵袭转移的研究"", 《中国博士学位论文全文数据库（电子期刊）医药卫生科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104667299A (en) * | 2015-02-28 | 2015-06-03 | 清华大学深圳研究生院 | Application of double-stranded RNA and anti-tumor composition related to double-stranded RNA in preparation of tumor cell inhibitor |
| CN106924757A (en) * | 2015-12-31 | 2017-07-07 | 中国科学院遗传与发育生物学研究所 | MiR-449c-5p and its plan are preparing the application in treating and preventing heart valve disease product like thing |
| CN106924757B (en) * | 2015-12-31 | 2020-07-24 | 中国科学院遗传与发育生物学研究所 | Application of miR-449c-5p and mimic thereof in preparation of products for treating and preventing heart valve diseases |
| CN110302388A (en) * | 2019-06-28 | 2019-10-08 | 浙江大学 | A kind of cholesterol modification microRNA is preparing the application in CamK-A inhibitor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104147616B (en) | 2018-03-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2017200853B2 (en) | MiRNA and its diagnostic therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated BRAF pathway | |
| JP6457645B2 (en) | RNA interference agent for regulating GST-π gene | |
| CN104147616A (en) | Application of dsRNA or modification thereof in preparation of tumor inhibitor | |
| US10150966B2 (en) | RNA sequence having anti-tumour activity | |
| CN113476606B (en) | Application of UPK1A-AS1 inhibitor in preparation of antitumor drugs | |
| CN104531709A (en) | siRNA dual-interference composition for inhibiting growth and metastasis of tumors and application thereof | |
| CN104667299A (en) | Application of double-stranded RNA and anti-tumor composition related to double-stranded RNA in preparation of tumor cell inhibitor | |
| CN101270358A (en) | MiRNA sequence and uses thereof | |
| CN104928353A (en) | Applications of human DGKZ gene and related drugs thereof | |
| CN104894224A (en) | Use and related drugs of human CKIP1 gene | |
| CN108642176A (en) | Applications of the PART1 as breast cancer diagnosis, treatment and prognostic marker | |
| CN101215563A (en) | KDR siRNA and application thereof | |
| JP6600389B2 (en) | RNA interference agent for regulating GST-π gene | |
| CN101787368B (en) | siRNA for restraining Z38 gene expression of human being and application thereof in preparing breast-tumor resisting medicine | |
| CN102140462B (en) | Human miR-1260 antisense nucleic acid and application thereof | |
| CN105779452A (en) | Oligonucleotide capable of inhibiting tumor growth and application of oligonucleotide | |
| CN103937800A (en) | Targeted-polygene siRNA (small interfering ribonucleic acid) molecule and application thereof in inhibiting tumors | |
| CN103320440A (en) | SiRNA specifically inhibiting breast cancer MDA-MB-468 cell proliferation, and application thereof | |
| CN113930423A (en) | SaRNA for protecting myocardial cells from stress injury and application thereof | |
| CN103157114A (en) | Purposes and related medicines of human ZNF786 gene | |
| CN116808215A (en) | Application of LINC02159 serving as therapeutic target in preparation of medicines for preventing and treating non-small cell lung cancer | |
| CN103656673A (en) | Application of human YWHAQ gene and related drugs thereof | |
| CN103667431A (en) | Applications and human related drugs of CCCH-type zinc finger protein expression gene | |
| CN106860877A (en) | A kind of utilization microRNA improves the application of antineoplastic sensitiveness | |
| WO2017213851A1 (en) | Inhibitory rna-based therapeutics targeting anln for cancer treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |